ID: 957153416

View in Genome Browser
Species Human (GRCh38)
Location 3:76516286-76516308
Sequence GTGTGGGTATGGAGGTAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 703
Summary {0: 1, 1: 0, 2: 2, 3: 56, 4: 644}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957153416 Original CRISPR GTGTGGGTATGGAGGTAGGA TGG (reversed) Intronic
900509495 1:3051809-3051831 GTGAGTGTATGGAGGATGGATGG - Intergenic
900561673 1:3310157-3310179 GTGAGGAGGTGGAGGTAGGAAGG - Intronic
900825271 1:4921158-4921180 GTGTGGGTCTCGGGGGAGGATGG + Intergenic
901723033 1:11215694-11215716 GTATGGTTTTGGAGGTAGCAGGG + Intronic
901791435 1:11655265-11655287 GTGGGGGTGGGGAGATAGGAAGG + Intronic
902194469 1:14788195-14788217 GTTTGGGGCTGGGGGTAGGATGG - Intronic
902938124 1:19779428-19779450 GGGAGAGTATGGAGGCAGGAGGG - Intronic
903004499 1:20289750-20289772 GTGTGGAGAAGGAGGTAGGGTGG + Intergenic
903549661 1:24149181-24149203 GTGTGGGGATGGAGGGAGGTGGG + Intergenic
903560720 1:24225021-24225043 GTGGGGGAAGGGAGATAGGAGGG - Intergenic
903745576 1:25584547-25584569 ATGTTATTATGGAGGTAGGAAGG - Intergenic
904000150 1:27334290-27334312 GTGTGGGTGGGCAGGCAGGAGGG - Intronic
904212901 1:28897543-28897565 CTGTAGGTAGGTAGGTAGGAAGG + Intronic
904567046 1:31434399-31434421 GTGTGGGTGTGGCGGGGGGATGG - Exonic
904768277 1:32867242-32867264 GTGGGGGTGTGGAAGCAGGAGGG + Intronic
904874512 1:33643880-33643902 GTCTGGGAATGAAGGAAGGAAGG + Intronic
904978976 1:34480449-34480471 GTGGGGGAATGGGGGTGGGAAGG - Intergenic
906461615 1:46038956-46038978 TTGTAGGTTTGGTGGTAGGAAGG + Intergenic
906652043 1:47519755-47519777 GTGTGGGCAGGGAGGGAGGGTGG + Intergenic
906785350 1:48610851-48610873 GTGTGTGTGTGGAAGGAGGAGGG - Intronic
906979306 1:50611829-50611851 GTGTGGGTATGTGGGGAGGTTGG - Intronic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907310442 1:53535925-53535947 GTGTGGGTACGGGGGTTGGAGGG - Intronic
907380423 1:54082710-54082732 GTGAGGGGAGGGAGGAAGGAGGG + Intronic
907460672 1:54603728-54603750 GTCTGGGTAGGGAGGCTGGATGG - Intronic
909488533 1:76200852-76200874 GTGGTGGTAAGGAGGCAGGATGG + Intronic
909607623 1:77522594-77522616 GGGTGGGCAGGGAGGTGGGATGG - Intronic
909920733 1:81377790-81377812 GTGGTGTTAAGGAGGTAGGATGG - Intronic
910873019 1:91852285-91852307 GTGTGTGTGTGGAGGTGGGGTGG - Intronic
911563023 1:99429589-99429611 GCATGGAAATGGAGGTAGGAGGG + Intergenic
912573401 1:110641796-110641818 GTGTGTGTAGGGAGGGAAGATGG + Intergenic
912637615 1:111312789-111312811 GTGTGGGGATGGGGGTTGGGGGG - Intronic
912952928 1:114133038-114133060 CTGAGGGTATGCAGGGAGGAAGG - Intronic
913206369 1:116542819-116542841 GTATGGGTAGGAAGGTAGGCAGG + Intronic
915013587 1:152712777-152712799 GAGTGGGAATGGAGGTAAGGAGG + Intergenic
915088208 1:153403255-153403277 TTGTGTGTATGAAGGAAGGAAGG + Intergenic
915096679 1:153467565-153467587 TTGTGCGTATGAAGGAAGGAAGG - Intergenic
915456092 1:156041849-156041871 GTGAGGGTAGGGGGGCAGGAGGG - Intronic
916236379 1:162592871-162592893 TTGGGGGTCTGGAGGGAGGATGG + Intronic
916417213 1:164603068-164603090 GAGTGGGTATGGAAGAAGGAAGG - Intronic
916489101 1:165285823-165285845 GTCTGGGTATGGATTTAGGGAGG + Intronic
916621685 1:166504709-166504731 GTGAGGGTAGGGAGGATGGAAGG + Intergenic
916738884 1:167631080-167631102 CTGTGTGTATGGAGGTATGCTGG + Intronic
917672488 1:177286106-177286128 GTGTGGGGATGGAGGAGAGAAGG + Intergenic
917921405 1:179753655-179753677 GTGTGTATATGGTGGTGGGAAGG + Intronic
918147739 1:181772342-181772364 GTGGGGGTGTGGAGAGAGGAGGG - Intronic
919452248 1:197786372-197786394 GTGTGGGTATGGGGTGAGAAAGG + Intergenic
919502102 1:198349973-198349995 GAGTGGGGATGGAGGTGGGATGG + Intergenic
919772159 1:201169136-201169158 GTGTAGGTATAGAGGTGGGTTGG + Intronic
920177670 1:204113145-204113167 GTGTGAGGATGGAGGCAGGGCGG - Intronic
921147992 1:212377700-212377722 GTTTGGGCTTGGAGGAAGGAAGG + Exonic
922471278 1:225878867-225878889 GTGTAGGTAGGTAGGTAGGTAGG - Intronic
922471279 1:225878871-225878893 GTGTGTGTAGGTAGGTAGGTAGG - Intronic
922471280 1:225878875-225878897 GTGTGTGTGTGTAGGTAGGTAGG - Intronic
923362653 1:233226800-233226822 GTGTGGGCATGGGGAGAGGAGGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923409783 1:233695554-233695576 GTGTGTGTATGGAGGTAGGCTGG - Intergenic
923433934 1:233950598-233950620 GTGGAGGGATGGAGGGAGGAGGG - Intronic
924150756 1:241126671-241126693 ATGGGGGGCTGGAGGTAGGAGGG - Intronic
924274500 1:242372007-242372029 GTGTGGGGAGGGTGGTAGGAGGG - Intronic
924286978 1:242497476-242497498 GTGTGTGTATGGAGGCAGGTGGG + Intronic
924946297 1:248849149-248849171 ATGTGGGTATGGAGGTGGGTGGG + Exonic
1063030645 10:2231736-2231758 GAGTGGTCATGCAGGTAGGATGG + Intergenic
1063030660 10:2231792-2231814 GAGTGGTCATGCAGGTAGGATGG + Intergenic
1063030676 10:2231848-2231870 GAGTGGTCATGCAGGTAGGATGG + Intergenic
1063030690 10:2231904-2231926 GAGTGGTCATGCAGGTAGGATGG + Intergenic
1063030706 10:2231960-2231982 GAGTGGTCATGCAGGTAGGATGG + Intergenic
1063030722 10:2232016-2232038 GAGTGGTCATGCAGGTAGGATGG + Intergenic
1063030736 10:2232072-2232094 GAGTGGTCATGCAGGTAGGATGG + Intergenic
1063030767 10:2232184-2232206 GAGTGGTCATGCAGGTAGGATGG + Intergenic
1063030782 10:2232240-2232262 GAGTGGTCATGCAGGTAGGATGG + Intergenic
1063030798 10:2232296-2232318 GAGTGGTCATGCAGGTAGGATGG + Intergenic
1063030812 10:2232352-2232374 GAGTGGTCATGCAGGTAGGATGG + Intergenic
1063470803 10:6283316-6283338 GTGTGCGTATGGGGGCAGGTGGG + Intergenic
1064779846 10:18822948-18822970 GGGTGGTTCTGGAGGAAGGAAGG + Intergenic
1065634991 10:27722656-27722678 GTGTAGGTAAGGAGGTTGGTTGG + Intronic
1065773482 10:29099144-29099166 GTGTGTGTGTGCAGGTAGGGAGG + Intergenic
1067310798 10:45111766-45111788 GTGGGGGTATGGATGTGGTATGG + Intergenic
1069164492 10:65135237-65135259 GTGGGGATATGGAGGTGGTATGG + Intergenic
1070161317 10:73868309-73868331 GTGTGGGGATGGAGGTGGGAAGG - Intronic
1070776798 10:79114531-79114553 GTGTGTGTGTGAAGGTGGGAGGG + Intronic
1071917996 10:90317564-90317586 GTGTGGGCAGAGAGGTAGGCAGG + Intergenic
1072637410 10:97186627-97186649 GTGGGTGCATTGAGGTAGGAAGG - Intronic
1072933860 10:99693082-99693104 GTGTGAGTAGGGTGGGAGGATGG + Intronic
1073128760 10:101171260-101171282 ATGTGGGTATATAGGCAGGAGGG - Intergenic
1073207365 10:101776155-101776177 GGGTGGGTGGGGAGGTGGGAGGG + Intronic
