ID: 957155160

View in Genome Browser
Species Human (GRCh38)
Location 3:76536448-76536470
Sequence CCACCAAGTGGGCCATGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 9, 3: 30, 4: 285}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957155154_957155160 14 Left 957155154 3:76536411-76536433 CCTTCAGGGTTTAGGGCTGAAAA 0: 1
1: 0
2: 21
3: 33
4: 185
Right 957155160 3:76536448-76536470 CCACCAAGTGGGCCATGAACTGG 0: 1
1: 0
2: 9
3: 30
4: 285
957155153_957155160 15 Left 957155153 3:76536410-76536432 CCCTTCAGGGTTTAGGGCTGAAA 0: 1
1: 2
2: 82
3: 480
4: 287
Right 957155160 3:76536448-76536470 CCACCAAGTGGGCCATGAACTGG 0: 1
1: 0
2: 9
3: 30
4: 285
957155150_957155160 23 Left 957155150 3:76536402-76536424 CCTTCTGGCCCTTCAGGGTTTAG 0: 1
1: 5
2: 44
3: 140
4: 356
Right 957155160 3:76536448-76536470 CCACCAAGTGGGCCATGAACTGG 0: 1
1: 0
2: 9
3: 30
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957155160 Original CRISPR CCACCAAGTGGGCCATGAAC TGG Intronic
900100337 1:959782-959804 GCACCCAGAGGGCCATGGACGGG - Intergenic
900570777 1:3357228-3357250 CCTCCACCTGGGCCATGAACGGG + Intronic
901270139 1:7945922-7945944 CCACCAAGTGGGCCATAAATTGG - Intergenic
903396070 1:23002746-23002768 TTGCCAAATGGGCCATGAACTGG + Intergenic
903811872 1:26039125-26039147 GCACCAACTGGGGCATGAACAGG - Exonic
904459116 1:30664951-30664973 TAACCAAGTGTGCCAGGAACTGG - Intergenic
906378683 1:45317547-45317569 TTGCCAAATGGGCCATGAACTGG - Intergenic
906744561 1:48212761-48212783 CTGCCAAATGAGCCATGAACTGG + Intergenic
907293556 1:53434163-53434185 TTGCCAAATGGGCCATGAACTGG - Intergenic
909035431 1:70590219-70590241 CTGCCAAATGAGCCATGAACTGG - Intergenic
910002785 1:82358653-82358675 CTGCCAAACGGGCCATGAACTGG + Intergenic
911416910 1:97586237-97586259 TCACCAAGTGGGAAAGGAACAGG + Intronic
911759828 1:101601831-101601853 CTGCCAAATGAGCCATGAACTGG + Intergenic
911966887 1:104382109-104382131 CTGCCAAATGAGCCATGAACTGG - Intergenic
916912603 1:169367243-169367265 CCCCCACGAGGGCCATTAACAGG - Intronic
918321020 1:183364985-183365007 CCACCCAGTGCCCCATGAACAGG + Intronic
920427380 1:205889041-205889063 TTGCCAAATGGGCCATGAACTGG + Intergenic
921459821 1:215413715-215413737 CTGCCAAATGAGCCATGAACTGG + Intergenic
922046387 1:221949845-221949867 CTGCCAAGTGGGCCATGAACTGG - Intergenic
922877045 1:228948174-228948196 CTGCCAAATGAGCCATGAACTGG - Intergenic
923075164 1:230603168-230603190 CCACCAAACAAGCCATGAACTGG - Intergenic
1064218237 10:13418074-13418096 CCAACACCTGGGCCATGGACTGG + Intergenic
1065019773 10:21494786-21494808 CCACCTAGTGGGTCCTGACCTGG - Exonic
1067360358 10:45573124-45573146 CTGCTAAATGGGCCATGAACTGG - Intronic
1068360741 10:55973138-55973160 CTGCCAAATGAGCCATGAACTGG - Intergenic
1071187191 10:83059061-83059083 TTGCCAAATGGGCCATGAACTGG - Intergenic
1071550831 10:86565035-86565057 TTGCCAAATGGGCCATGAACTGG + Intergenic
