ID: 957150061

View in Genome Browser
Species Human (GRCh38)
Location 3:76475334-76475356
Sequence TTGAATGAGGATGAAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 463
Summary {0: 1, 1: 0, 2: 2, 3: 49, 4: 411}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957150061 Original CRISPR TTGAATGAGGATGAAGTGGA AGG Intronic
900826213 1:4929323-4929345 TTGCAGGGGGATGAGGTGGAGGG - Intergenic
902295114 1:15461872-15461894 CTGAGGGAGGATGAAGAGGAGGG + Intronic
902297979 1:15481411-15481433 CTGAGGGAGGATGAAGAGGAGGG + Intronic
902741838 1:18444252-18444274 TTGAATGGGAAGGAACTGGAAGG - Intergenic
904565471 1:31425803-31425825 CTGGATGAGGATGAAGAGGAAGG - Exonic
904883370 1:33717289-33717311 TGTAAGGAGGATGAAGTGGAGGG + Intronic
906964254 1:50441179-50441201 TTGAAGGAGGGTGAAGTGCAGGG + Exonic
907089241 1:51709297-51709319 TTGCATGGGGAAGCAGTGGATGG - Intronic
907440221 1:54474355-54474377 TTGCAAGAGGGAGAAGTGGAGGG - Intergenic
908562293 1:65318915-65318937 TTGATTTAGGAGGAAGGGGAGGG + Intronic
909858900 1:80578080-80578102 TTGAATGATGATGATGTTAATGG + Intergenic
910125180 1:83832898-83832920 TTGGAAGGGGCTGAAGTGGAGGG - Intergenic
910354539 1:86340544-86340566 TTGAATGAGGAAAAAGAGGTAGG - Intergenic
910749705 1:90615567-90615589 ATGGATGAGGATTGAGTGGAGGG - Intergenic
911273311 1:95829935-95829957 TGAAATGGGGTTGAAGTGGAGGG - Intergenic
911740087 1:101377631-101377653 TGGAATTAGGAGGAAGTGGTTGG + Intergenic
912396673 1:109350401-109350423 CTTAAAGAGGATGGAGTGGAGGG - Intronic
912648252 1:111415376-111415398 TAGGATGAGAATGAAGTGGTAGG - Intronic
913564391 1:120057667-120057689 CTGAATAAGTAAGAAGTGGATGG - Intronic
913633737 1:120735897-120735919 CTGAATAAGTAAGAAGTGGATGG + Intergenic
914284978 1:146217016-146217038 CTGAATAAGTAAGAAGTGGATGG - Intronic
914546009 1:148667755-148667777 CTGAATAAGTAAGAAGTGGATGG - Intronic
914620555 1:149402911-149402933 CTGAATAAGTAAGAAGTGGATGG + Intergenic
915072426 1:153281617-153281639 TTGGATGTGGATGAAGAGGAAGG + Intergenic
915142555 1:153776402-153776424 TTGGATGAGGGTGAAGGGTATGG - Intronic
915595521 1:156894467-156894489 TTGAGGGAGGATGTAGGGGAAGG + Intronic
915608036 1:156966937-156966959 TGGCTTGAGGACGAAGTGGATGG - Intronic
915702570 1:157810188-157810210 AAGAATGAGGAAGAAGTGTAAGG + Intronic
915824779 1:159063868-159063890 TAGACTGAGGAGGAAGAGGAGGG - Intronic
917024075 1:170622930-170622952 TTGTAGGAGGATGGAATGGAGGG - Intergenic
917175021 1:172224494-172224516 TTTGATGAAGATGAGGTGGATGG + Intronic
919730264 1:200909136-200909158 AAGAATGGGGATGCAGTGGAAGG - Intronic
920199760 1:204252338-204252360 TGGGATGAGGAGGAAGAGGAAGG + Intronic
920382670 1:205544601-205544623 TTGAATTAGGATGAGGAAGAGGG - Intergenic
920662797 1:207932098-207932120 AAGAAAAAGGATGAAGTGGAGGG - Intergenic
921258394 1:213363208-213363230 TTGAATGATGATGCAGAGGCAGG - Intergenic
921261544 1:213388926-213388948 TAGAGTTAGGATGAAGGGGAAGG + Intergenic
921290999 1:213657378-213657400 TTGGATGATGAAGAATTGGAGGG + Intergenic
921592163 1:217016894-217016916 TTGCATGAGGATAAACTGTATGG - Intronic
921775931 1:219100175-219100197 TTTAAAGAGGATGAAGAGGCTGG + Intergenic
922659577 1:227418299-227418321 TTGACTGATGAAGAAATGGAAGG - Intergenic
923802636 1:237225427-237225449 GAGAATGAGGGTGAAGTGAAAGG + Intronic
924877567 1:248122104-248122126 TTGACTGAGGAGGAAGTACATGG - Intergenic
924879557 1:248145320-248145342 TTGACTGAGGAGGAAGTACATGG - Exonic
924887844 1:248239101-248239123 TTGACTGAGGAGGAAGTACATGG - Exonic
1063129826 10:3168660-3168682 GAGAATGAGGATCAAGTGAAGGG - Intronic
1063254094 10:4307399-4307421 TTGAATGAATTTGCAGTGGAAGG + Intergenic
1063522333 10:6752238-6752260 CAGAATGAGGATGAAGTGCTGGG - Intergenic
1063714127 10:8510457-8510479 TTGAATGAGAGTGAAGAGGATGG - Intergenic
1063915572 10:10878598-10878620 AGGACTGAGGCTGAAGTGGAGGG - Intergenic
1064322102 10:14315120-14315142 TTGAAAGGGGAGGGAGTGGAAGG - Intronic
1065311109 10:24416734-24416756 TGGAGGGAGGATGAAGAGGAGGG - Intronic
1066302520 10:34109367-34109389 TTGGATGAGGATGGAGAGGGGGG - Intergenic
1067040253 10:42948461-42948483 TTGAAAAAGGATAAAGTGGGAGG + Intergenic