1073215519 10:101834051-101834073 GAGTAGATATGGAGGGAGGAGGG - Intronic
1073894490 10:108139130-108139152 TTGTGGGCATGGAGTTAGGAAGG - Intergenic
1074288811 10:112122851-112122873 CTGTGTCTAAGGAGGTAGGAAGG + Intergenic
1074300854 10:112232292-112232314 GTGAAGGGCTGGAGGTAGGAAGG + Intergenic
1074713034 10:116193254-116193276 GAGTGGGTGTGGAGGTGGCAGGG - Intronic
1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG + Intergenic
1076653565 10:132006306-132006328 GGGTGGGTGTGGGGGTGGGAGGG + Intergenic
1077138692 11:1014034-1014056 GGGTGGGCATGGAGCGAGGAGGG + Intronic
1077195625 11:1278648-1278670 GTGTGGGTGTGGAGGAAAGGTGG - Intronic
1077339917 11:2021679-2021701 GTGTGGGGGTGGCGGCAGGAAGG - Intergenic
1078148306 11:8737489-8737511 GTTTTGGTAGAGAGGTAGGAAGG + Intronic
1078197309 11:9146696-9146718 TTGTGGGTATGCAGGGAGGGAGG + Intronic
1078953829 11:16167143-16167165 GTGAGGGTCTGGAAGTTGGAGGG - Intronic
1080479966 11:32637585-32637607 GTGTGTGTTTGGGGGCAGGAGGG - Intronic
1081133298 11:39406837-39406859 GTAGGGGTATGGTGGTAGGGGGG + Intergenic
1081558936 11:44194477-44194499 GTTTGGGTATGTATGTAGGAGGG + Intronic
1081690274 11:45073381-45073403 GTGTGCATCTGGATGTAGGAGGG + Intergenic
1081796515 11:45824165-45824187 GTGTGGGTATGGGGAAGGGAGGG + Intergenic
1083188107 11:61029653-61029675 GTGTGTGTGTGTAGGTAGGTAGG + Intergenic
1083188108 11:61029657-61029679 GTGTGTGTAGGTAGGTAGGTAGG + Intergenic
1083188109 11:61029661-61029683 GTGTAGGTAGGTAGGTAGGTAGG + Intergenic
1083551674 11:63594640-63594662 GTGTGGGTATAGGGGATGGAAGG + Intronic
1084097092 11:66918708-66918730 GTGTGGGTATAGAGATAAGTAGG + Intronic
1084198042 11:67537073-67537095 AGGTGGGAATGGAGGTAGGCAGG - Intergenic
1084343538 11:68526565-68526587 GTGTGTGAATAGAGGTAAGATGG - Intronic
1085310773 11:75515405-75515427 GTCTGGGTGTGGAGTTAGGTGGG - Intronic
1086558665 11:88141867-88141889 ATGAGGGTAGGAAGGTAGGAGGG - Intronic
1088356027 11:108944660-108944682 GTGGGGGGAAGGAGGGAGGATGG + Intergenic
1088937841 11:114421521-114421543 GTGTGTGCATGGAGGTAGAGGGG + Intronic
1089275969 11:117336384-117336406 CGGTGGGTATGGAGGAAGGTGGG + Intronic
1089350045 11:117816995-117817017 CTGTGGGCATGGGGGCAGGAGGG - Intronic
1089669052 11:120039744-120039766 GGGTGGGAATGGAGTTAGGCAGG - Intergenic
1090640670 11:128726529-128726551 GTGGGGGTAGGGGGGTGGGAGGG - Intronic
1090761928 11:129845291-129845313 GTGTGTGTATGCATGAAGGAAGG + Intronic
1090761933 11:129845361-129845383 GTGTGTGTATGCATGAAGGAAGG + Intronic
1090933262 11:131318520-131318542 GTGGGGGGATGGGGGAAGGATGG + Intergenic
1202822902 11_KI270721v1_random:76868-76890 GTGTGGGGGTGGCGGCAGGAAGG - Intergenic
1092489135 12:8929377-8929399 CTGTGGATAAGGAGGTAGGAAGG - Intronic
1092776056 12:11946103-11946125 GAGTGGGTACAGAGGAAGGATGG + Intergenic
1092910235 12:13139845-13139867 ATGAGGGAATGGATGTAGGACGG - Intronic
1093930065 12:24947156-24947178 GTGTGTGTGTGGAGGGAAGACGG - Intronic
1094043385 12:26141267-26141289 GTTTGGGGATGGAGGAAGGGAGG + Intronic
1094166669 12:27450287-27450309 GTGGGGGCAGGGAGGGAGGAGGG - Intergenic
1094462965 12:30717889-30717911 ATTTTAGTATGGAGGTAGGAGGG - Intronic
1094763413 12:33561706-33561728 GTGTGGGCATGGTGGGATGATGG - Intergenic
1096124169 12:49107503-49107525 CAGTGTGCATGGAGGTAGGAGGG - Intronic
1096229818 12:49890626-49890648 GAGTGGGGATGGAGGAAGAAGGG - Intronic
1096230214 12:49892611-49892633 GAGTGGTGAGGGAGGTAGGAGGG - Intronic
1096358884 12:50966503-50966525 CTGAGGGTGTGGAGGTGGGAAGG - Intronic
1096490241 12:52009067-52009089 GTGTGGATGTGGAGCTGGGAAGG + Intronic
1096518265 12:52170264-52170286 GAGTGGGCATGGAGGGAGGAAGG + Exonic
1096539189 12:52295001-52295023 TTGTGGCTATCGAGGTAGAAAGG - Intronic
1096715301 12:53487429-53487451 CTGTGGGAATGAAGGAAGGAGGG + Intronic
1096725145 12:53555341-53555363 GTGAGGGTTTGGGGGAAGGAGGG + Intronic
1096760301 12:53836237-53836259 GTGATGGAATGCAGGTAGGAAGG + Intergenic
1096832708 12:54326669-54326691 GTGTGTGTGTGTAGGTAGGTAGG + Intronic
1097187315 12:57202783-57202805 GTGGGGGTATGGTGGGAGCACGG - Intronic
1098854784 12:75639926-75639948 GTGTGAGTTTGGTGGTATGAAGG + Intergenic
1098898055 12:76084836-76084858 GTGGGGGTATGGAGGTCGCCGGG - Exonic
1099970065 12:89491112-89491134 GGGTGGGTGGGGATGTAGGAGGG - Intronic
1100014028 12:89987234-89987256 GTGTGGGTATGGAGAGACGAAGG + Intergenic
1100209030 12:92381941-92381963 GAGGGGGGATGGAGGGAGGAAGG + Intergenic
1100300059 12:93298536-93298558 GTGGGGGTAAGGGGGTAGCAAGG + Intergenic
1101682558 12:106983965-106983987 AGGTGGGTATGGAGGTAGGTGGG - Intronic
1101777798 12:107809453-107809475 GTGTGGGTTTGTATGCAGGAGGG - Intergenic
1102711908 12:114935615-114935637 GTTTGGGTATGGACATAGGGTGG - Intergenic
1102770111 12:115468506-115468528 GATTCGGAATGGAGGTAGGATGG + Intergenic
1103240179 12:119406773-119406795 GTGGGGGTATGTAGGTAAGTGGG - Intronic
1103437348 12:120937127-120937149 GGGTGGGTAATGAGGTTGGAAGG + Intergenic
1104024806 12:125017988-125018010 GTGTGTGTAGGGTGGTGGGATGG + Intronic
1104414827 12:128589404-128589426 GTGTGGGTTGGGAGGGAGGCAGG - Intronic
1104948715 12:132429177-132429199 GTGTGGTCAGGGAGGGAGGAGGG - Intergenic
1106695884 13:32172066-32172088 GTGTGGGTGTGGATGTAGATAGG + Intronic
1107044000 13:35976170-35976192 GGGTGGGTTTGGAGGCAGGTTGG + Intronic
1109854022 13:68105705-68105727 GTGTGGGGGAGCAGGTAGGAGGG - Intergenic
1110295243 13:73856523-73856545 GTGCGTGTATGGAGGAGGGAGGG - Intronic
1110533698 13:76626891-76626913 ATGTGGGTTTGAAGGTAGGGAGG - Intergenic
1110811277 13:79813017-79813039 GTGTTTGTCTGGAGATAGGAGGG - Intergenic
1112188126 13:97147690-97147712 GTGTAGGTATCCAGGAAGGATGG + Intergenic
1112556420 13:100472563-100472585 GTGTGGGTCAGGAGGCAGAAAGG + Intronic
1113073145 13:106441149-106441171 GTGTGGGGGTGGAGGCTGGAAGG + Intergenic
1113333192 13:109352033-109352055 GTGTGTGTGTGGAGGTGAGAGGG + Intergenic
1113637513 13:111929707-111929729 GGGGGGGCATGGAGGGAGGAAGG + Intergenic
1114560783 14:23589042-23589064 CTGTGGGGGTGGAGGTGGGAGGG + Intergenic
1114712760 14:24795048-24795070 GTGGGGGGTTGGAGGGAGGAGGG - Intergenic
1115653339 14:35419689-35419711 GTGTGGCTGTGCAGGAAGGAGGG + Intergenic
1116737692 14:48714395-48714417 ATGAGGGTACGGAGGTAGCATGG + Intergenic
1117831136 14:59752070-59752092 GTGTGGATGTGGAGGTTGGAAGG - Intronic
