ID: 957151793

View in Genome Browser
Species Human (GRCh38)
Location 3:76495953-76495975
Sequence CAGCCATATTGTACTTCTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 132}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957151792_957151793 8 Left 957151792 3:76495922-76495944 CCTATTAATATTTTGTAATGAAT 0: 1
1: 0
2: 1
3: 74
4: 728
Right 957151793 3:76495953-76495975 CAGCCATATTGTACTTCTTGAGG 0: 1
1: 0
2: 0
3: 12
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957151793 Original CRISPR CAGCCATATTGTACTTCTTG AGG Intronic
904225952 1:29019701-29019723 GAGCCATCTTGTTCTCCTTGGGG + Intronic
904955843 1:34283279-34283301 CAGCCACACTGGCCTTCTTGGGG + Intergenic
905419844 1:37833901-37833923 CAGCCATATGGTCCTCTTTGTGG - Intronic
907420172 1:54341934-54341956 CAGCCACATTGGGCTTCTTTTGG - Intronic
908007646 1:59743138-59743160 CAGTCATCTTGGACTTCTTTAGG + Intronic
908914695 1:69112662-69112684 TAGCCATATAGAACTACTTGAGG - Intergenic
915186597 1:154111083-154111105 CAGCCAGATTTTACTTATTTGGG - Intronic
915685679 1:157630333-157630355 AAGCAATACTGTACTTCTTTTGG + Intergenic
916530268 1:165649943-165649965 CCTCCACTTTGTACTTCTTGCGG - Exonic
916762167 1:167826890-167826912 CAGCCATATTGGTCCTCTTTTGG - Intronic
918120863 1:181539015-181539037 CAGCTATACTGGACTACTTGTGG + Intronic
918535326 1:185567848-185567870 CAGCCATCTTTTCCTCCTTGGGG - Intergenic
921480490 1:215659326-215659348 CAGCCACACTGGCCTTCTTGAGG - Intronic
1063622592 10:7662693-7662715 CAGCCATATGCCATTTCTTGAGG - Intronic
1067900739 10:50238890-50238912 CAGACATATGGGACTTCTAGCGG + Intronic
1071177403 10:82942396-82942418 CAGCCTTATGGTAATTCTTTTGG - Intronic
1077744628 11:4888860-4888882 CAGACACATGGTACTTGTTGAGG - Intronic
1078447364 11:11414407-11414429 CAGCCACACTGGACTTCTTGTGG + Intronic
1087399638 11:97649237-97649259 CAGCCCTATTGTATTTGCTGAGG + Intergenic
1087760922 11:102103708-102103730 CAGACATATTGAACCACTTGTGG - Intergenic
1088605017 11:111521077-111521099 CAGCCATTTTGAACCACTTGTGG + Intronic
1089788502 11:120925146-120925168 CAGCCATAGAGAACTTCTAGAGG - Intronic
1091537554 12:1426628-1426650 CAACTATATTGTACGTTTTGTGG + Intronic
1091992201 12:4964411-4964433 CAGCCATTGTGCCCTTCTTGGGG + Intergenic
1092903310 12:13080021-13080043 CAGAAATATTGTTCCTCTTGAGG + Intronic
1096059376 12:48683578-48683600 CAGCCTTAGTGTTTTTCTTGAGG - Intergenic
1098925337 12:76343169-76343191 AAGACATATTCTACTTCTTTTGG + Intergenic
1099225523 12:79964295-79964317 CAGCAAGATTGTATTGCTTGGGG + Intergenic
1101382955 12:104230364-104230386 CAGCCATGTTTAACTTTTTGAGG + Intronic
1102157526 12:110742882-110742904 CGGCCATTTTGTTCTTCTCGTGG - Exonic