1072884486 10:99261529-99261551 TTGCCAAATGGGCCATGAACTGG - Intergenic
1073013972 10:100383668-100383690 TTGCCAAATGGGCCATGAACTGG - Intergenic
1073683492 10:105729303-105729325 CTGCCAAATGAGCCATGAACTGG - Intergenic
1073709526 10:106021392-106021414 CTGCCAAATGAGCCATGAACTGG + Intergenic
1073933174 10:108599745-108599767 CTGCCAAATGAGCCATGAACTGG - Intergenic
1074110105 10:110416953-110416975 CCACCAAGTGGGACACTTACAGG + Intergenic
1075013445 10:118893866-118893888 TTGCCAAATGGGCCATGAACTGG - Intergenic
1075604432 10:123794083-123794105 CCTCCAAGTCGGCCAAGAGCAGG - Intronic
1075830608 10:125407757-125407779 CAACCTAGTGAGACATGAACTGG - Intergenic
1076492978 10:130876145-130876167 CCAGCATGTGGGCTCTGAACCGG - Intergenic
1077688555 11:4319686-4319708 CTGCTAAGTGGGCCATGTACTGG + Intergenic
1079132665 11:17756721-17756743 CCCCCAACTGGGCCATCAGCAGG - Intronic
1079182467 11:18205324-18205346 CCACCCAGGGGCCCAAGAACAGG + Intronic
1081159665 11:39736301-39736323 CTGCTAAGCGGGCCATGAACTGG - Intergenic
1082197800 11:49325204-49325226 TGGCCAAATGGGCCATGAACTGG + Intergenic
1083890993 11:65595715-65595737 CCAGCAAGTGGGCCACAACCAGG + Exonic
1084354151 11:68626038-68626060 CTGCTAAGTGGGCCATGAACGGG - Intergenic
1084421065 11:69060841-69060863 CCAACCAGTGGGCAATGAATGGG + Intronic
1084613315 11:70218076-70218098 CCGCCAAACGAGCCATGAACTGG + Intergenic
1085627250 11:78082887-78082909 CCACCAAACAGGCCATGAACTGG - Intergenic
1085987975 11:81808127-81808149 CTGCCAAATGAGCCATGAACTGG - Intergenic
1086134881 11:83435386-83435408 CTGCTAACTGGGCCATGAACTGG + Intergenic
1086136314 11:83446703-83446725 CTGCCAAATGAGCCATGAACTGG + Intergenic
1086658018 11:89382922-89382944 TGGCCAAATGGGCCATGAACTGG - Intronic
1089279314 11:117361856-117361878 CCCCCAAGAGGAACATGAACTGG - Exonic
1089953259 11:122548847-122548869 CTGCTAAGCGGGCCATGAACTGG - Intergenic
1092159603 12:6308933-6308955 CCACCAGCTGGGCCAGGAGCAGG + Intergenic
1093281007 12:17196213-17196235 CCAACCTGTGGGCCATGGACTGG + Intergenic
1093302191 12:17471488-17471510 TTGCCAAATGGGCCATGAACTGG - Intergenic
1093812880 12:23509811-23509833 CTGCCAAATGAGCCATGAACTGG + Intergenic
1093951029 12:25165061-25165083 CTGCCAAATGAGCCATGAACTGG - Intronic
1094400627 12:30057888-30057910 CTGCCAAATGAGCCATGAACTGG - Intergenic
1095426024 12:42075475-42075497 CCACCAACTGGACCATGGGCTGG + Intergenic
1095633282 12:44402456-44402478 CCACCACTTGGGCCATAGACAGG + Intergenic
1095637615 12:44451708-44451730 CTGCCAAATGAGCCATGAACTGG - Intergenic
1095655948 12:44668918-44668940 CCACCCAGAGGCCCAAGAACAGG + Intronic
1096996167 12:55839607-55839629 CCATGAAGTGGGCCATGCTCTGG - Exonic
1097398545 12:59103778-59103800 CTGCCAAATGAGCCATGAACTGG - Intergenic
1099762550 12:86940738-86940760 CTGCCAAATGAGCCATGAACTGG - Intergenic
1099836135 12:87911185-87911207 CTGCCAAATGAGCCATGAACTGG + Intergenic
1099872743 12:88369592-88369614 CTGCTAAGCGGGCCATGAACTGG - Intergenic