1117928268 14:60808571-60808593 GTATAGGTATGTAGGTAGGCAGG + Intronic
1118348225 14:64955228-64955250 GTGTGGGCGGGGAGGGAGGAAGG - Intronic
1118362046 14:65064933-65064955 GCCTGGGCCTGGAGGTAGGAGGG - Intronic
1118469386 14:66061063-66061085 GGGTGGGTAGGTAGGTAGGTAGG + Intergenic
1118748092 14:68788793-68788815 GTGTAGGTCTGCAGGAAGGAAGG - Exonic
1118810330 14:69268510-69268532 GTGTGTGTGTGGAGGCAGGAGGG - Intronic
1119218446 14:72887138-72887160 GTGTGTGTTTGGAGGCAGAAGGG - Intronic
1119757333 14:77128381-77128403 GGGTGGGAGTGGAGGTAGGAGGG - Intronic
1119884049 14:78125368-78125390 GTGTGTGTAGGTAGGTAGGTAGG + Intergenic
1120049353 14:79847234-79847256 GTGTGGAGATGGAGATTGGAAGG - Intronic
1120081741 14:80225355-80225377 GTGTGTGTCTGGTTGTAGGAAGG - Intronic
1120265480 14:82244124-82244146 GTGTGGATTTGGAGGAAGGATGG - Intergenic
1120924212 14:89781868-89781890 ATGTAGGTGTGGAGGGAGGAGGG + Intergenic
1121407249 14:93726476-93726498 GTGTGTGTATGGGTGTGGGAGGG - Intronic
1122316498 14:100828523-100828545 GGAGGGGTATGGAGGGAGGAAGG - Intergenic
1122606074 14:102948287-102948309 GGGTGGGTGTGGAGGTGAGACGG + Intronic
1122606225 14:102948643-102948665 GGGTGGGTTTGGAGGTGGGGGGG + Intronic
1122606250 14:102948707-102948729 GGGTGGGTGTGGAGGTGAGAGGG + Intronic
1123010493 14:105347356-105347378 GTGTGGACATGGCGGTGGGAAGG - Intronic
1125532590 15:40423327-40423349 GAGTGGGAATGGGGATAGGAGGG - Intronic
1125967114 15:43883502-43883524 GTGTGGGTATCTAAGCAGGAGGG - Intronic
1126338311 15:47611138-47611160 GTGTGTGTGTGTATGTAGGACGG - Intronic
1126568566 15:50126129-50126151 GTGTGGGTGTGGAGGTGTCACGG + Intronic
1126688488 15:51268249-51268271 GGATGGGTGTGGAGGAAGGATGG - Intronic
1127559085 15:60118100-60118122 GTGTGGGTGGGGAGGTAGGTGGG + Intergenic
1127855568 15:62950798-62950820 GTGTGGGTAGGGATGTAGGTAGG + Intergenic
1128750190 15:70143258-70143280 GGGTGGGAATGGAGATTGGAGGG + Intergenic
1128758887 15:70201494-70201516 GTGTGTGTTTGGAGTTGGGATGG - Intergenic
1129156222 15:73719810-73719832 GGGTGGGTAGGTAGGTAGGCAGG - Intergenic
1130108493 15:80946541-80946563 ATGTGGTGATGGAGGAAGGAAGG - Intronic
1130158016 15:81370058-81370080 GATTGGGTGTGGAGGTAGCAGGG + Intronic
1130368889 15:83266252-83266274 GTGTGGGGAGGGAGGGAGGGAGG + Intronic
1130373338 15:83305922-83305944 GGGTGGGGATGGGGATAGGAGGG + Intergenic
1131015991 15:89058291-89058313 GTGTGGGTGTGGAGGAAGCTTGG - Intergenic
1131484134 15:92806572-92806594 GTGTATGTATGTAGGTAGGCAGG + Intronic
1131865325 15:96702601-96702623 GTGTGGGTATGGGGGAGGGGCGG + Intergenic
1131901924 15:97097252-97097274 GTGTGTGTTTGGAGGCAGAAAGG + Intergenic
1132513390 16:354663-354685 GTGTGGGAAAGGGGGTAGCATGG + Intergenic
1132767424 16:1541564-1541586 GCGTGGGGGTGGAGGTGGGAAGG - Intronic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1134540657 16:15062192-15062214 ATGTGGGTATGTTGGTAAGAAGG - Intronic
1134742582 16:16561066-16561088 GTGTGTGTGTGTAGGTAGGTAGG + Intergenic
1134742583 16:16561070-16561092 GTGTGTGTAGGTAGGTAGGTTGG + Intergenic
1134924979 16:18151386-18151408 GTGTGTGTGTGTAGGTAGGTTGG - Intergenic
1135560213 16:23470372-23470394 GTGTGTGTATGATGGTTGGATGG - Intronic
1135583679 16:23650427-23650449 GTGTGGGGAGGGAGGGAGGCAGG - Intronic
1135686098 16:24499471-24499493 GTGCGTGTGTGGAGGAAGGAAGG - Intergenic
1136340822 16:29642017-29642039 GTGTGGGCCTGGAGGTTGCATGG - Intergenic
1136570001 16:31090997-31091019 GTGCGGGTATGGCAGGAGGAGGG + Exonic
1137445516 16:48529569-48529591 ATGTGGCCATGGAGGGAGGAGGG - Intergenic
1137509768 16:49089002-49089024 GAGAGGGTAAGGGGGTAGGAGGG + Intergenic
1137641216 16:50031857-50031879 GTGTTGCCATGGAGGGAGGAAGG + Intronic
1137865358 16:51889951-51889973 GTGTGTGTATGGATGTTGAAAGG - Intergenic
1138707704 16:58934568-58934590 GTGGGGGTGGGGAGGAAGGAAGG - Intergenic
1139247916 16:65464345-65464367 GTGTGGGTCTGAGGGTATGAGGG - Intergenic
1139475084 16:67199098-67199120 CTGGGGGTAGGAAGGTAGGACGG - Exonic
1139655070 16:68382542-68382564 GGGAGGGTGTGGAGATAGGAAGG + Intronic
1140087713 16:71811282-71811304 GTGTAGGTAGGTAGGTAGGTAGG - Intergenic
1140094024 16:71859973-71859995 GGGTGGGTAGGTAGGTGGGAAGG + Exonic
1140132429 16:72175302-72175324 GTGTGGTTTTGGAGAGAGGAAGG + Intronic
1140519344 16:75567933-75567955 GTGTGGGCAAGGAGGTGGGTGGG - Intronic
1141489540 16:84362884-84362906 CTGTGGGTACGGCGGGAGGACGG - Intergenic
1141576177 16:84964701-84964723 GTGTGGGTATGGGAGTGGGCAGG + Intergenic
1142622160 17:1172077-1172099 GTGTGTGTGGGGAGGAAGGAAGG + Intronic
1142759279 17:2033968-2033990 GTGTGTGTATGGTTGTGGGAGGG - Intronic
1142778457 17:2161050-2161072 ATGTAGGTAGGTAGGTAGGAAGG + Intronic
1143216294 17:5227656-5227678 GTGTGGGGGTTGAGGTGGGAGGG + Intronic
1143498896 17:7327509-7327531 GTGTGGGGATGGGAGTAGGGGGG + Exonic
1144297364 17:13888884-13888906 TTGTGGAGATGGAGGGAGGAGGG + Intergenic
1145958790 17:28873350-28873372 GTGGGGGTAGGGAGTGAGGAGGG - Intergenic
1145960704 17:28885095-28885117 GTGTGGGTATGGAAGGAGAGAGG + Intronic
1145974783 17:28977767-28977789 GTGTGGGAAAGGGGGTGGGAGGG - Intronic
1146462460 17:33057025-33057047 GTGTGTTTAAGGAGGTGGGAAGG + Intronic
1146519658 17:33516422-33516444 GTGTGTGTATGGAGGAGGGGTGG + Intronic
1146941591 17:36847350-36847372 GTGTGGGGAGGGAGGTGGGAGGG + Intergenic
1147592828 17:41695910-41695932 GTGTGGGGATGGGGGCAGGAGGG - Intergenic
1147661585 17:42119868-42119890 GGGTGGGCATGGTGGTAGGGAGG - Intronic
1147683089 17:42266651-42266673 GTGTGGAGGTGGAGGTGGGAGGG + Intronic
1147686747 17:42290474-42290496 GAGTGGGTATGGAGGAAGAGAGG + Intronic
1148340980 17:46873281-46873303 GAGTGGGGAGGGAGGTAGAATGG - Intronic
1149027901 17:52051086-52051108 GAGTGGGAAGGGAGGAAGGAAGG + Intronic
1149084741 17:52701918-52701940 GTATGGCTGGGGAGGTAGGAAGG - Intergenic
1149397491 17:56259895-56259917 GTGTGTGTTTGGAGGTGGGGTGG - Intronic
1149551545 17:57544125-57544147 GTGTTTGTGTGTAGGTAGGAGGG + Intronic
1149848659 17:60022115-60022137 GGGTGGGTTTGGGGGTGGGAAGG - Intergenic
1149861510 17:60124409-60124431 GGGTGGGTTTGGGGGTGGGAAGG + Intergenic
1151538558 17:74752352-74752374 GTGTGGTTTTGGGGGTAGGGAGG - Intronic
1151774895 17:76193896-76193918 CTGTGGATGTGGAGGTGGGAGGG - Intronic
1152231778 17:79117522-79117544 GTGTGGGTGTGGAGGGAAGCGGG - Intronic