1067665062 10:48270697-48270719 TTGAAAGAGGAGGAGGTGGGGGG - Intronic
1067670743 10:48318787-48318809 ATGAATAAGGAAGAATTGGAGGG + Intronic
1070000043 10:72369473-72369495 TTGTGTGAGGATGGATTGGAAGG + Intronic
1070105513 10:73427243-73427265 TGGAATGAGGTTGTAGTAGAAGG + Intronic
1070326106 10:75390333-75390355 GTGAAGGAGGAGGAAGAGGAGGG - Intergenic
1071102231 10:82052309-82052331 TTGAATTAGGCTGAAGGGAAGGG + Intronic
1071545211 10:86523622-86523644 CTGCATGAGGCTGAAGTGGAAGG + Intergenic
1072808440 10:98441166-98441188 TTTACTGGGGATGCAGTGGAAGG - Intronic
1073056815 10:100708384-100708406 TTGACTGAAGCTGAAGTGAAGGG - Intergenic
1074331230 10:112511706-112511728 TTGAATTAGGAGGAGGAGGAGGG - Intronic
1074419926 10:113299738-113299760 CTGAATGAGGAGGAAGGTGAGGG + Intergenic
1074560270 10:114529416-114529438 TAGAAAGAGGATGAAGAGGCCGG - Intronic
1075109363 10:119565547-119565569 TTGAAAGAGGCTGAGGTGGGTGG + Intergenic
1075992729 10:126851588-126851610 TTCATTGAGAATGATGTGGAAGG + Intergenic
1076343023 10:129762612-129762634 CTGTCTGAGGATGAAGAGGAAGG - Intronic
1076659997 10:132049330-132049352 AAGAAAGAGGAGGAAGTGGAAGG - Intergenic
1078104178 11:8348170-8348192 TTGCAGGAAGAGGAAGTGGAGGG - Intergenic
1079052294 11:17172768-17172790 ATCATTGATGATGAAGTGGAGGG - Intronic
1079221940 11:18570830-18570852 GTGAATGTGGATGAAATGGGGGG - Intronic
1079365423 11:19804966-19804988 TTGAATTGGGCTGAAGTGAAAGG + Intronic
1080297034 11:30742043-30742065 TAGAATGTGGCTTAAGTGGAAGG + Intergenic
1081091417 11:38870943-38870965 GAGGAGGAGGATGAAGTGGAAGG + Intergenic
1084234803 11:67780364-67780386 TGGCATTAGGATGAAGAGGAAGG - Intergenic
1084326567 11:68403742-68403764 TTGCATGAGGAGGAAGTGACGGG + Intronic
1084535604 11:69754598-69754620 CTGAATGAACATGGAGTGGAGGG - Intergenic
1086222952 11:84471603-84471625 TTAAATGAGGAGGAAAGGGAAGG + Intronic
1086866038 11:91981244-91981266 TTGACTGAGGAGGAACTTGAAGG - Intergenic
1087711892 11:101563645-101563667 TGGAGTGAGGATAAAGAGGATGG + Intronic
1088014332 11:105040096-105040118 TTATCTGAGGAGGAAGTGGAAGG + Intergenic
1088019631 11:105103853-105103875 TTATCTGAGGAGGAAGTGGAAGG + Intergenic
1088837126 11:113587207-113587229 TTGCATGGGGGTGAAGAGGAAGG + Intergenic
1090336892 11:125974975-125974997 GGGAATGGGGATGAAGAGGAAGG - Intronic
1090807519 11:130211681-130211703 TAGAATGAGGATGATGCTGAAGG + Intergenic
1091274342 11:134340364-134340386 CAGAATGAGGAAGAACTGGATGG - Intronic
1091900095 12:4137515-4137537 TTCAATGAGGAGAAAATGGAAGG + Intergenic
1092787129 12:12037107-12037129 TTGAATGTGGATGGGATGGATGG - Intergenic
1092808438 12:12249491-12249513 TTGAATGAGGGGGAAGAGGAAGG - Intronic
1093289799 12:17305607-17305629 TTGAATCAGGAAGAAATTGAAGG - Intergenic
1093502584 12:19828955-19828977 ATGGATGAGGATGGTGTGGAAGG + Intergenic
1095519670 12:43048019-43048041 TGAGGTGAGGATGAAGTGGATGG + Intergenic
1095785019 12:46100722-46100744 CTGAATGAGGATGTAGTTAAAGG - Intergenic
1095975608 12:47939061-47939083 TTGTTTTAGGATGAAATGGAGGG + Intronic
1097004075 12:55902424-55902446 TGTAATGAGGATGAAGTGTTTGG - Intronic
1097276704 12:57818566-57818588 CTGAATGAGGAAGAAATGAAAGG - Intronic
1097982205 12:65745760-65745782 TTTCATGAATATGAAGTGGATGG + Intergenic
1098618344 12:72558258-72558280 AGGAAGGAGGTTGAAGTGGATGG + Intronic
1100822593 12:98445337-98445359 TTTTATGAGGATGAGGTGGGTGG - Intergenic
1101282803 12:103276843-103276865 TAGAAGGAGGATGATGAGGAGGG - Intronic
1101553310 12:105783782-105783804 TGGAAGGAGGATGCAATGGAAGG - Intergenic
1102230386 12:111257689-111257711 GAGAATGAGGAGGAAGGGGAAGG - Intronic
1102547193 12:113665705-113665727 TTGACTGGGGATGGAGTGAAGGG - Intergenic
1103099641 12:118162061-118162083 GTGAATGGAGATGAACTGGAAGG + Intronic
1103201706 12:119093310-119093332 TTGAATGAAGAATAAGTGAACGG + Intronic
1103646801 12:122400199-122400221 ATGAATGTGAATGAAGTGGAAGG - Intronic
1104735684 12:131134779-131134801 ATGAATGATGAACAAGTGGACGG - Intronic
1105300733 13:19132453-19132475 AAGAAGGAGGATGCAGTGGATGG + Intergenic
1105309115 13:19190476-19190498 TTGAAAAGGGATGAAGGGGAAGG + Intergenic
