ID: 957149146

View in Genome Browser
Species Human (GRCh38)
Location 3:76462978-76463000
Sequence GACCTACACACTGTTCAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 70}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957149146_957149148 8 Left 957149146 3:76462978-76463000 CCAGTCTGAACAGTGTGTAGGTC 0: 1
1: 0
2: 0
3: 5
4: 70
Right 957149148 3:76463009-76463031 TTGCCCATCACCGCATTACATGG 0: 1
1: 0
2: 1
3: 1
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957149146 Original CRISPR GACCTACACACTGTTCAGAC TGG (reversed) Intronic
904046490 1:27612347-27612369 CACATACACACTATTCAGAGAGG + Exonic
917969754 1:180199041-180199063 GGGCTACACACTGTGCAGCCCGG - Exonic
923483134 1:234403401-234403423 GAAATACAGACTGTTCAGTCTGG - Intronic
924606247 1:245538098-245538120 GACCTACTCACTGCTCTGAGAGG + Intronic
1073372962 10:103007189-103007211 GACCTACTCCCTGTTCGTACAGG - Intronic
1074652533 10:115540279-115540301 GGGCTACCCACTGTTCAGTCCGG - Intronic
1080062967 11:27977014-27977036 GACCAAGACACTGTCCAGACTGG - Intergenic
1108818352 13:54317200-54317222 GACCTCCTCACTGTTGAGAAAGG + Intergenic
1109480002 13:62939412-62939434 AACCTCCAAACTGTTCAGAGTGG - Intergenic
1113291264 13:108909372-108909394 TGACTACACACTGTTCACACTGG + Intronic
1121182565 14:91940562-91940584 TACCTAAACACTGTCCTGACTGG + Exonic
1123107824 14:105851180-105851202 GGCCCCCACACTGTGCAGACAGG + Intergenic
1129661981 15:77558009-77558031 GACCTCCACACTGGGCAGACTGG - Intergenic
1131953065 15:97702637-97702659 GACCAACAAAGTGATCAGACAGG + Intergenic
1142932606 17:3299599-3299621 GTCCTACTCCCTGTTCAAACAGG + Intergenic
1157823620 18:50792303-50792325 GATCTACACACTGTGCAGAGTGG - Intergenic
1163904264 19:20137776-20137798 GACCTCCTCACTTTCCAGACTGG - Intergenic
924989316 2:298135-298157 GACCTACACACTATAAAGAAAGG - Intergenic
925874724 2:8302056-8302078 AACCTACTCAGGGTTCAGACTGG + Intergenic
926446745 2:12952067-12952089 GACCATCACATTGTTCAGCCTGG + Intergenic
926942893 2:18156575-18156597 GACTTACACACAGCTCTGACAGG - Intronic
928701710 2:33904567-33904589 GACCTCCTCACTGTTGAGAAAGG - Intergenic
928798958 2:35063551-35063573 GATCTAAACACTGTTCAGTATGG - Intergenic
936168852 2:110149793-110149815 CACCCACACACTGTCAAGACTGG - Intronic
937571354 2:123366600-123366622 TACCTACACCCTGTTCAAAAAGG + Intergenic
1169846751 20:10002122-10002144 GACATACAGACAGTTCAGAAAGG - Intronic
1171323080 20:24264173-24264195 GATCTACACACTCTACACACAGG - Intergenic
1174555165 20:51389853-51389875 TGCCTACAGACTGTACAGACTGG + Exonic
1176410973 21:6449326-6449348 CACCTACACGCAGTTCAAACAGG - Intergenic
1178697134 21:34803108-34803130 GACAGACACACTCTTCAGGCTGG + Intronic
1179686466 21:43057648-43057670 CACCTACACGCAGTTCAAACAGG - Intronic
1182206858 22:28636647-28636669 GACCTACAAACTGCTAAGAGGGG - Intronic
1183513149 22:38247702-38247724 AACCCACACTCTGTTCAGCCAGG + Intronic
1185176620 22:49331013-49331035 GACCTAAAGGCTGTTCTGACCGG - Intergenic