1108755177 13:53492167-53492189 AAGCCCTTTTGTACTTCCTGAGG - Intergenic
1110903049 13:80848366-80848388 CAGACCTATTGTACATCATGGGG - Intergenic
1112085074 13:96021474-96021496 CAGCCATATTATTCTTATTCTGG - Intronic
1113731804 13:112646960-112646982 CAGCAATATTGTATTGATTGTGG + Intergenic
1117672549 14:58123288-58123310 CATCCATATTGTCCTTCTGTTGG - Intronic
1124691710 15:31828875-31828897 CAGTCATAGTGTACATCTTCTGG - Intronic
1128236473 15:66070970-66070992 GAGCCATCTTCTAGTTCTTGAGG - Intronic
1129061703 15:72865615-72865637 CAGCCAGGCTGAACTTCTTGTGG + Intergenic
1130122373 15:81062319-81062341 CAGCCACATTACACATCTTGAGG - Intronic
1133442792 16:5835125-5835147 CAGCCCCATTATACTTCTGGGGG - Intergenic
1142499090 17:322391-322413 CCACCATATTGTAGTTCTTCAGG - Intronic
1145985759 17:29045121-29045143 CATGCATCTGGTACTTCTTGAGG - Intronic
1146594078 17:34154838-34154860 CAGCCACACTGGACTTCTGGAGG + Intronic
1146744970 17:35320283-35320305 TAGCCAGATTGTAGTTATTGTGG - Intergenic
1146848688 17:36202795-36202817 CAGCCTTTTTGCACTACTTGTGG + Intronic
1148190521 17:45675551-45675573 CAGCCAACTGGGACTTCTTGGGG + Intergenic
1149832628 17:59885167-59885189 CACACATGTTATACTTCTTGAGG - Intronic
1151211814 17:72550153-72550175 CAGCCATATGGTAGTTTATGGGG - Intergenic
1155329980 18:24705216-24705238 CAGCTATGTTGTACTGCATGTGG - Intergenic
1155736419 18:29228049-29228071 AAGCCATATTCTTCTTCTTGGGG - Intergenic
1157195879 18:45619788-45619810 CAGCCAGCTTGTACTTCATCTGG + Intronic
1158687969 18:59632001-59632023 CAGCAATATTTTAATTCTTAAGG - Intronic
1164091928 19:21961777-21961799 GAGCCATATTTTTCTTCTTGAGG - Intronic
1164491543 19:28719801-28719823 CAGCCATCTTTTAATTCTTATGG + Intergenic
1164863346 19:31581294-31581316 CATCCATACTGTGCCTCTTGCGG - Intergenic
1167709691 19:51102762-51102784 CAGCCACACTGGACTTCTTGGGG + Intronic
1167866545 19:52333402-52333424 CAGCCATGTTGTACTTTCTTAGG - Intergenic
925836322 2:7950618-7950640 CAGCCTTATTGTTCTGCTTTGGG + Intergenic
929866012 2:45717902-45717924 GCCCCATATTGTACCTCTTGTGG + Intronic
930550207 2:52825105-52825127 CAGCCATATTATACGGGTTGTGG + Intergenic
933215841 2:79629120-79629142 CAGCCATATTGGCCCTCGTGTGG + Intronic
937544565 2:123001339-123001361 CAGAAATATTCTTCTTCTTGGGG + Intergenic
937701478 2:124867412-124867434 CAGCAAAATTGTACTTCTCAAGG + Intronic
941399378 2:165011929-165011951 GAGCCATTTTGTCCTTATTGAGG - Intergenic
941757455 2:169202976-169202998 CATCCATCTTTTACTTCTTCTGG - Intronic
946236373 2:218326921-218326943 CAGGCATATTGTGCTGCTTCTGG - Intronic
1169150616 20:3286597-3286619 CAGCCCTTTTGTCCTGCTTGTGG - Intronic
1171241575 20:23571922-23571944 TAGACATCTTTTACTTCTTGAGG + Intergenic
1172325731 20:34033026-34033048 CAGACGTATTCTTCTTCTTGTGG - Intronic