1106329136 13:28722986-28723008 TTGACTGATGATGAAGTAGCAGG - Intergenic
1106652835 13:31710193-31710215 ATGAATGAGGCTTATGTGGAAGG + Intergenic
1107039887 13:35937383-35937405 TGGAATGGGGATGAGGTGGGTGG - Intronic
1107556439 13:41520135-41520157 TTGAAAGAGGAAGAACTGAAAGG + Intergenic
1107581882 13:41798868-41798890 TGAAAAGAGAATGAAGTGGAGGG - Intronic
1108372938 13:49788942-49788964 TTGAAGGAGGAGGAAGAGGGAGG + Intronic
1108572460 13:51764991-51765013 TTGCAAGAGCAGGAAGTGGAGGG - Exonic
1108807460 13:54176437-54176459 CTCAATGAGAATGCAGTGGAAGG - Intergenic
1111666983 13:91281918-91281940 TTGACAGAGGATAAGGTGGAAGG + Intergenic
1112811592 13:103224847-103224869 ATGAATCAGAATGAAGTGAAAGG - Intergenic
1113141842 13:107161261-107161283 TTGAAGGAGGAAGATGAGGAGGG + Intergenic
1113357330 13:109593892-109593914 TGGATTGAGAATGAAGTTGAAGG + Intergenic
1113372851 13:109738494-109738516 TGGAATGTGGAGGAAGTGGCAGG - Intergenic
1113994507 14:16055157-16055179 TTTAATGAGGATCCATTGGAGGG + Intergenic
1114612773 14:24053183-24053205 GTGAATGAGTATGCTGTGGAAGG - Intronic
1115919987 14:38361935-38361957 TGGAATGAAGATGAGGTTGAGGG + Intergenic
1116052107 14:39816747-39816769 TTGACAGAGGTTGAAGTGGGAGG - Intergenic
1116479458 14:45381432-45381454 ATGAATGAGAATAAAATGGAGGG + Intergenic
1118333484 14:64832478-64832500 TAGACAGAGGAAGAAGTGGAGGG - Intronic
1119003651 14:70905626-70905648 TGTAATGAGGGTGAGGTGGATGG - Intergenic
1120147980 14:81000624-81000646 ATGAATCAGGCTGACGTGGAGGG - Intronic
1120148232 14:81003186-81003208 TAGAATGAAAATGAAGTAGAAGG - Intronic
1120490847 14:85176898-85176920 TTGCATGAGGATGAAATCTAGGG - Intergenic
1121696639 14:95918680-95918702 CTGACTCAGGAGGAAGTGGAGGG - Intergenic
1121774028 14:96578414-96578436 TTCAAGAAGGATGAAGGGGAGGG + Intergenic
1122339582 14:101019581-101019603 TGGATTGAGTATGAACTGGATGG - Intergenic
1124664413 15:31580204-31580226 TTAAGTGTGGATGAAGTGGAGGG + Intronic
1125983725 15:44028611-44028633 TTATAAGAGGATGAACTGGATGG + Intronic
1126963746 15:54027990-54028012 TTGAATTGGGAGGAAGTGGTAGG + Intronic
1127484446 15:59406146-59406168 TTCAATGAGAATGATCTGGAAGG - Intronic
1127868483 15:63050313-63050335 TTGAATGAAGAGGAAGTGGGCGG + Intronic
1129315515 15:74740858-74740880 TTGAATGGGGAAGAAGTGGTTGG + Intergenic
1130573882 15:85073450-85073472 TGGATTAAGGATAAAGTGGAAGG - Intronic
1130791860 15:87163872-87163894 TTTAAAGAGAATGAACTGGATGG - Intergenic
1132811842 16:1803428-1803450 TTGAAACAGGATGAGTTGGAGGG - Intronic
1133331282 16:4975990-4976012 TTGGATGAGGAAGAACAGGAAGG + Intronic
1134185235 16:12079817-12079839 TGGAATGAGAATGAAATGGCTGG - Intronic
1134435787 16:14255479-14255501 TTTAGGGAGGAAGAAGTGGAAGG + Intronic
1134832273 16:17333156-17333178 TTGAATGAGGATGAAGGAAATGG - Intronic
1135855447 16:26006000-26006022 TTAAATGAGGCTCAAGTGGCCGG + Intronic
1136300322 16:29329856-29329878 TGGAATGAGGATGAGGTGAAAGG + Intergenic
1139332332 16:66203107-66203129 ATGATTGAGGATGAAGAGTAAGG - Intergenic
1140498812 16:75414638-75414660 GTGAAGGAAGATGAAGTGGATGG - Exonic
1141795768 16:86272900-86272922 TGGAATGTGGATGCAATGGATGG + Intergenic
1142009129 16:87704885-87704907 CTGTGTGAGGATGAATTGGAGGG - Intronic
1142062051 16:88036620-88036642 CGGAATGAGGATGAGGTGAAAGG + Intronic
1143980488 17:10865258-10865280 TTGAATGTGAAGGAAGAGGATGG - Intergenic
1144095211 17:11894226-11894248 TTTAATGAGGGTAGAGTGGAAGG - Intronic
1146424608 17:32724721-32724743 AGGAATAAGGATGAAGTAGAAGG + Intronic
1147242439 17:39099329-39099351 TGGAATGAGGGTGAATTAGAGGG - Intronic
1147783578 17:42961692-42961714 CTGCAAGAGGATGGAGTGGAGGG - Intronic
1148193795 17:45698895-45698917 AAGAATGAGGAGGAAGAGGAAGG + Intergenic
1148458292 17:47822656-47822678 CTCGGTGAGGATGAAGTGGAAGG - Intergenic
1148541177 17:48481890-48481912 TTGAATGAGAGTGGAGTGGGAGG + Intergenic
1148963600 17:51415070-51415092 ATGAATGGTGATGAAGTTGATGG + Intergenic
1149604921 17:57917750-57917772 TTAAATGAGGCTGATGTGGCAGG - Intronic
1151121678 17:71799805-71799827 ATTAATGAGGAGGAAGCGGAAGG - Intergenic
1151253246 17:72854295-72854317 TTGACTGGGGATGAAGTGGGGGG + Intronic
1154087943 18:11325628-11325650 ATGCTTGAGGATGAAGTGAATGG + Intergenic