1155076688 18:22363498-22363520 GTGTAGGGATGCAAGTAGGAAGG - Intergenic
1156627819 18:38931017-38931039 GTGTGTGTGTGGAGGTGGGGAGG + Intergenic
1156640236 18:39086272-39086294 TTGTGGGTGTGGAGGTGTGAAGG + Intergenic
1157116915 18:44870656-44870678 GTGTAGGTGTGGAGGTGGGTGGG - Intronic
1157419775 18:47536983-47537005 GTGTAGGTAAGGATGTAGAAAGG + Intergenic
1157493415 18:48139171-48139193 GTGCGGGAGTGGAGGCAGGAGGG + Intronic
1157663998 18:49470019-49470041 TGGTGGGTATGGAGGAAGGTAGG - Intergenic
1157749106 18:50162284-50162306 TTGTGGGTAGGGAGGGAGGGAGG - Intronic
1158315972 18:56211443-56211465 GTGTGTGTAGGGAGGAAGGAAGG - Intergenic
1158315973 18:56211447-56211469 GTGTGTGTGTGTAGGGAGGAAGG - Intergenic
1158673609 18:59499329-59499351 GTGAGGGAAGGGAGGTAGGGGGG + Intronic
1159688929 18:71460714-71460736 GTGTGTGTGTGGAGGTGGGGTGG + Intergenic
1159730892 18:72026202-72026224 GTGTGGGACTGGAGGAAGGTGGG - Intergenic
1160025875 18:75215796-75215818 GTGTGTGCAGGGTGGTAGGAGGG - Intronic
1160972459 19:1775634-1775656 GAGTGGGCATGGAGGGAGGAAGG - Exonic
1161028821 19:2048724-2048746 GGGTGGGTGGGGAGGCAGGAGGG - Intronic
1161125922 19:2557000-2557022 GTGTGTGTGTAGAGGTGGGAGGG - Intronic
1161347162 19:3774193-3774215 GTGTGGGTATGGAGGTGCAAGGG + Intergenic
1161403395 19:4078708-4078730 GGGTGGGGATGGAGGTGGGGTGG - Intergenic
1163008306 19:14409876-14409898 GTGTGGGAAGGGAGGTGGGAGGG + Intronic
1163509021 19:17724459-17724481 GCGTGGGTCTGGAGGTGGGAAGG + Intronic
1164245172 19:23422054-23422076 GTGTGGGAGTGAGGGTAGGATGG + Intergenic
1164832594 19:31333972-31333994 GTGTGGGTGGGGAGGGAGCAAGG - Intronic
1164971108 19:32533265-32533287 GTGTGGCTCCGGAGGTAAGAGGG - Intergenic
1165149848 19:33753932-33753954 GTGTGGGGATGGTGGGAGGTTGG - Intronic
1165149863 19:33753976-33753998 GTGGGGGGATGGAGGGGGGATGG - Intronic
1165149881 19:33754016-33754038 GTGGGGGGATGGAGGGGGGATGG - Intronic
1165167995 19:33870763-33870785 GTGTGGGTAGGTAGGTAGATGGG - Intergenic
1165168014 19:33870831-33870853 GTGTGGGTAGGTAGGTAGATGGG - Intergenic
1166230368 19:41422931-41422953 GTGGGGGTCAGGAGGGAGGATGG - Intronic
1166379673 19:42349416-42349438 GGGTGGGTTTGGAGGTATCAGGG + Intronic
1166737329 19:45093684-45093706 GGGTGGCTATGGAGTTGGGAAGG + Intronic
925363219 2:3294271-3294293 GTGTGTGTGTGTAGGGAGGATGG - Intronic
925363255 2:3294440-3294462 GTGTGTGTTTGGAGAGAGGATGG - Intronic
925363263 2:3294475-3294497 GTGTGTGTGTGTAGGGAGGATGG - Intronic
925363298 2:3294638-3294660 GTGTGTGTTTGGAGAGAGGATGG - Intronic
925363484 2:3295554-3295576 GTGTGTGTGTGGAGAGAGGATGG - Intronic
925363498 2:3295619-3295641 GTGTGTGTATGTAGAGAGGATGG - Intronic
925363517 2:3295719-3295741 GTGTGTGTATGTAGAGAGGATGG - Intronic
925363670 2:3296447-3296469 GTGTGTGTGTGGAGAGAGGATGG - Intronic
925363724 2:3296716-3296738 GTGTGTGTGTGTAGGGAGGATGG - Intronic
925987748 2:9229958-9229980 GTTTGTGTATGGAGCAAGGAAGG + Intronic
926339697 2:11894846-11894868 CTGAGGGTAAGGAGGTGGGAAGG + Intergenic
926677519 2:15638664-15638686 GTGTGAGGATTGAGTTAGGATGG - Intergenic
927264896 2:21135692-21135714 GGGTGGGAATGGGGGTAGGGTGG - Intronic
927520827 2:23696994-23697016 GTGTGTGGCTGGAGGGAGGAAGG - Intronic
927707903 2:25308158-25308180 GTGTAGGTAGGTAGGTAGGTAGG + Intronic
927964719 2:27262050-27262072 GGGTGGGCAGGGAGGTCGGACGG + Intronic
928904461 2:36355693-36355715 GTCTGGGGGAGGAGGTAGGATGG + Intergenic
929935142 2:46289226-46289248 GCCTGGGGATGGAGGTGGGAGGG - Intergenic
931214342 2:60227308-60227330 GTGTGGGTCTGCAGTTAGCATGG - Intergenic
931223141 2:60306306-60306328 GGGTGGGAGTGGAGGGAGGAAGG - Intergenic
931784752 2:65608822-65608844 GAGTGGGTAGGAAGGCAGGAGGG + Intergenic
932120816 2:69098074-69098096 GTGTGGGAGTGGAGGTAGGGAGG + Intronic
932750265 2:74367063-74367085 GCATGAGTGTGGAGGTAGGACGG - Exonic
933189146 2:79313818-79313840 GTGTGTGTTTGGGGGTAAGAGGG + Intronic
933685306 2:85136597-85136619 ATGTAGGTATGGGGGTGGGATGG - Intronic
935527532 2:104189513-104189535 GTGTGGGTGTGGAGGTTGTTGGG - Intergenic
935613191 2:105047480-105047502 GGAAGGGGATGGAGGTAGGAGGG + Intronic
935677595 2:105609371-105609393 GAGTGTGAATGGAGATAGGATGG + Intergenic
936545656 2:113390840-113390862 GTGTTTGTATGGAACTAGGAGGG + Intergenic
937038615 2:118803383-118803405 GGGTGGGAATGGAGCAAGGATGG - Intergenic
939097467 2:137851020-137851042 GTGTGTGTGAGGAGGCAGGACGG + Intergenic
939618010 2:144381906-144381928 CTGTGGGTAGAGAGGTTGGATGG + Intergenic
939973573 2:148689597-148689619 GTGGGGGAAGGGAGGAAGGAGGG + Intronic
940053063 2:149484532-149484554 GGGTAGCTATGGAGCTAGGAAGG - Intergenic
940204629 2:151189233-151189255 GTGTGTGTATGGTGGTAGAATGG - Intergenic
941268960 2:163401277-163401299 GTGTTGGTATGGAGGGTAGAAGG - Intergenic
941799153 2:169635984-169636006 GTGAGGGTCAGGAGGTAGTAAGG - Intronic
942121433 2:172781731-172781753 GTGTGTGTGTGTAGGTAGGTAGG - Intronic
944522768 2:200588285-200588307 GTGTGCTTAAGGAGGTAGGTTGG + Intronic
944732321 2:202529336-202529358 ATTTGGGTATGGAGGGAGGGTGG - Intronic
944797241 2:203199812-203199834 GGGAGGGAATGGAGGGAGGAAGG - Intronic
945678964 2:212889904-212889926 GTGGGGGTAGGGAGTTGGGAGGG - Intergenic
945980914 2:216309935-216309957 GTGTGTGTTTGTAGCTAGGATGG - Intronic
946165926 2:217863829-217863851 GTCTGGGGATAGAGGGAGGAAGG + Intronic
946522955 2:220486423-220486445 GAGTGGCTAGTGAGGTAGGAGGG + Intergenic
946884780 2:224211988-224212010 GGGTGGGAGTGGAGGGAGGAGGG - Intergenic
947428989 2:230009224-230009246 GTTTGGGATAGGAGGTAGGATGG + Intronic
947505596 2:230706127-230706149 GTGTGGGTAGGGTGGAAGGATGG + Intergenic
948109717 2:235444950-235444972 GTCTGGGTCTGGAGGTGGGTGGG + Intergenic
948265647 2:236633457-236633479 GTGTGTGTCTGGAGCTGGGATGG + Intergenic
948540685 2:238689830-238689852 GTGTAGGAAGGGAGGGAGGAGGG + Intergenic
948558418 2:238834256-238834278 GTGTGTGTAGGTAGGTAGGTAGG - Intergenic
948558419 2:238834260-238834282 GTGTGTGTGTGTAGGTAGGTAGG - Intergenic
949042521 2:241855857-241855879 GTGTGTGTGTGGAGGTGGGAAGG + Intronic
1168754892 20:309660-309682 CTGTGGGTAAGGAGGCAGGAGGG - Intergenic
1169112213 20:3041593-3041615 GTGTGGGAATGAAGTGAGGAAGG - Intergenic
1169424127 20:5483366-5483388 GTGTGCTTTTGGAGGTGGGAGGG - Intergenic
1169468228 20:5860143-5860165 CTGCGGGTAAGAAGGTAGGAAGG + Intronic
1169647079 20:7823713-7823735 GTGAGGGTATGGGGGAAGTAGGG + Intergenic