1102604424 12:114057755-114057777 CCGCTAAGCGGGCCATGAACTGG - Intergenic
1103860180 12:124006162-124006184 CCACAAAGTGGACTATGAACTGG - Intronic
1104418527 12:128615748-128615770 CCAACCCCTGGGCCATGAACCGG - Intronic
1106015326 13:25863578-25863600 CAGCCAGGTGTGCCATGAACAGG - Intronic
1107093769 13:36512869-36512891 CCACCAAGCAGGCCAGGAATGGG + Intergenic
1108202658 13:48058294-48058316 CTGCCAAATGAGCCATGAACTGG - Intronic
1109716783 13:66230149-66230171 CTGCCAAATGAGCCATGAACTGG + Intergenic
1110119673 13:71866100-71866122 CCACCAAGTGCTTCAGGAACAGG + Exonic
1110650525 13:77937132-77937154 CTGCTAAGTGGGCCCTGAACTGG + Intergenic
1112129447 13:96505298-96505320 ACAGCAAGTGGGTCATGAAAGGG + Intronic
1112357486 13:98686127-98686149 CCACCATGATGACCATGAACAGG + Intronic
1113356155 13:109582386-109582408 CCTGCATGTGGGCTATGAACTGG - Intergenic
1114221635 14:20702496-20702518 TTGCCAAATGGGCCATGAACTGG - Intergenic
1115251910 14:31357881-31357903 CCAACCAGTGGGCCACGGACTGG + Intronic
1116140557 14:40988230-40988252 CCAACACCTGGGCCATGAACTGG - Intergenic
1116613472 14:47106120-47106142 CTGCCAAATGAGCCATGAACTGG - Intronic
1117174119 14:53130376-53130398 TTAACAAATGGGCCATGAACTGG - Intronic
1118937291 14:70299618-70299640 CTGCCAAGCTGGCCATGAACTGG + Intergenic
1119248435 14:73132432-73132454 TTGCCAAATGGGCCATGAACTGG + Intergenic
1119560330 14:75584470-75584492 CTGCCAAGCGGGCCATGAACTGG + Intronic
1120251436 14:82064880-82064902 CTGCCAAATGAGCCATGAACTGG + Intergenic
1121356431 14:93219306-93219328 CCACCTATTGGCCCCTGAACTGG + Exonic
1121980623 14:98450923-98450945 CTGCCAAATGAGCCATGAACTGG + Intergenic
1123037516 14:105477501-105477523 CCACCAACTGGGCCCTGATGGGG - Intronic
1123882533 15:24689347-24689369 CTACCAAACGAGCCATGAACTGG + Intergenic
1125342940 15:38692471-38692493 GCACCAGGTGGGCCATGCTCAGG - Intergenic
1125629179 15:41133424-41133446 CTGCTAAGTGAGCCATGAACTGG - Intergenic
1125849049 15:42886466-42886488 CTGCCAAACGGGCCATGAACTGG - Intronic
1126530194 15:49702909-49702931 CTGCCAAATGAGCCATGAACTGG + Intergenic
1126584724 15:50272627-50272649 CCCCCAAAATGGCCATGAACTGG + Intergenic
1129259397 15:74355840-74355862 CTGCCAAATGAGCCATGAACTGG - Intronic
1130956034 15:88628202-88628224 CCCCCAAGTCAGCCATGAAGTGG - Intronic
1132184523 15:99791983-99792005 CCACCAGGTGAGCCATGCGCTGG - Intergenic
1132432452 15:101772676-101772698 CCACCAGGTGAGCCATGCGCTGG + Intergenic
1133869590 16:9674914-9674936 CTGCTAAGCGGGCCATGAACTGG + Intronic
1135829539 16:25761148-25761170 CCACCAGGTGGGTCCTGACCAGG - Intronic
1136011182 16:27364205-27364227 CCTCCACGTGGGCCATGATCTGG - Exonic
1137055375 16:35743721-35743743 CTGCCAAATGGGCCATGAACTGG + Intergenic
1144677550 17:17171566-17171588 CCACCATGGGCGCCCTGAACAGG - Intronic
1144860899 17:18301283-18301305 CCACCAACTGGCCTATGACCCGG + Intronic
1148051529 17:44772204-44772226 CCGCCAAGTGGGCCTGGAGCAGG + Intronic