1156107566 18:33683607-33683629 TTATATTATGATGAAGTGGAAGG + Intronic
1156655622 18:39282560-39282582 TTAAAAGAGGATGCACTGGAGGG + Intergenic
1156914765 18:42452739-42452761 TTGAATGTAGATAAAGTGGATGG + Intergenic
1157464802 18:47933826-47933848 AGGAAGGAGGATGAATTGGAAGG - Intergenic
1157492394 18:48133264-48133286 ATGGGTGCGGATGAAGTGGAAGG + Intronic
1158922336 18:62206981-62207003 TTAAATGAGGCTGAGGTGGGAGG - Intronic
1159281229 18:66288597-66288619 TTGGATGAGGCTGCAGAGGATGG + Intergenic
1161509569 19:4663023-4663045 TAGAATGAGGACGGAGTGGGAGG - Intronic
1161509588 19:4663110-4663132 TAGAATGAGGATGAGGTGGGTGG - Intronic
1161509621 19:4663243-4663265 TAGAATGAGGATGGGGTGGGTGG - Intronic
1161509641 19:4663332-4663354 TAGAATGAGGATGGGGTGGATGG - Intronic
1161509660 19:4663422-4663444 TAGAATGAGGATGGGGTGGGTGG - Intronic
1161509681 19:4663508-4663530 TAGAATGAGGATGGGGTGGGTGG - Intronic
1161509707 19:4663598-4663620 TAGAATGAGGATGGGGTGGGTGG - Intronic
1161509738 19:4663727-4663749 TAGAATGAGGATGGGGTGGGTGG - Intronic
1161509751 19:4663772-4663794 TAGAATGAGGATGGGGTGGGTGG - Intronic
1162145902 19:8611850-8611872 GTGAATGAGGAGGACCTGGATGG + Intergenic
1164591934 19:29512167-29512189 GAGAAAGAGGATGAAGAGGAAGG + Intergenic
1164720910 19:30431007-30431029 TTGAAGCAAGATGAACTGGAGGG + Intronic
1164837655 19:31367925-31367947 TTGAAGGAGGCTGAGGTGGGAGG - Intergenic
1165215115 19:34265493-34265515 TTGAAAGAGGAGGGAGTGGTGGG + Intronic
1165993844 19:39831264-39831286 TTGAAGCAGGATGAAGTGGGAGG - Intronic
1166241690 19:41499119-41499141 AAGAATGAGGATGAAGAGGAGGG + Intergenic
1166343085 19:42150342-42150364 ATGGATGAGGAGGAAGAGGAGGG + Intronic
1166537172 19:43581538-43581560 GAGGATGAGGATGAAGTGTAAGG - Intronic
1166808449 19:45500588-45500610 TGGAATGAGGGTGGGGTGGAAGG + Intronic
1167767651 19:51494957-51494979 CTGCAGGAGGATGAAGAGGATGG + Intronic
1167807255 19:51796633-51796655 TAGAATGAGTAAGACGTGGATGG + Intronic
925289830 2:2740104-2740126 TGGAATGAGGATGAGATAGAAGG + Intergenic
925840830 2:7990223-7990245 TTGAAGGGGGGTGAAGTAGAAGG - Intergenic
926383353 2:12313133-12313155 CTTAAAGATGATGAAGTGGAAGG + Intergenic
926708571 2:15856572-15856594 TTGAGATAGGATGAAATGGAAGG + Intergenic
926931793 2:18048376-18048398 TTGGATGAGGAAGAAGAGAACGG - Intronic
926975055 2:18506447-18506469 TTGAATAAGGAAGAAAGGGAGGG - Intergenic
927791550 2:26013967-26013989 TTGAATTTGGATGTATTGGAGGG + Intergenic
928686533 2:33755769-33755791 TAGAATGAGGATGAAATACAAGG + Intergenic
928730211 2:34223325-34223347 CTGAATGGTGATGAAGTGGGTGG - Intergenic
929944540 2:46360687-46360709 CTTCATGAGGATGAAGTGCACGG + Exonic
931138812 2:59434503-59434525 TTGAATGAAGAAGAAGAGGAAGG + Intergenic
932561413 2:72874292-72874314 TTGATTAAAGATGAAGTTGATGG + Intergenic
933069726 2:77842194-77842216 ATGAATGAGAATCAACTGGAGGG + Intergenic
935438834 2:103067885-103067907 TGGATTGATGATGAAGAGGAGGG + Intergenic
936567462 2:113592184-113592206 GGGAATGAGGATGAAGGGAAGGG + Intergenic
938536964 2:132255593-132255615 TTTAATGAGGATCAATTGGAGGG - Intronic
938928617 2:136066635-136066657 ATGGATGAGGGTGAGGTGGATGG + Intergenic
939496946 2:142936085-142936107 TTGAATGAGGAAAAAGAGGTAGG + Intronic
939599066 2:144165864-144165886 ATGAATAAGGATGACGTTGAAGG - Intronic
940988985 2:160078628-160078650 TTAAAAGAGGAAGATGTGGATGG + Intergenic
941052342 2:160749079-160749101 TTGAATGAGGATGGGTCGGAAGG - Intergenic
941155569 2:161973577-161973599 TTGAGAGAGGAGGAAATGGAAGG - Intronic
941437710 2:165492040-165492062 TAGAAAGAGGACAAAGTGGAGGG - Intronic
941718373 2:168787282-168787304 AGGGATGAGGATGGAGTGGAAGG - Intronic
941831332 2:169963446-169963468 TAGAAAAAGGATGAAGTGGTAGG - Intronic
942058676 2:172207936-172207958 TTGAGTTATGATGAAATGGATGG - Intergenic
942183460 2:173402474-173402496 GTGTATGAGGATAAAGTGGCTGG + Intergenic
942628960 2:177935578-177935600 TTGAGTGTGGAGGGAGTGGAGGG - Intronic
943399294 2:187385350-187385372 TAGAATGAGAAGGAATTGGAGGG - Intronic
943410445 2:187540198-187540220 ATAAATGAGGATGACGTGGCCGG - Intronic