1170153321 20:13247548-13247570 GTGTGTGTGTGTAGGTAGGTAGG + Intronic
1170436289 20:16333087-16333109 ATGTGGGCAAAGAGGTAGGAAGG - Intronic
1170475876 20:16713969-16713991 GGGTGGGAATGGAGGGTGGAAGG + Intergenic
1170537885 20:17359472-17359494 GTGTGGGAATGGAGCTCAGATGG - Intronic
1171252902 20:23663050-23663072 AGGTGGGAATGGAGGTAGAAAGG - Intergenic
1171259385 20:23718367-23718389 AGGTGGGAATGGAGGTAGAAGGG - Intergenic
1172007342 20:31826533-31826555 GTGCGGGTATGGAGGGTGGGTGG + Intronic
1172397768 20:34621585-34621607 GGGTGAGTATGGAGGCAGGCAGG + Intronic
1172446839 20:34997650-34997672 GGGTGGGTATGGGGTGAGGAAGG - Intronic
1172501794 20:35432936-35432958 CTGTGAGTATGGGGGTAGCAGGG + Intergenic
1172798156 20:37557625-37557647 GTGTGTGTAGGGTGGTAGGGTGG + Intergenic
1172801276 20:37578028-37578050 GTGTGGGGTTGGGGGAAGGAAGG - Intergenic
1173094962 20:40017081-40017103 GTGTGGGTGTGGATGTGGGTGGG + Intergenic
1173374456 20:42470913-42470935 ATGGGGGTATGGAGGTGGGGTGG + Intronic
1173547405 20:43909456-43909478 GTGTGTGTATGTATGTAGGAAGG + Intergenic
1173801956 20:45899588-45899610 GTGTGAGGATGGAGGAAGAAAGG - Intronic
1173980086 20:47217125-47217147 AGCTGGGTAAGGAGGTAGGAAGG + Intronic
1174577429 20:51546472-51546494 GTGGAGGGATGGAGGTGGGATGG + Intronic
1174757424 20:53173730-53173752 GGGTGGGTAGGCAGGTAGGTAGG + Intronic
1174978131 20:55358193-55358215 ATGTGGGTAATGAAGTAGGATGG - Intergenic
1175872194 20:62213748-62213770 GAGTGGGGATGGGGGTTGGAGGG + Intergenic
1175934976 20:62510215-62510237 GTGAAGGTATGGAGGCTGGAAGG - Intergenic
1176046922 20:63097516-63097538 GGGTGGGGATGGGGGTGGGAAGG + Intergenic
1176115688 20:63430978-63431000 GGGTGGGGATGGAGGCACGAGGG + Intronic
1176212472 20:63931689-63931711 GGGTGGGCGTGGAGGCAGGAGGG - Exonic
1176350860 21:5795388-5795410 GGGTGGGTGAGGAAGTAGGAGGG - Intergenic
1176357674 21:5915972-5915994 GGGTGGGTGAGGAAGTAGGAGGG - Intergenic
1176545181 21:8193458-8193480 GGGTGGGTGAGGAAGTAGGAGGG - Intergenic
1176564132 21:8376503-8376525 GGGTGGGTGAGGAAGTAGGAGGG - Intergenic
1176940288 21:14915638-14915660 GTGTGTGGATGGGGGTGGGAGGG + Intergenic
1177939567 21:27391915-27391937 GTGAGGGTATTGTGGTAAGAAGG - Intergenic
1180019027 21:45108615-45108637 ATGTGGGTGTGGTGGTTGGAAGG - Intronic
1181161164 22:20960748-20960770 GTGTGGGCAAGGAGGTAAGATGG - Intergenic
1181863501 22:25837341-25837363 GTGTGGCCAGGGAGGCAGGAGGG + Intronic
1183536347 22:38403801-38403823 GTCTGGGAATGGGGGTGGGAGGG + Intergenic
1183541028 22:38429568-38429590 GTGTGGGAAGGAAGGCAGGAGGG - Intronic
1184835651 22:47019553-47019575 GTGTGGGTGTGCAGGGAGGGAGG + Intronic
1185149048 22:49153921-49153943 GTGTGGGTAAGGTGGGAGGAGGG + Intergenic
1185186752 22:49405672-49405694 GGGTGGGGATGGGGGTGGGAGGG + Intergenic
1203250051 22_KI270733v1_random:109696-109718 GGGTGGGTGAGGAAGTAGGAGGG - Intergenic
949891205 3:8734664-8734686 GTGTGGGCCTGGAGGCAGCAGGG - Intronic
951537209 3:23751025-23751047 GTGTGGGTAGGGAGAGAGGAAGG - Intergenic
951655337 3:25001105-25001127 GTGTGAGGATGGAGGGAGGGAGG + Intergenic
952102668 3:30032950-30032972 CTGAGGGGATGGAGGTAAGAGGG + Intergenic
952243727 3:31562473-31562495 GTGGGGGTATGGAGCTAGCTGGG + Intronic
952591066 3:34954257-34954279 GTATGGGGAAGGAGATAGGAAGG + Intergenic
952835101 3:37595694-37595716 GTTTGGGTTTGTAGGCAGGATGG + Intronic
952841967 3:37654179-37654201 GTGTGTGTGTGGAGGCAGGAGGG - Intronic
952943849 3:38462955-38462977 GTTGGGGTGTGGAGGTAGGAAGG - Intronic
953025269 3:39141525-39141547 GTGTGGGTGTGTAGGAAGAAGGG + Intergenic
953095362 3:39769654-39769676 CTGTGGGTATGGATGTTGGCAGG - Intergenic
953374434 3:42416958-42416980 ATGTGTGTATGGTGGTAGCAAGG - Intergenic
953911354 3:46894651-46894673 GTGTGGGGATGTGGGTAGCAGGG - Intronic
953922342 3:46960853-46960875 TTGTGGGTATGGAGGTATAAAGG + Intronic
954248052 3:49347222-49347244 GTGTGGTTAGGGATGAAGGATGG + Intergenic
954794417 3:53154288-53154310 GTGTGGGTGGGGTGGGAGGAGGG + Intergenic
954899771 3:54008818-54008840 CTGTGGGTAGGGAAGTAGCAGGG - Intergenic
954954518 3:54507705-54507727 GTCTGGGAATGGAGGGAGGCTGG + Intronic
955731842 3:61995594-61995616 GTGTGGGTATGGGGGTGTGTAGG + Intronic
956066372 3:65401369-65401391 GTGGGGGGCTGGAGGTGGGAGGG - Intronic
957131130 3:76223371-76223393 GTGTGGGGAAGTAGGTAGGGGGG + Intronic
957153416 3:76516286-76516308 GTGTGGGTATGGAGGTAGGATGG - Intronic
957228003 3:77473917-77473939 ATGGGGGTTTGGAGGAAGGAAGG - Intronic
957422485 3:79989398-79989420 GTGTGTGCATGTAGGTAGGTGGG - Intergenic
957891083 3:86360038-86360060 GTATGGGTATTCAGGTAGGTAGG + Intergenic
959011459 3:101081636-101081658 GTGTGGGGGTGGGGGTAGGGGGG + Intergenic
960023629 3:112984177-112984199 GGATGGGTAAGGAGGTTGGAGGG + Intergenic
960337967 3:116441624-116441646 CTATGGGTATGAGGGTAGGAGGG + Intronic
960590899 3:119364227-119364249 GTGGGGGGATGGAGGTGGGGGGG + Intronic
960935227 3:122895604-122895626 GAGGGGGTATGGAGACAGGAGGG - Intergenic
961192472 3:124973535-124973557 GTGTTGCTATTGAGGTATGAAGG - Intronic
961481116 3:127181505-127181527 GTAGGGGTAGGGAGGTGGGAGGG + Intergenic
961569041 3:127785185-127785207 GTGTGGGGAAGGAGGGGGGAAGG - Intronic
961640309 3:128360728-128360750 GGGTGGGAGTGGAGGGAGGAGGG + Intronic
961986755 3:131142617-131142639 GTTGGGGTAGGGAGGTAGGTTGG - Intronic
962269536 3:133967868-133967890 GTGGGGGTGTGGAGGTGGGGTGG - Intronic
962422449 3:135240423-135240445 GTGTGGGATTGGAGGCAAGAAGG + Intronic
962642892 3:137406761-137406783 GAGTGAGTGTGGAGGGAGGAGGG + Intergenic
963550097 3:146709380-146709402 GTATGGGAAGGGAGGGAGGAAGG - Intergenic
964663837 3:159151014-159151036 GTGTGGGAATGCAGGTGGGAAGG + Intronic
966252866 3:177886281-177886303 GTGTGTATATGGGGGTAGGGAGG - Intergenic
966431139 3:179832575-179832597 GGGTGGGTAAGTAGGTAGGTTGG - Intronic
966431166 3:179832667-179832689 GGGTGGGTAAGTAGGTAGGTTGG - Intronic
966603813 3:181801698-181801720 GAGTGGGGAGGGAGGGAGGAAGG + Intergenic
966629012 3:182051088-182051110 GTGTGGGAAGTGAGGCAGGAAGG - Intergenic
966695807 3:182789843-182789865 GTGGGAGGATGAAGGTAGGAGGG - Intergenic
966758599 3:183394408-183394430 GTCTGGTTGTGGAGGTAGGAGGG - Intronic
966770600 3:183500350-183500372 GTGTGGCCAGGGAGGGAGGAAGG + Intronic
967899980 3:194440054-194440076 ATGTGGGTAGGGAGGGAGGGAGG + Intronic