951239878 3:20275221-20275243 GACCTCCTCACTGTTGAGAAAGG + Intergenic
955441036 3:58955769-58955791 GAGCTACAAACTGTGCAGCCTGG - Intronic
957149146 3:76462978-76463000 GACCTACACACTGTTCAGACTGG - Intronic
958016995 3:87949838-87949860 GACCAAGACATTGTTCAAACTGG - Intergenic
960844430 3:121993495-121993517 CACCCATACACTGGTCAGACAGG - Exonic
963615323 3:147529406-147529428 GACATACACAGTGTTCAGGTTGG - Intergenic
964804033 3:160587385-160587407 GACCTGCAAGCTGTTCAGCCTGG - Intergenic
965139716 3:164817793-164817815 GACCTCCTCACTGTTGAGAAAGG + Intergenic
967825350 3:193873105-193873127 GACCTACCCACTGTGCAGGGAGG - Intergenic
971088867 4:23315906-23315928 GACATACAAACTGTTGAAACTGG - Intergenic
974141410 4:57892989-57893011 TACCTACAATCTGTTCAGATTGG - Intergenic
977609397 4:99016783-99016805 GATCTACACCCTGGCCAGACAGG - Intronic
983157584 4:164370169-164370191 GACATACACTCTGTTGAGATTGG - Intronic
983564218 4:169132546-169132568 GACATACTCACCCTTCAGACTGG - Intronic
989239020 5:39182229-39182251 CACCTGCACTCTGTTCACACTGG - Intronic
996848268 5:127924711-127924733 CACCTATCCATTGTTCAGACAGG - Intergenic
998397719 5:141829766-141829788 GACCCACACCCTGTGCAGACTGG + Intergenic
998713029 5:144848523-144848545 GACCTCCTCACTGTTGAGAAAGG - Intergenic
1006417957 6:33916013-33916035 TACCTCCACACTCTTCAGCCAGG - Intergenic
1007316029 6:40989959-40989981 GAACTACACACCGTGCAGAGGGG + Intergenic
1010370544 6:75101988-75102010 GACCAACTCACTGTTCGGCCTGG + Exonic
1013283223 6:108658375-108658397 TACCTACAGAAAGTTCAGACAGG - Intronic
1018875553 6:167819318-167819340 GAGCTACACACTGTGGACACAGG - Intergenic
1021337437 7:19420881-19420903 TTCCCACACACTGTTCAGAAGGG - Intergenic
1022960616 7:35422925-35422947 GACATACTCACTGTTCACCCTGG - Intergenic
1030797445 7:113806108-113806130 GACCTCGACTCTGCTCAGACTGG - Intergenic
1031896032 7:127348357-127348379 TACCTACAAACTTTTCATACAGG + Intronic
1033599197 7:142876791-142876813 GATCTCCTCACTGTTCACACAGG + Exonic
1034233957 7:149554235-149554257 GACCTCCTCACTTCTCAGACGGG - Intergenic
1038784251 8:30596647-30596669 GAACAACACACTATTGAGACAGG - Intronic
1042475614 8:69245515-69245537 GACCTCCTCACTTTCCAGACTGG - Intergenic
1043991674 8:86763250-86763272 GACTTACACAGACTTCAGACAGG - Intergenic
1052056981 9:23917500-23917522 GACCTCCTCACTGCTGAGACAGG - Intergenic
1054754212 9:68940769-68940791 GGCCTACACTCTATTCAAACAGG + Exonic
1058035728 9:100250457-100250479 GACCTAGACAAGATTCAGACAGG - Intronic
1059334759 9:113561970-113561992 AAACTCCACACTGTTCAGACAGG - Intronic
1188378154 X:29458477-29458499 CACACACACACTGTTCAGATGGG + Intronic
1192630349 X:72773019-72773041 GCCCCACACACTGCTCACACTGG - Intergenic
1192651361 X:72947785-72947807 GCCCCACACACTGCTCACACTGG + Intergenic
1197118299 X:122860204-122860226 GACCTGAACAATGTTCAGGCCGG - Intergenic
1197713509 X:129689115-129689137 AACCTACCCACTGGTCAGATTGG - Intergenic
1201743652 Y:17348574-17348596 GACCTCCTCACTGTTGAGAAAGG - Intergenic