1152453910 17:80401822-80401844 CTGCCAAGTGGGCCATGAACTGG - Intergenic
1155961954 18:32002521-32002543 CCACTAAGCAGGCCATGAACTGG - Intergenic
1156251972 18:35360109-35360131 CTGCCAAATGAGCCATGAACTGG + Intergenic
1156924096 18:42556286-42556308 CTGCCAAATGAGCCATGAACTGG + Intergenic
1157647851 18:49295396-49295418 CCAACAAATGGGATATGAACGGG + Intronic
1158684398 18:59600115-59600137 CCAACCACTGGGCCATGGACAGG + Intronic
1161711171 19:5848998-5849020 CTGCCAAATGGGCCATGAACTGG - Intronic
1161711999 19:5854023-5854045 TTGCCAAATGGGCCATGAACTGG - Intergenic
1162409959 19:10499739-10499761 CCACCTTGTGGGCCATGAACTGG + Exonic
1163209602 19:15830719-15830741 CCACCAAACGGGCCATGAACTGG - Intergenic
1163944492 19:20522848-20522870 TTGCCAAATGGGCCATGAACTGG + Intergenic
1164004129 19:21133570-21133592 CCGCCAAATGGCCCATGAACTGG + Intergenic
1164080757 19:21859698-21859720 TTGCCAAATGGGCCATGAACTGG - Intergenic
1164536119 19:29087663-29087685 CCAAGAAGTGCTCCATGAACAGG + Intergenic
1166905840 19:46107848-46107870 TTGCCAAATGGGCCATGAACTGG + Intergenic
1167099423 19:47394960-47394982 CTGCTAAGTGGGCCACGAACTGG - Intergenic
1168212159 19:54898689-54898711 CTGCCAAATGAGCCATGAACTGG + Intergenic
925274344 2:2638224-2638246 CCACCAGGTGGGCCATTGATAGG + Intergenic
925744241 2:7031153-7031175 CCAACACCTGGGCCATGGACGGG - Intronic
927134125 2:20084256-20084278 TTGCCAAATGGGCCATGAACTGG - Intergenic
928521979 2:32098028-32098050 AGAGCAAGTGGGCTATGAACTGG - Intronic
928778265 2:34791648-34791670 CTGCCAAATGAGCCATGAACTGG - Intergenic
928884287 2:36130456-36130478 CCACCAAGTGGGCTAGTACCAGG + Intergenic
929383501 2:41379847-41379869 CTGCCAAATGAGCCATGAACTGG - Intergenic
929946523 2:46376587-46376609 CCATCAGGTGGGGCTTGAACAGG - Exonic
931850385 2:66245869-66245891 CCGCCGAATGAGCCATGAACTGG - Intergenic
932102704 2:68915178-68915200 CCACCAAGTAGGCAATGACGTGG + Intergenic
933137888 2:78759812-78759834 TTGCCAAATGGGCCATGAACTGG - Intergenic
933721666 2:85401210-85401232 CCACCGAGCGGGCACTGAACTGG - Exonic
937697877 2:124828021-124828043 GCACCCAGTGTGCCATGGACAGG + Intronic
938453790 2:131445411-131445433 GCACCCAGAGGGCCATGGACGGG - Intergenic
938972457 2:136445004-136445026 CCAGCGCCTGGGCCATGAACAGG + Intergenic
941456225 2:165714265-165714287 CTGCCAAATGAGCCATGAACTGG + Intergenic
943061540 2:183045803-183045825 CTGCCAAATGGGCCATGAACTGG - Intergenic
944250988 2:197580052-197580074 TTGCCAAGTGGGCCATGAACTGG - Intronic
944509830 2:200453634-200453656 CCACCACGTGGGCCTTGAGCTGG - Intronic
944719908 2:202413168-202413190 GCACTAAATGGGCCACGAACAGG - Intronic
945301526 2:208220032-208220054 CTGCCAAATGAGCCATGAACTGG + Intergenic
946655889 2:221946615-221946637 CCAACACCTGGGCCATGGACCGG - Intergenic
946871802 2:224091646-224091668 CTGCCAAATGAGCCATGAACTGG + Intergenic
948128539 2:235583115-235583137 CCTCCAAGTGGGCCAGGGTCAGG + Intronic
