ID: 957151888

View in Genome Browser
Species Human (GRCh38)
Location 3:76497066-76497088
Sequence CATTGTGGCTGGAGTGCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2217
Summary {0: 1, 1: 2, 2: 30, 3: 265, 4: 1919}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957151888_957151894 27 Left 957151888 3:76497066-76497088 CCCACTGCACTCCAGCCACAATG 0: 1
1: 2
2: 30
3: 265
4: 1919
Right 957151894 3:76497116-76497138 TGCCAGATACTCCTGCCTCAGGG 0: 1
1: 1
2: 1
3: 20
4: 168
957151888_957151893 26 Left 957151888 3:76497066-76497088 CCCACTGCACTCCAGCCACAATG 0: 1
1: 2
2: 30
3: 265
4: 1919
Right 957151893 3:76497115-76497137 CTGCCAGATACTCCTGCCTCAGG 0: 1
1: 0
2: 6
3: 18
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957151888 Original CRISPR CATTGTGGCTGGAGTGCAGT GGG (reversed) Intronic
Too many off-targets to display for this crispr