1173202126 20:40961849-40961871 CAGCCATCTGATTCTTCTTGAGG + Intergenic
1174257404 20:49267705-49267727 CTGCCACATTGTACTTGTCGTGG - Intronic
1176321752 21:5332477-5332499 CAGACATATTGTACGCCTTGAGG + Intergenic
1176479408 21:7264260-7264282 CAGACATATTGTACGCCTTGAGG + Intergenic
1176717803 21:10368177-10368199 GAGCCATAAGGTATTTCTTGTGG - Intergenic
1177930467 21:27276725-27276747 CAGTCATATTTTCTTTCTTGAGG - Intergenic
1179300452 21:40104402-40104424 CAGACATATTGTACTATTTAAGG - Intronic
1179879257 21:44286639-44286661 CAGCCATCCTGGACTTCTGGAGG + Exonic
1180299030 22:11021083-11021105 GAGCCATAAGGTATTTCTTGTGG - Intergenic
1182685584 22:32120194-32120216 CAGCCGGGTTGTACTCCTTGGGG + Intergenic
951189041 3:19748095-19748117 CAGCCCCACTGTTCTTCTTGAGG + Intergenic
951728095 3:25782541-25782563 CAGCAAAATTGCACTTCTAGAGG - Intronic
954005014 3:47583725-47583747 CAGCCCTATTGCAATTCTTATGG - Intergenic
956315469 3:67930726-67930748 GAGCCATATTTTTCTTCTTGCGG - Intergenic
957151793 3:76495953-76495975 CAGCCATATTGTACTTCTTGAGG + Intronic
957461451 3:80526438-80526460 CAGCAAAAATATACTTCTTGGGG + Intergenic
958110965 3:89144455-89144477 CTTCCATTTTGTACTTATTGAGG + Intronic
958966592 3:100565104-100565126 CAGCCATTTTGTAATACTAGGGG + Intronic
959879498 3:111427245-111427267 CAGTCATTTTATTCTTCTTGTGG - Intronic
960666725 3:120116645-120116667 GAGCCATATTTTTCTTCTTGCGG + Intergenic
962338299 3:134558639-134558661 AAGCCAAATTCTACTTCTTATGG - Intronic
962764109 3:138545606-138545628 GAGCCATATTTTTCTTCTTTCGG + Intronic
964609519 3:158596402-158596424 CAGCCATGTGGTACTGCTGGAGG + Intronic
964979016 3:162655835-162655857 CAGGCTTAATGTACTTCTTGAGG - Intergenic
966113249 3:176429303-176429325 CTTCCATATTGTTCTTCTTGAGG - Intergenic
967327914 3:188260587-188260609 CAGCCATGAGGTCCTTCTTGGGG - Intronic
967369317 3:188725948-188725970 CAGTCATATTGCACTTTTTTTGG - Intronic
972774298 4:42227240-42227262 CTTCCAAATTGTACGTCTTGAGG - Intergenic
973799881 4:54467004-54467026 GAGCCATATTTTTCTTCTTGCGG + Intergenic
974064247 4:57063034-57063056 CAGCCATAATGAACTTGCTGTGG + Intronic
975733496 4:77359636-77359658 CAGCCATCCTGTCCTTCCTGAGG + Intronic
975735222 4:77373923-77373945 CAGACATTCTGTACTTCCTGAGG + Intronic
977614636 4:99074555-99074577 CAGCCATGGTGTGTTTCTTGTGG - Intronic
978348803 4:107799832-107799854 CAGGCATAGAGTAGTTCTTGGGG - Intergenic
979768276 4:124490045-124490067 CAGCCATATTAAACTTTTTTTGG + Intergenic
984252974 4:177356537-177356559 CAGCTATAGTGTTCATCTTGTGG + Intronic
985051474 4:185996400-185996422 CAGCCTTATTTTACTTTTTAGGG - Intergenic
988884236 5:35537923-35537945 CAGCCATACTGTTATTCTTCAGG - Intergenic