1168839218 20:898459-898481 CTGCTAAGTGGGCCATGAACGGG - Intronic
1170325528 20:15151630-15151652 CTGCCAAATGAGCCATGAACTGG + Intronic
1171258445 20:23710048-23710070 CCACCCAGGAGGCCATGACCTGG - Intergenic
1171262416 20:23746280-23746302 GCACCCAGGAGGCCATGAACTGG - Intergenic
1171265590 20:23769581-23769603 CCATCCAGAGGGCCATGAATGGG - Intergenic
1172932515 20:38596529-38596551 CTGCCAAGCGGGCCATGACCTGG + Intergenic
1173763819 20:45587992-45588014 CTGCCAAATGAGCCATGAACTGG + Intergenic
1174541818 20:51295903-51295925 CCACCCAGGGAGCTATGAACAGG - Intergenic
1177100581 21:16894095-16894117 CTGCCAAATGAGCCATGAACTGG - Intergenic
1177102635 21:16915902-16915924 CTGCCAAATGAGCCATGAACTGG - Intergenic
1179898141 21:44374833-44374855 CCACCCCCTGGGCCATGGACTGG - Intronic
1180119699 21:45738692-45738714 CTACCCAGGGGGCCATGGACAGG - Intronic
1180119880 21:45739253-45739275 CCATCCAGGGGGCCATGGACAGG - Intronic
1180120047 21:45739770-45739792 CCACCCAGAGGGCCATGGGCAGG - Intronic
1180560907 22:16613548-16613570 CTGCTAAGTGGGCCATGACCTGG - Intergenic
1182062403 22:27407558-27407580 CCACCCCGTGGACCCTGAACTGG + Intergenic
1182281198 22:29218634-29218656 GCACCAAGTGGGCCAGGGAGGGG + Intronic
950575660 3:13830640-13830662 CCACCATGTGGTCCATGGACAGG - Intronic
950801311 3:15553931-15553953 CCATAAAGAGGGCCATGAAGAGG - Intergenic
951762839 3:26164165-26164187 CTGCCAAATGAGCCATGAACTGG + Intergenic
953177155 3:40562932-40562954 CTGCCAAATGAGCCATGAACTGG - Intronic
954161804 3:48728137-48728159 CTGCCAAATGAGCCATGAACTGG + Intronic
955253324 3:57305619-57305641 CCGCCAAATGAGTCATGAACTGG - Intronic
955592495 3:60552623-60552645 TTACCAAGTTGGCAATGAACAGG - Intronic
955797316 3:62650984-62651006 TCTCCAAGTTGGCCATGAGCAGG + Exonic
956018294 3:64907696-64907718 GCACCAGGTGGGCCATTAACAGG + Intergenic
956233541 3:67042476-67042498 CTGCCAAATGAGCCATGAACTGG + Intergenic
957155160 3:76536448-76536470 CCACCAAGTGGGCCATGAACTGG + Intronic
957451402 3:80386813-80386835 CTGCCAAATGAGCCATGAACTGG - Intergenic
958676854 3:97276751-97276773 CTGCCAAATGAGCCATGAACTGG + Intronic
959485814 3:106926499-106926521 CTGCCAAACGGGCCATGAACTGG + Intergenic
961293467 3:125865617-125865639 CTGCCAAATGAGCCATGAACTGG - Intergenic
962524006 3:136221681-136221703 CTGCTAAGCGGGCCATGAACTGG + Intergenic
963111885 3:141695056-141695078 TTGCCAAATGGGCCATGAACTGG + Intergenic
963520404 3:146355466-146355488 CTGCCAAATGAGCCATGAACTGG - Intergenic
963521582 3:146363968-146363990 CTGCCAAATGAGCCATGAACTGG - Intergenic
963578956 3:147099928-147099950 CCAACACTTGGGCCATGAGCTGG - Intergenic
964067828 3:152599280-152599302 CTGCTAAGCGGGCCATGAACCGG - Intergenic
964176088 3:153827071-153827093 CTGCTAAGTGGGCCATGAACCGG + Intergenic
964984912 3:162726315-162726337 CTGCCAAATGAGCCATGAACTGG + Intergenic
965070285 3:163909483-163909505 CTGTCAAATGGGCCATGAACTGG - Intergenic
965335069 3:167424489-167424511 CTGCCAAATGAGCCATGAACTGG - Intergenic