943553941 2:189377715-189377737 GTGAAGGAGGAGAAAGTGGAGGG - Intergenic
944014388 2:195017058-195017080 TTGGAAGAGGAGGAAGTGGGAGG - Intergenic
944200476 2:197101972-197101994 GTGTATGAGGATGAAGAGGAAGG - Intronic
944208424 2:197181961-197181983 GTGAATGATGATGATGGGGAGGG - Intronic
944450563 2:199838029-199838051 TTGAATGATGATAGAGGGGAGGG - Intronic
944502078 2:200372263-200372285 TTGAATGAGGATAATGGAGAGGG - Intronic
944609401 2:201386331-201386353 TTAGAAGAGGATGAAGAGGAGGG - Exonic
944936279 2:204572302-204572324 TTGAAGGAGGAGGAAAAGGAGGG + Intronic
945299517 2:208202898-208202920 GTGGATGAGGATGAAGTGACAGG - Intergenic
946040076 2:216775553-216775575 TGGAATGAGGTTGGAGTGGGTGG + Intergenic
946154310 2:217797199-217797221 CTCAAGGAGGAGGAAGTGGATGG - Intergenic
948483294 2:238263922-238263944 CTGAAGGAGGAAGAAGAGGAAGG + Intronic
948584156 2:239008292-239008314 ATGAAGGAGGATGGAGAGGAAGG - Intergenic
1168888605 20:1278510-1278532 TTGCCTGAGGATGAAGGGGGAGG - Intronic
1169090903 20:2860873-2860895 CTGAGTGGGAATGAAGTGGACGG + Intronic
1169282408 20:4278754-4278776 TTAAAGGAGGAAGAAGAGGAGGG - Intergenic
1169447930 20:5688052-5688074 TTGCATGAGCAGGAAGGGGAAGG - Intergenic
1169757025 20:9053458-9053480 TTGAATGAGGGAGCAGGGGAAGG - Intergenic
1169777652 20:9273600-9273622 GTGAAGGAGGAGGAAGAGGAAGG + Intronic
1169855890 20:10102312-10102334 TAGGATGAGGAGGAAGAGGAGGG - Intergenic
1169955445 20:11097760-11097782 TTGACAGAAGATGAGGTGGAAGG - Intergenic
1170336079 20:15271662-15271684 ATGAATGAATATGAAGTGAAAGG + Intronic
1171850833 20:30306845-30306867 ATGAATGGGGAGGAAGAGGATGG - Intergenic
1171865871 20:30487372-30487394 TTTAATGAGGATCCATTGGAGGG - Intergenic
1172067450 20:32231527-32231549 TTGAATGAGGATGTAGAGAGTGG + Intronic
1172107723 20:32526809-32526831 TTGAATGAGCATGAAGGGCTTGG + Intronic
1172408965 20:34708818-34708840 TCGGAGGAGGATGAAGTGGACGG + Exonic
1172882055 20:38208487-38208509 TGAGATGAGGCTGAAGTGGAGGG + Intergenic
1173630434 20:44509979-44510001 CTGAATGAGGATGAAGAGGGCGG + Exonic
1175195035 20:57237208-57237230 TTTAATGAGGATGAAGCTCAAGG + Intronic
1175196666 20:57248531-57248553 TTGCATGAGGATGAACTGGCTGG + Intronic
1175221221 20:57417576-57417598 TTGATGGAAGATGAAATGGAGGG + Intergenic
1175319804 20:58077474-58077496 TGGAATGCGGATGATGTGGCTGG - Intergenic
1176994431 21:15538603-15538625 TTGAAAGAGAATGAAATGTAAGG + Intergenic
1176997563 21:15574473-15574495 TTGAAAAATGATGAAGGGGATGG + Intergenic
1178419527 21:32432488-32432510 TGGCATTAGGATGAAGAGGAAGG + Intronic
1179027449 21:37691402-37691424 TTCAATGAGGGTGAAGTGCTGGG + Intronic
1180312584 22:11252247-11252269 TTTAATGAGGATCCATTGGAGGG - Intergenic
1182781431 22:32871576-32871598 ATAAATGAGGATGGAGTGGCAGG - Intronic
1183043677 22:35202668-35202690 TTTCATCAGGATGAAGTGGTTGG + Intergenic
1183090354 22:35518213-35518235 TTGAATAAGGACCATGTGGAAGG + Intergenic
1184113763 22:42410143-42410165 TTGGATGAGGTTGAAGGAGATGG - Intronic
1184312973 22:43660314-43660336 GGGAATGGGGATGTAGTGGAAGG - Intronic
1203312756 22_KI270736v1_random:154265-154287 TTGAAGTAGAGTGAAGTGGAAGG + Intergenic
950845132 3:16008017-16008039 TTGCATTAGGATGATGTGGAGGG + Intergenic
951265544 3:20561461-20561483 TGGAGTGAGGCAGAAGTGGAAGG + Intergenic
951361763 3:21733323-21733345 TTGAAGGAGGACAAAGTTGAAGG - Intronic
952126794 3:30310261-30310283 TTAAATTAGGATCAAGTTGAAGG - Intergenic
952180446 3:30911243-30911265 TTGAATAAGAGTGAAATGGAGGG + Intergenic
952604625 3:35130128-35130150 AAGAATGAGAGTGAAGTGGAGGG + Intergenic
952826613 3:37530001-37530023 GTGGATGAGGATGAAGCAGAGGG + Intronic
954750582 3:52811231-52811253 TTGGATGAGGTGGAAGGGGAGGG - Intergenic
955080489 3:55653965-55653987 AGGAATGAGGAGGAAGAGGAGGG - Intronic
955472638 3:59301834-59301856 TTGAATCAGGAGGAAGTGGGAGG + Intergenic
956345154 3:68270238-68270260 TAGAATGAGGTTGAAATGGTGGG + Intronic
957150061 3:76475334-76475356 TTGAATGAGGATGAAGTGGAAGG + Intronic
957169787 3:76723567-76723589 TTGTATGAGAATGAAGTGGGCGG - Intronic
957637602 3:82807112-82807134 TTGACTGATGATGAAGTAGCAGG - Intergenic
957796613 3:85017208-85017230 ATGAATGACTATTAAGTGGATGG + Intronic