968038259 3:195567051-195567073 AGGTGGGCATGGAGGGAGGAGGG - Intergenic
968274357 3:197428553-197428575 GAGTGGTGATGGAGGTGGGAGGG + Intergenic
968690544 4:1987701-1987723 GTGTGGGCACGGAGACAGGAGGG - Intronic
969061510 4:4439051-4439073 GTGTGGGTATATATGTGGGAGGG - Intronic
969096630 4:4737242-4737264 GTGTGGCTATGGAGGTCGTGGGG + Intergenic
969173424 4:5381865-5381887 GTGTGCGTATGAAGGAGGGAGGG + Intronic
969333412 4:6492976-6492998 GTGTTGGAATGGAGTGAGGAGGG - Intronic
970740755 4:19234959-19234981 GTGTGTGAAGGGAGGAAGGATGG - Intergenic
971664331 4:29462184-29462206 GAGGGGGGATGGAGGGAGGAGGG + Intergenic
972142024 4:35972824-35972846 CTGTAGGATTGGAGGTAGGAGGG - Intronic
974007524 4:56573713-56573735 GTGTGGGTATGGGTGTGGGTAGG + Intronic
974795546 4:66744515-66744537 GTGTGTGTGTGGAGGTGGGTGGG - Intergenic
975035681 4:69677320-69677342 GTGAGGGGCTGGAGGGAGGAAGG + Intergenic
975073229 4:70170119-70170141 GTGTGGGTGTGTGGGGAGGAGGG + Intronic
975525604 4:75346035-75346057 GTGTGTATATGGGGGTAGTATGG - Intergenic
979443073 4:120775815-120775837 GTGGCTGTATGGAGTTAGGATGG - Intronic
980419958 4:132546587-132546609 GTGTGGGTGTGGGGGTAGGGCGG - Intergenic
980682075 4:136176557-136176579 GTGTGTGTATGGTGGTGGGGGGG - Intergenic
980869066 4:138589827-138589849 GTGTGTGTGTGTAGGTAGGTAGG + Intergenic
981044637 4:140253466-140253488 GTGGGGATAAGGAGGAAGGAGGG + Intergenic
981344077 4:143655008-143655030 GTGTGGAAATGGAGGATGGAGGG - Intronic
982361650 4:154525047-154525069 GTTTTGGTAGGGAGGTGGGACGG + Intergenic
982802266 4:159720010-159720032 GTGTGGCTACGGAGTGAGGATGG + Intergenic
982909678 4:161124020-161124042 GTGGGGACATGGGGGTAGGAAGG + Intergenic
983574924 4:169250684-169250706 TAGTGGGGATGGGGGTAGGAGGG + Intronic
983851984 4:172592408-172592430 GTGTGGGGATGGTGGGAGGTAGG - Intronic
984613497 4:181868255-181868277 GTGAGGGAAGGGAGGTGGGAGGG - Intergenic
984720791 4:182970844-182970866 GAGTGGGGATGTAGGGAGGAAGG + Intergenic
984943755 4:184955324-184955346 ATGTGTGTGTGGAGGGAGGAGGG + Intergenic
985331325 4:188839476-188839498 GTGTGGGTATGAAAGTTGTATGG + Intergenic
985367954 4:189253397-189253419 GAGTGGGTAGGGTGGGAGGAGGG + Intergenic
985485509 5:146268-146290 GTGTGGGAAAGGAGGGAGGGGGG - Intronic
986221861 5:5775543-5775565 GTGTGGGCCTGGAGGTAAGAGGG + Intergenic
986881863 5:12184032-12184054 GAGTTGGGATGGAGGTAGCAGGG + Intergenic
986969086 5:13311123-13311145 GTGGGGGTAGGTAGGTAGGTAGG + Intergenic
987735597 5:21838868-21838890 ATGTGGGTATGGATGAAGGCTGG - Intronic
988444942 5:31275345-31275367 GAGTGGGGAGGGAGGTGGGAGGG - Intronic
988678391 5:33458065-33458087 ATGTTGGCAAGGAGGTAGGAGGG + Intronic
989300246 5:39882866-39882888 GTGTGTGTGTGGTGGTGGGAAGG + Intergenic
990182309 5:53174594-53174616 GTGTGGGAAGGGAGGGAGGGAGG - Intergenic
992530829 5:77650349-77650371 GTGTGTGTGTGGAGGTACAAGGG + Intergenic
993362535 5:86996046-86996068 GTGTGTGTTTGTGGGTAGGATGG - Intergenic
993390035 5:87308557-87308579 GTGAGATTATGGAGGTATGAGGG - Intronic
993810543 5:92470713-92470735 GTGTAGGTATGGAGGTATGGAGG + Intergenic
994588891 5:101748686-101748708 GTGTGTGTAAGTAGGTAGGTAGG - Intergenic
996103489 5:119470292-119470314 GTGTGGGCATGGTGGGATGATGG + Intronic
996336792 5:122392542-122392564 ATGGGTGTATGTAGGTAGGATGG + Intronic
996465570 5:123798684-123798706 GGGTGGGTATGGATTCAGGACGG + Intergenic
997696617 5:135866195-135866217 GTGTGGGTATGTCGGTATGTGGG - Intronic
999192403 5:149758057-149758079 GTGTGGGTTTGGAGGTGGGCAGG - Intronic
999269768 5:150289960-150289982 GTGTGGGCCTGGGGGTGGGATGG + Intronic
999475938 5:151899022-151899044 GTGTGTGTATGAAGGAGGGAGGG + Intronic
1000172662 5:158718374-158718396 GTGAAGGTATGGAGATAGAAAGG - Intronic
1000613702 5:163404629-163404651 GTGTGTGTAAGGAGGGAGGGGGG - Intergenic
1000683593 5:164219130-164219152 GTGTGAGTTTGGAGGTGGGTGGG - Intergenic
1001026202 5:168226281-168226303 GGGTGAGTTTGGGGGTAGGATGG - Intronic
1001462855 5:171933585-171933607 GTGTGTGTATGTGGGTAGAAGGG + Intronic
1001891715 5:175344788-175344810 GTGGGGGGAAGGAGGTGGGAAGG + Intergenic
1001948226 5:175797488-175797510 GTGGGGGTCTGGAGGGAAGACGG - Intronic
1001988898 5:176099662-176099684 GTGTGCATATGGAAGTTGGATGG + Intronic
1002188615 5:177467661-177467683 GGGTGGGGATGGCGGGAGGATGG - Intronic
1002227968 5:177738474-177738496 GTGTGCATATGGAAGTTGGATGG - Intronic
1002278176 5:178116266-178116288 GGGAGGGGGTGGAGGTAGGATGG + Intronic
1002877051 6:1220014-1220036 CTGTAGGTATGAAGGTAGGGAGG + Intergenic
1003923500 6:10855675-10855697 GGGTGGGGATGGGGGTGGGAGGG - Intronic
1004069919 6:12288568-12288590 GTGTGGGTGTGGGTGTGGGAGGG + Intergenic
1004189014 6:13447993-13448015 GGGTGGATTTGGAGGGAGGAGGG + Intronic
1004845177 6:19633896-19633918 GTGTGGAAAGGGAGGTGGGATGG + Intergenic
1005140955 6:22631056-22631078 AGGGGGGTAGGGAGGTAGGAGGG - Intergenic
1005164796 6:22907375-22907397 GTGTGTGTAGGGAGTGAGGATGG - Intergenic
1005573700 6:27172154-27172176 GTGTGTGTATGTATATAGGAGGG - Intergenic
1006102334 6:31693272-31693294 GAGAGGGCATGGAGGTGGGAGGG + Intronic
1006407132 6:33851906-33851928 GTTTGGGGGTGGTGGTAGGAGGG + Intergenic
1007909467 6:45499047-45499069 GTGTGGGTATGGAGGAGAGTGGG + Intronic
1008485726 6:52033341-52033363 TTGTGGGTGTGGGGGCAGGATGG - Intronic
1008683222 6:53896419-53896441 GTGTGTGTATGGGGGAAGGGAGG + Intronic
1010333827 6:74657360-74657382 ATGTGGAGATGGTGGTAGGAAGG + Intergenic
1011290510 6:85772229-85772251 GTGTTTGCATGGAGGCAGGACGG + Intergenic
1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG + Intergenic
1013970894 6:116017165-116017187 GTGTGTGTTGGGAGGTAGGGAGG - Intronic
1014518334 6:122406417-122406439 GTGAGAGTAGGGAGGTAGGCAGG + Intronic
1014856808 6:126412031-126412053 GTGGAGGGATGGAGGAAGGAAGG - Intergenic
1015506287 6:133992272-133992294 GTGTGGGCATAGATGTAGGTAGG + Intronic
1015575579 6:134667448-134667470 GTGTGGGTATGAGCGGAGGATGG - Intergenic
1015634802 6:135264683-135264705 GTGTAGGCATGGAGGTGGGTAGG - Intergenic
1015891759 6:137976785-137976807 GTGTGTGTAGGGAGGCAGGATGG - Intergenic
1016672134 6:146721492-146721514 GGGGGAGTATGGAGGTAAGAGGG + Exonic
1018266412 6:162029178-162029200 GTGTGGGGGTGGAGGTGGGTGGG - Intronic
1018476061 6:164142934-164142956 GGGAGGGTCTGGAGGAAGGAAGG + Intergenic
1018621734 6:165735364-165735386 GGGTGGGTAGGTAGGTAGGTAGG + Intronic