965624924 3:170676314-170676336 CTGCCAAATGAGCCATGAACTGG + Intronic
965862018 3:173159705-173159727 CTGCCAAACGGGCCATGAACTGG + Intergenic
966279257 3:178209445-178209467 CTGCCAAATGAGCCATGAACTGG - Intergenic
966397608 3:179518770-179518792 CTGCCAAATGAGCCATGAACTGG - Intergenic
966398485 3:179524704-179524726 CTGCCAAATGAGCCATGAACTGG + Intergenic
967005410 3:185378325-185378347 CTGCCAAACGGGCCATGAACTGG + Intronic
967662548 3:192130716-192130738 CCACTAGGTGGCACATGAACTGG + Intergenic
968413361 4:407639-407661 CTGCCAAGCGGGCCAGGAACCGG + Intergenic
968531061 4:1091897-1091919 CCACCCCGTGGGCTATGAAGAGG + Intronic
968870269 4:3238582-3238604 ACACCACGGTGGCCATGAACTGG - Exonic
970042047 4:11808186-11808208 CTGCCAAATGAGCCATGAACTGG - Intergenic
970087502 4:12365680-12365702 CTGCCAAATGAGCCATGAACTGG - Intergenic
970532688 4:16999604-16999626 CTGCCAAAGGGGCCATGAACTGG - Intergenic
970854090 4:20634069-20634091 CTGCCAAATGAGCCATGAACTGG + Intergenic
970887318 4:21001387-21001409 CCTCCAAGTGGGTCCTGAAATGG + Intronic
971552604 4:27975876-27975898 GCGCCAAATGGGCCATGAACTGG - Intergenic
971726339 4:30317507-30317529 CCACCATGTGTGACATGAATGGG + Intergenic
972071179 4:35020578-35020600 TTGCCAAATGGGCCATGAACTGG + Intergenic
974950975 4:68582644-68582666 CCACCAGGTGGGCCAGGTCCAGG - Intronic
976479428 4:85522853-85522875 CCTCTAAGTGGGCCTTGAAGTGG - Intronic
976558527 4:86476496-86476518 CTGCCAAATGAGCCATGAACTGG - Intronic
977446479 4:97138396-97138418 CTGCCAAATGAGCCATGAACTGG + Intergenic
977626257 4:99192528-99192550 CCATAAAGTGGGTCATGTACAGG - Intergenic
977782483 4:100995580-100995602 CTGCCAAACGGGCCATGAACTGG + Intergenic
978303273 4:107294216-107294238 TTGCCAAATGGGCCATGAACTGG + Intergenic
979764092 4:124444815-124444837 CCACCACTGGGGCCAAGAACAGG - Intergenic
980284904 4:130769270-130769292 CTGCCAAATGAGCCATGAACTGG - Intergenic
980472481 4:133267493-133267515 CTGCCAAATGAGCCATGAACTGG + Intergenic
980527827 4:134014081-134014103 CTGCCAAATGAGCCATGAACTGG - Intergenic
982318765 4:154058191-154058213 TTGCCAAATGGGCCATGAACTGG - Intergenic
982396763 4:154922638-154922660 CTGCCAAATGAGCCATGAACTGG + Intergenic
982414240 4:155112235-155112257 CTGCCAAATGAGCCATGAACTGG + Intergenic
982650294 4:158080047-158080069 GCAACCAGTGGGCCATAAACTGG + Intergenic
985079046 4:186245931-186245953 CTGCCAAACGGGCCATGAACTGG + Intronic
985538733 5:478182-478204 CCCCCGAGTGGGCAGTGAACTGG - Intronic
986502588 5:8416006-8416028 CTGCCAAAAGGGCCATGAACTGG - Intergenic
986555086 5:9002346-9002368 CTGCCAAATGAGCCATGAACTGG + Intergenic
987096203 5:14552631-14552653 CCATGAAGTGGGCCCTCAACAGG + Intergenic
989255150 5:39358447-39358469 CCACCTTGTAGGCCATGGACAGG + Intronic
989615193 5:43331742-43331764 TTGCCAAATGGGCCATGAACTGG + Intergenic
989688945 5:44118501-44118523 TTGCCAAATGGGCCATGAACTGG + Intergenic