958869493 3:99540741-99540763 TTGAAAGAGGATGAAGGCAAGGG - Intergenic
959675660 3:109032418-109032440 TTGTATGAAAATGAACTGGAAGG + Intronic
959689218 3:109180458-109180480 TTGAATGCAGATGAAGAGGATGG - Intergenic
960490587 3:118312727-118312749 TTGAATGAGGATGGAGCTGAGGG - Intergenic
961346733 3:126268120-126268142 ATGCAGGAGGATGAAGAGGACGG - Intergenic
961884433 3:130086899-130086921 TGGCATTAGGATGAAGAGGAAGG - Intronic
962883896 3:139605209-139605231 ATGAATAAGGATGAGGAGGAAGG - Intronic
963105969 3:141647489-141647511 TTGAAAGAGGAAGAATTGGCTGG - Intergenic
963254143 3:143127963-143127985 TTGCATGAGGATGAAGAACATGG + Intergenic
963657786 3:148080390-148080412 AAAAATGAGGATGAAGGGGAGGG + Intergenic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
966347693 3:178997530-178997552 TGGAAGGGGGATGAAGTGGGAGG - Intergenic
967032288 3:185619211-185619233 CTGAATAAGGATGAATTCGAAGG - Intronic
969820343 4:9715384-9715406 TGGCATTAGGATGAAGAGGAAGG + Intergenic
970161087 4:13189793-13189815 ATGAAGGAGGAGGTAGTGGAAGG + Intergenic
970590865 4:17559680-17559702 TAGAATGTAGATGCAGTGGATGG - Intergenic
971129185 4:23787169-23787191 TTTATTGAGGAGGAAATGGAGGG - Intronic
971152834 4:24052019-24052041 TTGAATGAAGATAAAGGGTAAGG + Intergenic
972144343 4:36002979-36003001 TACAATGAGGACTAAGTGGAAGG + Intronic
972824388 4:42739912-42739934 TTGAATCAGGAAGAAATTGAAGG + Intergenic
973300326 4:48575207-48575229 TTAAACAAGGATGAAGGGGATGG + Exonic
973851313 4:54964082-54964104 GAGAATGAGGATCAAGTGAAAGG - Intergenic
974152763 4:58030349-58030371 TTGCGGGAGGAAGAAGTGGATGG + Intergenic
974310399 4:60200902-60200924 CTGAATCAGAATGAAGTGGAGGG - Intergenic
974631457 4:64494786-64494808 GAGAATGAGAATGAAGTGAAAGG + Intergenic
975115768 4:70678968-70678990 TTTTATGAGGATGAACAGGAAGG - Intronic
975374507 4:73628450-73628472 TTGAATGAGGAAAAAATAGAAGG - Intergenic
977503799 4:97877542-97877564 GAAAATGAGGATGAAGTGAAAGG + Intronic
977913735 4:102566630-102566652 TTTGATGAGGATGCAGAGGAAGG + Intronic
978177178 4:105746333-105746355 AAGGATGAGGAGGAAGTGGAGGG + Intronic
978350300 4:107814044-107814066 ATGCAGGAGGATGAGGTGGAAGG + Intergenic
978396176 4:108282534-108282556 AGGAATGAGGTTGAATTGGATGG + Intergenic
978574834 4:110179259-110179281 TTTAAGGAGGCTGAGGTGGATGG + Intronic
979134127 4:117086763-117086785 TGGAGTGAGGATGGAGGGGAGGG + Intergenic
981035117 4:140161398-140161420 TTGAGTATGGATGAAGTAGATGG - Intergenic
981296110 4:143133751-143133773 TTGGATGAGTATTATGTGGATGG - Intergenic
981754031 4:148121584-148121606 TTGAAAGAGGAAGAGATGGATGG - Intronic
981812922 4:148795822-148795844 GGGAAGGAGGATGAAGTGGTAGG - Intergenic
983163274 4:164444110-164444132 CTGAATGAGGGTGAAGGGGAAGG - Intergenic
984184853 4:176531415-176531437 TTGAATGTAGATGAAAAGGAAGG - Intergenic
984251375 4:177339555-177339577 TAGATTGAGGAGGAAGAGGAGGG + Intronic
984258051 4:177410531-177410553 TTCAAAAAGGATGAAGTGGCCGG - Intergenic
984470280 4:180161590-180161612 TTAAATGAAGAAGAAATGGAGGG + Intergenic
985186811 4:187326548-187326570 TTGAATTAGAATCAAGTGAATGG - Intergenic
985193212 4:187400251-187400273 AGGAATGAGGAGGAAGGGGAGGG - Intergenic
986423022 5:7603044-7603066 TTGAATGTAGATGAAATGGCTGG - Intronic
986974802 5:13382201-13382223 TTGAATGGGAAGGAAGTGCAAGG + Intergenic
988131124 5:27107497-27107519 TTGAATAAGGATAAAATGTATGG + Intronic
989448478 5:41559151-41559173 TGGAAGGAGCATGAATTGGATGG - Intergenic
989619291 5:43368737-43368759 TTGAAAGAAGATGATGTGAAGGG + Intergenic
989646077 5:43633936-43633958 TAGAATTAGGAAGTAGTGGAAGG + Intronic
989757127 5:44968929-44968951 TTTGAGGAAGATGAAGTGGAGGG + Intergenic
990137194 5:52660368-52660390 TTGAATGAGGATCCTGTGAATGG - Intergenic
990477998 5:56180355-56180377 TTGAAAAAGAATAAAGTGGAAGG - Intronic
991594079 5:68284548-68284570 TTGAGTGCAGATAAAGTGGATGG - Intronic
993167481 5:84375505-84375527 TTAAATGAGGATGAGATGTAAGG + Intronic
993698711 5:91093242-91093264 CTGAATGAGGATGAACTCGAGGG - Intronic
993824429 5:92664787-92664809 TTTAATGAGGATGAAATGATTGG - Intergenic
994959516 5:106580604-106580626 TTGACTGAGGATTAAGTAAATGG + Intergenic
