ID: 957151888 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:76497066-76497088 |
| Sequence | CATTGTGGCTGGAGTGCAGT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2217 | |||
| Summary | {0: 1, 1: 2, 2: 30, 3: 265, 4: 1919} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 957151888_957151894 | 27 | Left | 957151888 | 3:76497066-76497088 | CCCACTGCACTCCAGCCACAATG | 0: 1 1: 2 2: 30 3: 265 4: 1919 |
||
| Right | 957151894 | 3:76497116-76497138 | TGCCAGATACTCCTGCCTCAGGG | 0: 1 1: 1 2: 1 3: 20 4: 168 |
||||
| 957151888_957151893 | 26 | Left | 957151888 | 3:76497066-76497088 | CCCACTGCACTCCAGCCACAATG | 0: 1 1: 2 2: 30 3: 265 4: 1919 |
||
| Right | 957151893 | 3:76497115-76497137 | CTGCCAGATACTCCTGCCTCAGG | 0: 1 1: 0 2: 6 3: 18 4: 210 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 957151888 | Original CRISPR | CATTGTGGCTGGAGTGCAGT GGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||