989956182 5:50363249-50363271 CAGCTATAGTGCACCTCTTGAGG - Intergenic
990900280 5:60742415-60742437 CAGGCAAAATGTATTTCTTGTGG - Intergenic
995017590 5:107328723-107328745 CATCTATATTATACTTCATGTGG + Intergenic
995387610 5:111605259-111605281 CAGCCATATTGGTCTTTTTCTGG - Intergenic
998969968 5:147580460-147580482 GAGCCATATTTTTCTTCTTGCGG + Intergenic
999015197 5:148095265-148095287 CTGCCCTCTTGTAGTTCTTGAGG - Intronic
1003149456 6:3536588-3536610 CGGCCATGTTGTACTTCTCAGGG + Intergenic
1004511326 6:16286373-16286395 CAGCCGTACTTTACTGCTTGTGG - Intronic
1006967991 6:38009337-38009359 CTGACATCTTGTACTTCTGGTGG + Intronic
1008016173 6:46522361-46522383 TAGCCATATCCTACTTTTTGGGG - Intergenic
1008827609 6:55716553-55716575 CAGCCATGTTTTCCTTCATGTGG - Intergenic
1010461525 6:76119296-76119318 CCCCCATATTGTACTGCTTTTGG + Intergenic
1011078240 6:83461061-83461083 CAGTCATTGTGAACTTCTTGAGG + Intergenic
1014769765 6:125447401-125447423 CATGCATACTGTACTTCCTGTGG - Intergenic
1017991599 6:159493872-159493894 TTGCCTTATTTTACTTCTTGTGG - Intergenic
1021690368 7:23224865-23224887 CAGCCATGTTTCACTTCTTTAGG + Intergenic
1023007389 7:35886864-35886886 CACCTCTATTGTATTTCTTGAGG - Intronic
1023014233 7:35951038-35951060 CATCTCTATTGTATTTCTTGAGG - Intergenic
1023799817 7:43824162-43824184 CAGCCATGTTGTACTTGCTTAGG - Intergenic
1029092873 7:98062072-98062094 CAGCCTGATTCTACTTCTTTTGG + Intergenic
1029277362 7:99414897-99414919 CAGCCCTGTTTAACTTCTTGAGG + Intronic
1033995649 7:147343401-147343423 AAGCCATATTTTATTGCTTGGGG - Intronic
1035119108 7:156550044-156550066 CAGCCCCATGGTACTTCATGTGG - Intergenic
1035334148 7:158114768-158114790 CAGCCCTGTGGTAGTTCTTGGGG - Intronic
1038156963 8:25000349-25000371 CAGCAATATTGAACTTCTGCAGG - Intergenic
1040294790 8:46143566-46143588 CAGCCACATTTTTCTTATTGGGG + Intergenic
1043258360 8:78163390-78163412 CTGCCATATATTTCTTCTTGGGG - Intergenic
1043914191 8:85901757-85901779 TTGCCATAATGTATTTCTTGAGG + Intergenic
1055365705 9:75542465-75542487 CAGCCACATTGTACTTGTGTTGG - Intergenic
1056397701 9:86196592-86196614 CAGCCATACTGGACTACTGGGGG - Intergenic
1057719264 9:97518958-97518980 CAGCCACAGTGAACATCTTGAGG - Intronic
1203560020 Un_KI270744v1:45398-45420 CAGGCATAGTATACTTCTTAGGG + Intergenic
1185542675 X:916021-916043 GAGCCATAAGGTATTTCTTGTGG + Intergenic
1185744903 X:2564751-2564773 CTGCCACATTTTCCTTCTTGGGG + Intergenic
1189351436 X:40278715-40278737 CAGCCCCATTTTCCTTCTTGTGG - Intergenic
1199056485 X:143301735-143301757 CTGCCATTTTGACCTTCTTGAGG - Intergenic
1199514819 X:148664326-148664348 CAGCCATATGGGACTACCTGTGG + Intronic
1201706573 Y:16943965-16943987 AAGCCATATTTTTCTTTTTGTGG - Intergenic