997221740 5:132172935-132172957 TTGAAAAAGAATGAAGTTGAAGG + Intergenic
997897217 5:137729922-137729944 CTGAAAGAGGATGAAGAGTATGG - Intronic
998375421 5:141687322-141687344 GGGAATGAGGATGCAGGGGAAGG - Intergenic
998388622 5:141772838-141772860 GTGAATGTGGATGAAGTGGATGG + Intergenic
998516882 5:142763916-142763938 TTGAATGTGGATGCAATGCATGG - Intergenic
999084814 5:148878257-148878279 GAGAATGAGGAAGAAGAGGAGGG + Intergenic
1001280819 5:170385208-170385230 TTGAATGAGGGTCAAGGAGAGGG + Intronic
1001310045 5:170604046-170604068 TTGAAGTAGGATGGAGAGGAAGG + Intronic
1001536862 5:172504204-172504226 TGGAAGGAGGAAGAAGTGGGCGG - Intergenic
1001854044 5:174995388-174995410 GTGAAGAAGAATGAAGTGGAGGG + Intergenic
1002526536 5:179818754-179818776 TCAAATGGGGCTGAAGTGGAAGG - Intronic
1002970138 6:2007634-2007656 TTGAATGTAGAAGAACTGGAAGG - Intronic
1005565018 6:27082814-27082836 TTGAATGTGGAAGAGGTAGAGGG + Intergenic
1005757749 6:28940475-28940497 TTGAAAGAGGGTGAAGTGCAGGG - Intergenic
1005945778 6:30594698-30594720 TTTAATGAGGCTGAGGTGGGAGG - Intronic
1006010737 6:31041007-31041029 TTGACTGAGGATGCAGCAGAGGG + Intergenic
1006749815 6:36369795-36369817 TTGCAAGAGGCTGAAGTGGGAGG + Intronic
1006871214 6:37253978-37254000 TTGAATGAAGATGAAGTTGAGGG + Intronic
1007447723 6:41920118-41920140 TTGAAAGAAGATGAGGTGGCAGG - Intronic
1007555852 6:42765587-42765609 AAGAATGATGATGAAGTGAAAGG + Intronic
1008137249 6:47791011-47791033 TTGGAGGAGGATGAGGTGGAAGG + Intronic
1008554300 6:52659873-52659895 TGGGATGAAGATGAAGGGGAAGG - Intergenic
1008897428 6:56572958-56572980 TGCAGTGAGGATGCAGTGGATGG + Exonic
1010267445 6:73882919-73882941 TAGAAAGAGGAAGAAGTTGATGG + Intergenic
1010408091 6:75528465-75528487 ATGCATGAGGATTAAGTGGAAGG - Intergenic
1011430967 6:87286277-87286299 TTCAATAAGAATGAAGTTGAAGG - Intronic
1012136200 6:95560337-95560359 TAGAATGAAGTTGAAGGGGATGG + Intergenic
1012162922 6:95909800-95909822 TTGAAAAGGGATGAAGTGAAGGG + Intergenic
1013769566 6:113612831-113612853 TGGAATGAGAATCAAGTGAAAGG + Intergenic
1014219722 6:118787838-118787860 TAGCATGAGGTTGCAGTGGAAGG - Intergenic
1015838343 6:137447255-137447277 TTGAACGAGAATGAAGTGCAAGG - Intergenic
1017913568 6:158815585-158815607 CTGACTGAGGCTGAAGTGGGAGG - Intronic
1018003427 6:159599378-159599400 TTGAATAAGGATGATGTGACTGG - Intergenic
1018577705 6:165276753-165276775 TTCCATGAGGATGAGGAGGAAGG - Intergenic
1019931675 7:4227402-4227424 TTGAATGAGGATCCGATGGAAGG + Intronic
1020104378 7:5415061-5415083 AGGAATGAGGAGGCAGTGGAGGG - Intronic
1020727001 7:11828370-11828392 TTGACTGAGGAAGGAGTAGAAGG - Intronic
1021554857 7:21909015-21909037 TTGACTGAGGACGCAGTGGCAGG - Intronic
1022066260 7:26861103-26861125 ATGAATGAGGATGAATGAGAAGG + Intronic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1023129537 7:36988380-36988402 TTGATTGAGGAAGACTTGGATGG - Intronic
1023685259 7:42727628-42727650 TTGAATGAGGAGTCAGTGAATGG - Intergenic
1024677254 7:51647779-51647801 TTGGATGAGGAGGAGGAGGAAGG - Intergenic
1024756352 7:52537696-52537718 TTGAATAAGGAAGATGTGGGTGG - Intergenic
1025021969 7:55487322-55487344 TTTAATGTGACTGAAGTGGATGG - Intronic
1025243908 7:57301536-57301558 ATGAAGGAGGCTGAGGTGGAAGG - Intergenic
1026283014 7:68938365-68938387 TTGAATGAGGAGTAGGTGAATGG - Intergenic
1027416617 7:77980899-77980921 TGGAATGAGCAGGAAGTGGGGGG + Intergenic
1028555804 7:92123280-92123302 TTGACTGATGATGAAGTAGCAGG - Exonic
1031243895 7:119281972-119281994 TTGAATGATGATGAAATAGAAGG + Intergenic
1033087636 7:138357102-138357124 CTGAGTGAGGCTGAAGTGGGAGG - Intergenic
1033414344 7:141148989-141149011 TGGCATGAAGATGAAGTGGAGGG + Intronic
1033423734 7:141224843-141224865 CTGAATGAGGTTGAAATGGCTGG + Intronic
1033646259 7:143306914-143306936 TTTAATGAGGTTCAAGGGGAAGG - Exonic
1033710472 7:143937962-143937984 AGTAGTGAGGATGAAGTGGATGG + Intergenic
1034242212 7:149619294-149619316 TAGACTGAGGAGGAAGAGGAGGG - Intergenic
1034248617 7:149670082-149670104 TTGAAAGAAGATAGAGTGGAGGG + Intergenic
1034438738 7:151076104-151076126 GAGGATGAGGATGAAGGGGAAGG - Exonic
1034633241 7:152547183-152547205 ATGAATGAGGCAGAAGTGGATGG + Intergenic