1018921294 6:168177704-168177726 GCGTGGGGAAGGAGGCAGGAGGG - Intergenic
1019026836 6:168972910-168972932 GTGTGTGTATGGAGAGAGAAAGG - Intergenic
1019092723 6:169553020-169553042 GTGTGTGTATGCAGGGAGGTGGG + Intronic
1019092736 6:169553088-169553110 GTGTGTGTATGCAGGGAGGTGGG + Intronic
1019486035 7:1289576-1289598 CTGTGGGTTTGGAGGGTGGAAGG - Intergenic
1020278062 7:6636840-6636862 TTGTGGGTGGGGAGGGAGGAGGG - Intergenic
1021016592 7:15543146-15543168 GAGTGGGTGTGGAGGAAGGAAGG - Intronic
1021491802 7:21227145-21227167 GGGTGGGTAGGTAGGTAGGTAGG - Intergenic
1021817661 7:24463992-24464014 GGGTTGGTATGGAGGTTGCATGG + Intergenic
1022045778 7:26621131-26621153 GTCTGGCTTTGGAGTTAGGATGG - Intergenic
1022384452 7:29888630-29888652 GTACAAGTATGGAGGTAGGAAGG + Intronic
1022393014 7:29959951-29959973 GTGGGGGGAGGGAGGGAGGAGGG + Intronic
1025120908 7:56301340-56301362 TTGTGGGGATGAAGGTGGGATGG - Intergenic
1026136351 7:67664897-67664919 GGGTAGTTATGGAGTTAGGAAGG - Intergenic
1027605567 7:80294307-80294329 GAGTGGGGAGGGAGGAAGGAAGG - Intergenic
1027629527 7:80585313-80585335 GTGTGTGTGTGGAGGTGGGGGGG + Intronic
1028775363 7:94669826-94669848 GGAAGGGTAGGGAGGTAGGAGGG + Intergenic
1028851522 7:95543339-95543361 GTGTAGGTAGGGAGCCAGGAAGG - Intergenic
1030083509 7:105797889-105797911 GTTTGACTATGGAGATAGGAAGG - Intronic
1031401420 7:121329386-121329408 ATGTGAGTATGGAGGTGGCAGGG + Exonic
1031522704 7:122785832-122785854 GTGTGGGGCTTGAGGTGGGAGGG - Intronic
1032190694 7:129763954-129763976 GGGTGGGCAAGGAGGGAGGATGG - Intergenic
1033120846 7:138665074-138665096 GCGTGGGGGTGGGGGTAGGAAGG - Intronic
1033345123 7:140520433-140520455 GTGGAGGTGTGGAGGGAGGATGG + Intronic
1034164992 7:149018825-149018847 GTGGGGGTGGGGGGGTAGGAGGG - Intronic
1034480567 7:151317220-151317242 GTGGGGGTAAGGAGGTCGGATGG + Intergenic
1034642106 7:152612428-152612450 GTGTGGGGGTGGAGTGAGGATGG - Intergenic
1034713938 7:153221805-153221827 GGTTGAGTATGGAGGTAGGATGG + Intergenic
1034749241 7:153553541-153553563 GTGTGTGTGTGGAGGTAGGGCGG - Intergenic
1035265827 7:157689986-157690008 GTGTGGGAAAGGAGGAGGGAAGG - Intronic
1035332665 7:158106463-158106485 GTGTGTGTGTGGAGGCAGGGAGG - Intronic
1035653644 8:1288639-1288661 GTGTGTGTACGTAGTTAGGAGGG + Intergenic
1035969102 8:4227868-4227890 GTGTGGGGTTGAATGTAGGATGG - Intronic
1037169413 8:15873908-15873930 GAGTGGGGAGGGAGGAAGGAAGG - Intergenic
1037498485 8:19463342-19463364 CTGTGGGTATGGTGGGTGGATGG - Intronic
1037877311 8:22554429-22554451 CTGTGGGGAAGGAGGAAGGAAGG - Intronic
1038040191 8:23717667-23717689 GTCTGGGAATAGAGATAGGAAGG + Intergenic
1038240556 8:25804229-25804251 GGGTGGGTAGGTAGGTAGGTAGG - Intergenic
1038271992 8:26082701-26082723 GTGTGAGTGTGGAAGCAGGAGGG - Intergenic
1038397423 8:27257441-27257463 GTGTTTGTATGGGGGTCGGAGGG - Intronic
1039065997 8:33607892-33607914 GAGAGGGAATGGAGGAAGGAAGG - Intergenic
1040017090 8:42708525-42708547 GTGTGTGTTTGGAGGGAGGTGGG + Intronic
1040839690 8:51772040-51772062 GTGTGGGCATGGAGGAAGAGGGG - Intronic
1041877495 8:62707042-62707064 GTGTGTGTATGTATGTATGATGG - Intronic
1041966976 8:63689435-63689457 GAGGGGGTATGGAGAAAGGAAGG - Intergenic
1042040349 8:64582131-64582153 GGGTGGGGAGGGAGGGAGGAGGG + Exonic
1042070895 8:64931953-64931975 GTGTGTGTATAGTGGTAGGGGGG - Intergenic
1042129036 8:65568347-65568369 CTGTGGGAATGGAAGTGGGAAGG - Intergenic
1042144831 8:65716884-65716906 GTGTGGGTATAGAGGTCTGAGGG - Intronic
1042210422 8:66375177-66375199 GGGTGGGAATTGAGGAAGGAGGG - Intergenic
1042798630 8:72692338-72692360 GTGAAGGATTGGAGGTAGGATGG + Intronic
1042906054 8:73773410-73773432 GAGTGGGGATGGAGGCAGCAGGG - Intronic
1044479729 8:92671340-92671362 GTATGGGTAAGGAGCAAGGAAGG - Intergenic
1044656009 8:94549372-94549394 GTGAGGGTATGGCTTTAGGAGGG - Intronic
1045076546 8:98575514-98575536 GTGTGGGAAAGAAGGAAGGATGG - Intronic
1045723294 8:105139678-105139700 GTGTGGGGAGGGTGGTGGGATGG + Intronic
1046530772 8:115442595-115442617 GTGTGTGTTTGGGGGAAGGAAGG + Intronic
1047179370 8:122572528-122572550 GTGTGTGCATGGGGGCAGGAAGG + Intergenic
1047740046 8:127799113-127799135 GTGTGTGTGTGGAGTTAGGTGGG + Intergenic
1048141646 8:131800882-131800904 GTGGGTGTATGGAGGTGGGACGG + Intergenic
1048148303 8:131867491-131867513 CTGTGGGCTTGGAGGGAGGAAGG - Intergenic
1048377257 8:133833654-133833676 GTGTGGGTATGGAGGGAATTGGG - Intergenic
1048577767 8:135706440-135706462 GTGTAGTTTGGGAGGTAGGAGGG - Intergenic
1050054242 9:1635286-1635308 GTGTGCACATGCAGGTAGGAAGG - Intergenic
1050350254 9:4734384-4734406 GTGTGGGCATGGGAGCAGGAGGG - Intronic
1050728623 9:8681550-8681572 GTGTGTGTATGGAGATGGGGAGG - Intronic
1050774798 9:9246486-9246508 CTGTGGGAGTGGAGGCAGGAAGG - Intronic
1051608639 9:18940519-18940541 GTGGAGGTAGGGAGGTTGGAGGG - Intronic
1052109928 9:24569004-24569026 GTGTGGGAATGAAGATTGGAAGG - Intergenic
1053073953 9:35116831-35116853 GTGTTGATATGGAGTTAGGAGGG + Intergenic
1053202856 9:36164597-36164619 GTGTGTGTATGGGGGTGGGGGGG - Intergenic
1053307553 9:36995127-36995149 GTGTGGCTTTGGGGGCAGGAAGG - Intronic
1053472655 9:38357963-38357985 GTGTGGTTATGAAGGTGGGAGGG + Intergenic
1055395592 9:75870573-75870595 GTGTGTGTAGGTAGGTAGGTAGG + Intergenic
1055395593 9:75870577-75870599 GTGTAGGTAGGTAGGTAGGTAGG + Intergenic
1055774617 9:79753909-79753931 GTGTGGGTATGGGGTGAGGTCGG + Intergenic
1056077807 9:83059604-83059626 GTGTGGGTGTTGAGGGTGGAGGG - Intronic
1056628540 9:88274032-88274054 GGGTGGGGATGGAGGGAGGCTGG + Intergenic
1056993978 9:91437659-91437681 GTGGGGCTAGGGAGGTAGAAAGG - Intergenic
1058077953 9:100669567-100669589 GTGTGTGTGGGGAGGTAGGCGGG + Intergenic
1058351204 9:104026539-104026561 GTGTGGTAATGCAGTTAGGAGGG + Intergenic
1058847215 9:108972846-108972868 GTGTGGGTGGGGGGGTGGGAGGG + Intronic
1059139900 9:111843115-111843137 GTGGGGGTAGGGAGATAGAAAGG + Intergenic
1059336011 9:113568873-113568895 GAGTGGGGATGGGGGCAGGATGG + Intronic
1060395933 9:123316561-123316583 CTGTGGGGATGGGGGTTGGAAGG + Intergenic
1061489010 9:130934832-130934854 GTGTGGCTGAGGAGGTAGAATGG - Intronic
1203466451 Un_GL000220v1:92963-92985 GGGTGGGTGAGGAAGTAGGAGGG - Intergenic
1185612145 X:1399079-1399101 ATGTGGGAAGGGAGGAAGGAGGG + Intergenic
1185746614 X:2578441-2578463 ATGTGGATTTGGAGCTAGGAGGG - Intergenic