989705041 5:44319845-44319867 CCAACCACTGGGCCATGGACTGG + Intronic
992452052 5:76884186-76884208 CTGCTAAGAGGGCCATGAACTGG + Intronic
993467636 5:88268445-88268467 ACAGTAAATGGGCCATGAACAGG + Intronic
993559767 5:89391571-89391593 TCAATAAGTGGTCCATGAACTGG - Intergenic
994324828 5:98436478-98436500 TTGCCAAATGGGCCATGAACTGG - Intergenic
996437820 5:123454967-123454989 CCACCAGATGGGACATCAACTGG - Intergenic
997157245 5:131573778-131573800 CTGCTAAGTGGGCCATGAACTGG - Intronic
997678904 5:135735455-135735477 CTGCCAAATGAGCCATGAACTGG + Intergenic
997746357 5:136303223-136303245 CTGCCAAATGAGCCATGAACTGG - Intronic
997769719 5:136543386-136543408 CTGCCAAATGAGCCATGAACTGG + Intergenic
997770674 5:136550122-136550144 CCGCTAAGCGGGCCATGAACCGG + Intergenic
997900623 5:137760601-137760623 CCACCTCCTGGGCCATGGACTGG - Intergenic
999618908 5:153453483-153453505 CTGCCAAATGAGCCATGAACTGG + Intergenic
999718815 5:154383269-154383291 CCAGCAAGTGGGCAATCTACAGG + Intronic
1000438543 5:161241879-161241901 CTGCCAAATGAGCCATGAACTGG - Intergenic
1000606886 5:163335957-163335979 TTGCCAAATGGGCCATGAACTGG - Intergenic
1000885367 5:166742885-166742907 CTGCCAAATGAGCCATGAACTGG + Intergenic
1001225437 5:169940848-169940870 CCAACACCTGGACCATGAACTGG - Intronic
1001354519 5:171006816-171006838 CTGCTAAGCGGGCCATGAACTGG + Intronic
1001481864 5:172094239-172094261 CCTCCCTGTGGGCCATGAGCTGG - Intronic
1002169851 5:177368899-177368921 CTACCTGGTGGGCAATGAACAGG + Exonic
1002521032 5:179793407-179793429 CCACCCAGGGGGCCTTGGACAGG + Intronic
1003099694 6:3167766-3167788 CTACAAAGCAGGCCATGAACTGG - Intergenic
1004952209 6:20686228-20686250 CCAACCCCTGGGCCATGAACTGG + Intronic
1005923318 6:30418956-30418978 CCACCATGTGGGGAATGAAAGGG - Intergenic
1007465718 6:42049729-42049751 CTTCCAAGTGGGCCATTGACAGG + Intronic
1010510591 6:76713768-76713790 TCACCATGTTGGCCATGAATAGG + Intergenic
1010894583 6:81348904-81348926 CTGCCAAATGAGCCATGAACTGG + Intergenic
1011911784 6:92449605-92449627 CCACCACGTGGGACATGAACAGG + Intergenic
1012505918 6:99946158-99946180 CCAGGAAGAGGGCCTTGAACAGG - Intronic
1013808134 6:114016113-114016135 CTGCTAAGCGGGCCATGAACTGG + Intergenic
1014115391 6:117663484-117663506 CTGCCAAACGGGCCATGAACTGG + Intergenic
1014396017 6:120927126-120927148 CCGCTAAGCGGGCCATGAACTGG - Intergenic
1016535800 6:145106923-145106945 CTGCCAAATGAGCCATGAACTGG + Intergenic
1016650336 6:146454189-146454211 CTGCCAAATGAGCCATGAACTGG + Intergenic
1017922884 6:158886830-158886852 CTGCCAAGCGGGCCATGACCTGG + Intronic
1020532757 7:9357193-9357215 CTGCCAAATGAGCCATGAACTGG + Intergenic
1021429803 7:20547385-20547407 CAGCCAAATGAGCCATGAACTGG - Intergenic
1021637272 7:22705180-22705202 CTGCCAAATGAGCCATGAACTGG - Intergenic
1021660576 7:22915055-22915077 TTGCCAAATGGGCCATGAACTGG - Intergenic
1022901044 7:34811130-34811152 CCACCAAGAGGGCACTGAGCTGG - Intronic