1036181573 8:6590279-6590301 GTCAGTGAGGATGGAGTGGAGGG + Intronic
1037096473 8:14992759-14992781 TTGAATGAGGAGGATGGGGGAGG - Intronic
1037096486 8:14992819-14992841 TTGAATGAGGAGGATGGGGGAGG - Intronic
1037346432 8:17906215-17906237 TGGAAAGAGGATGAATTGGTGGG - Intronic
1038645849 8:29361500-29361522 TGGACTGAGGATGGAGTAGAGGG - Intergenic
1039743588 8:40404095-40404117 TTTAATGAGGAGAAAGTGGCTGG + Intergenic
1040064656 8:43135560-43135582 TTAAATTAGGATGAAGTTGCAGG + Intergenic
1041106669 8:54451431-54451453 CTGAATGAGTGTGAAGTAGAGGG + Intergenic
1041113104 8:54506269-54506291 TGGAATGAGGGTAAACTGGAAGG - Intergenic
1041174486 8:55180287-55180309 ATGAATGAGCATAAATTGGATGG + Intronic
1041768283 8:61443679-61443701 TTGAAAAAGAATAAAGTGGAAGG - Intronic
1042607700 8:70563107-70563129 CTGATTGAGGCTGAAGTGGCAGG - Intergenic
1042909961 8:73816536-73816558 GGGAATGAGGATGAAGAGGAAGG + Intronic
1043035035 8:75186117-75186139 TTGCATGATGATGAAGTTGGGGG - Intergenic
1043283544 8:78500850-78500872 TAGAATGAGAATGGAGTAGAAGG + Intergenic
1043848947 8:85193634-85193656 GGGATTGAGGATGAAGTTGAGGG - Intronic
1046268619 8:111863413-111863435 TTAAATGGGGATGAGTTGGAGGG - Intergenic
1046368313 8:113267594-113267616 GTGAATGGGGAAGAAGGGGAGGG + Intronic
1046427139 8:114068938-114068960 TGGAATGAGGATGTTGTAGAAGG - Intergenic
1046797046 8:118384634-118384656 TTGAGAGAGGATGCATTGGAAGG + Intronic
1047354009 8:124103035-124103057 TTGAATGAGTAGGAAGTGAAGGG + Intronic
1047864947 8:129012962-129012984 TTGAATGTGGCTGATGTGGCAGG + Intergenic
1048248938 8:132841658-132841680 TTCAGTGAGGATGAAGTAAATGG + Intronic
1049280215 8:141740343-141740365 GAGACTGAGGATGCAGTGGACGG - Intergenic
1050565198 9:6875007-6875029 TTGATTGAGGATGCAGTTGCTGG + Intronic
1050681012 9:8111472-8111494 TTGAAAAAGGAAGAAGTGGGTGG - Intergenic
1051374307 9:16388466-16388488 TAGAGTGAGGATTAAGTGAAAGG - Intergenic
1051686816 9:19666461-19666483 TTGAATGTGGGAGAAGTGTAGGG + Intronic
1051982690 9:23042993-23043015 TAGAAAGAGGATGAAGTGTAAGG + Intergenic
1053420958 9:37977821-37977843 GTGAAGGAGGGTGAAGAGGAAGG - Intronic
1053449140 9:38178987-38179009 TGGAATGAGGAGGAGGTGGAAGG - Intergenic
1053727783 9:41021969-41021991 TAGAGAGAGGATGAAGAGGAAGG - Intergenic
1057048081 9:91901075-91901097 TTGAAGGATGGTGGAGTGGAGGG - Intronic
1057325012 9:94054232-94054254 TTTAATTAGGGTGATGTGGAGGG + Intronic
1061595657 9:131627546-131627568 TTGACAGAGGCTGAAGGGGAGGG - Intronic
1203361090 Un_KI270442v1:219721-219743 TTTAATGAGGATCCATTGGAGGG - Intergenic
1186721355 X:12307875-12307897 TTGGATGAGGAGTCAGTGGAGGG + Intronic
1187301860 X:18058746-18058768 TAGAATGTGGGTGAAGTGGACGG + Intergenic
1187595674 X:20769982-20770004 TTGCTGGAGGCTGAAGTGGAAGG + Intergenic
1187968985 X:24640656-24640678 TGGACTGAGAAGGAAGTGGATGG - Intronic
1188520504 X:31033099-31033121 GAGAATGAGAATGAAGTGAAAGG + Intergenic
1189590465 X:42505777-42505799 CAGAATGAGGATGGAGTAGAAGG + Intergenic
1189657154 X:43256636-43256658 TGCAAAGAAGATGAAGTGGAAGG - Intergenic
1190475939 X:50827466-50827488 ATGGACAAGGATGAAGTGGAGGG - Intergenic
1190777236 X:53562674-53562696 CTGGCTGAGGATAAAGTGGATGG + Intronic
1191939366 X:66461725-66461747 CTGGATGTGGCTGAAGTGGAGGG + Intergenic
1192987959 X:76420640-76420662 TTCTATGAGGAAGAAGTGCAAGG - Intergenic
1193435382 X:81469011-81469033 GTGAATGAGCATTAAGTGGAAGG - Intergenic
1193945682 X:87730491-87730513 TTGAAAGAGGGTGAAAAGGATGG - Intergenic
1195055152 X:101137393-101137415 AAGAAGGAGGATGCAGTGGATGG + Intronic
1195726298 X:107920542-107920564 TTGCATGAGAATGAAAAGGAAGG - Intronic
1197086675 X:122484916-122484938 TTGAAAAAGAATGAAGTTGAAGG + Intergenic
1197663459 X:129198161-129198183 TCCAATGAGGAAGAAGTGGAGGG + Intergenic
1198162304 X:134019693-134019715 TTGAATGGGGATTACTTGGAGGG + Intergenic
1199471391 X:148199549-148199571 TAGAATGAGGCTACAGTGGAGGG - Intergenic
1199502813 X:148527746-148527768 TAGAATGAGGATGAGGTGGCGGG - Intronic
1200816065 Y:7533808-7533830 TTCAATGAGGTTGTAGTTGAAGG - Intergenic
1201728128 Y:17176727-17176749 TTGAGTGAGGGTGAAGCTGAAGG + Intergenic