1186038449 X:5449561-5449583 GTGTGGGGAGGGAGGTGGGTGGG - Intergenic
1186137024 X:6532789-6532811 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137045 X:6532848-6532870 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137056 X:6532878-6532900 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137068 X:6532911-6532933 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137087 X:6532970-6532992 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137106 X:6533029-6533051 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137118 X:6533062-6533084 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137129 X:6533092-6533114 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137141 X:6533125-6533147 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137152 X:6533155-6533177 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137164 X:6533188-6533210 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137176 X:6533221-6533243 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137187 X:6533251-6533273 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137198 X:6533281-6533303 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137218 X:6533343-6533365 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137240 X:6533405-6533427 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137252 X:6533438-6533460 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137263 X:6533468-6533490 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137275 X:6533501-6533523 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137287 X:6533534-6533556 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186267155 X:7844205-7844227 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267177 X:7844267-7844289 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267199 X:7844329-7844351 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267211 X:7844362-7844384 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267222 X:7844392-7844414 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267234 X:7844425-7844447 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267245 X:7844455-7844477 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186297738 X:8169171-8169193 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297750 X:8169204-8169226 GTGTGGGGAGGGAGGGAGGGGGG - Intergenic
1186297764 X:8169237-8169259 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297776 X:8169270-8169292 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297788 X:8169303-8169325 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297800 X:8169336-8169358 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297812 X:8169369-8169391 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297824 X:8169402-8169424 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297836 X:8169435-8169457 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297858 X:8169497-8169519 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297870 X:8169530-8169552 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297882 X:8169563-8169585 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297904 X:8169625-8169647 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297926 X:8169687-8169709 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297940 X:8169724-8169746 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297952 X:8169757-8169779 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297964 X:8169790-8169812 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297978 X:8169827-8169849 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186324882 X:8466630-8466652 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324955 X:8466838-8466860 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324967 X:8466871-8466893 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324978 X:8466901-8466923 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324989 X:8466931-8466953 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325001 X:8466964-8466986 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325014 X:8466997-8467019 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325036 X:8467059-8467081 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325117 X:8467296-8467318 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186518557 X:10185814-10185836 GTGTGGAAATGGAGGCAGCAGGG + Intronic
1186630109 X:11339512-11339534 GTGAGGAAATGGAGGTATGATGG - Intronic
1186654917 X:11601992-11602014 CTGTGTGTATGGAGGTGAGAGGG + Intronic
1187354082 X:18550333-18550355 CTGTGGGTATGGATGTGGGTGGG - Intronic
1187762566 X:22603730-22603752 GTGTTTCTATGGAGGTATGAAGG + Intergenic
1187995766 X:24924794-24924816 GTAAGGGTGTGGAGGAAGGAAGG + Intronic
1188248700 X:27864500-27864522 GTGTGGGTATGGCAGAGGGAGGG - Intergenic
1188287239 X:28342790-28342812 GTGTGGGGTTGGAGGTAGGTGGG - Intergenic
1189121927 X:38404405-38404427 GTTTGAGGATAGAGGTAGGAGGG + Intronic
1189852639 X:45192584-45192606 GGTTGGGTATGGAGGTAGAGTGG - Intronic
1191716160 X:64195149-64195171 GTGTGTATTTGGAGGTGGGAGGG - Intronic
1192207077 X:69103478-69103500 GAGTGGGGGTGGAGGTGGGATGG - Intergenic
1192591452 X:72363321-72363343 GGGTGGGGATGGAAGAAGGAAGG + Intronic
1192639744 X:72850445-72850467 GTGTGTGTATGGGGGGAGGGGGG - Intergenic
1192641967 X:72870360-72870382 GTGTGTGTATGGGGGGAGGGGGG + Intergenic
1194449382 X:94025760-94025782 GTGTGTGTGTGTAGGTAGGTAGG + Intergenic
1194976890 X:100405559-100405581 GTGTGTGTATGGGGGGGGGAGGG - Intronic
1195272549 X:103246313-103246335 GTGTGAGGATGTAGGAAGGATGG - Intergenic
1195294518 X:103462605-103462627 GTATGTGTTTGGAGGTAGGGAGG + Intergenic
1195406616 X:104521544-104521566 GTGTGTGTAAGAAGGTAGAAGGG + Intergenic
1196834243 X:119800077-119800099 GTGTGAGAATGGAGGAAGAAGGG - Intergenic
1198146171 X:133859517-133859539 GTGTGGGTAGGGAGAGATGAAGG + Intronic
1199963745 X:152801038-152801060 GTGTGGGAAGGGAGGGAGGTGGG - Intergenic
1199982924 X:152930727-152930749 GTGTGGCCAGGGAGGTAGGCAGG + Intronic
1200015957 X:153164082-153164104 GTGTGGGAAGGGAGGAAGGTGGG - Intergenic
1202098871 Y:21284533-21284555 GTGTGGGGTTGGAGGGAGGTGGG - Intergenic