1027158272 7:75783835-75783857 CTGCTAAGTGGGCAATGAACTGG - Intronic
1027354372 7:77341608-77341630 TTGCCAAATGGGCCATGAACTGG - Intronic
1027448547 7:78302912-78302934 GAACCAAGTGGGATATGAACAGG + Intronic
1029130880 7:98329839-98329861 CCACCAAGTTATCCATCAACAGG + Intronic
1029317112 7:99725179-99725201 GTGCTAAGTGGGCCATGAACTGG - Intronic
1030086050 7:105816643-105816665 CCTCCACTTGGGCCAGGAACAGG - Intronic
1031004627 7:116457420-116457442 CTGCCAAATGAGCCATGAACTGG - Intronic
1032687910 7:134254458-134254480 CCAGGAAGTGGGCCCTGACCAGG - Intronic
1033084670 7:138330939-138330961 TTGCCAAATGGGCCATGAACTGG - Intergenic
1033465080 7:141582586-141582608 TTGCCAAATGGGCCATGAACTGG + Intronic
1034224166 7:149470020-149470042 GCACCAAGTGGGCCACGAGGAGG + Intergenic
1034334084 7:150309268-150309290 CCACCAAGCGGGCCAAGAACTGG - Intronic
1036281439 8:7404374-7404396 CTGCCAAATGAGCCATGAACTGG - Intergenic
1036340030 8:7907198-7907220 CTGCCAAATGAGCCATGAACTGG + Intergenic
1041651886 8:60310301-60310323 CGGCCAAATGAGCCATGAACTGG + Intergenic
1041917583 8:63152102-63152124 TTGCCAAATGGGCCATGAACTGG + Intergenic
1042706040 8:71666341-71666363 TTGCCAAATGGGCCATGAACTGG - Intergenic
1043597495 8:81902306-81902328 CCACCAAATGAGCCATGAACTGG + Intergenic
1043837691 8:85064877-85064899 CTGCCAAATGAGCCATGAACTGG - Intergenic
1044631706 8:94286541-94286563 TCACCAAGTAGACCATGAGCAGG + Intergenic
1045654953 8:104377162-104377184 CCAACCCTTGGGCCATGAACTGG - Intronic
1046557228 8:115790236-115790258 CAACCTAGTGAGACATGAACTGG + Intronic
1047856329 8:128916328-128916350 CTGCCAAATGAGCCATGAACTGG - Intergenic
1048135425 8:131742635-131742657 CTGCCAAATGAGCCATGAACTGG - Intergenic
1048321746 8:133405579-133405601 CGCCCAAGTGCCCCATGAACAGG + Intergenic
1048728468 8:137412076-137412098 CTGCCAAATGAGCCATGAACTGG + Intergenic
1049790783 8:144471876-144471898 CCACCAAATAGGGCATAAACAGG + Intronic
1053134165 9:35638945-35638967 CTGCCAAGCGGGCCAGGAACTGG - Intronic
1056882938 9:90414512-90414534 CTGCCAAATGAGCCATGAACTGG - Intergenic
1057168485 9:92946673-92946695 CCCCAAATTGGGCCATAAACTGG - Intergenic
1057982040 9:99672101-99672123 CTGCCAAATGAGCCATGAACTGG - Intergenic
1058612356 9:106790107-106790129 CTGCCAAATGAGCCATGAACTGG - Intergenic
1060226153 9:121792233-121792255 CTGCTAAGCGGGCCATGAACTGG - Intergenic
1062691526 9:137844651-137844673 CTGCCAAGCGGGCCATGAACTGG - Intronic
1187134345 X:16532353-16532375 CCACAAAGTGGGTCATGCAAAGG - Intergenic
1188301101 X:28506196-28506218 CTGCCAAATGGGCCATGAACTGG + Intergenic
1189031854 X:37459584-37459606 CTGCCAAATGAGCCATGAACTGG + Intronic
1191014242 X:55792078-55792100 TTGCCAAATGGGCCATGAACTGG + Intergenic
1191805859 X:65133433-65133455 TTGCCAAATGGGCCATGAACTGG + Intergenic
1191971692 X:66824178-66824200 CAACCAAGTGGGCCCTCACCAGG - Intergenic
1192706097 X:73529576-73529598 CTGCCAAATGGGCCATGAACTGG - Intergenic
1192731562 X:73806687-73806709 TTGCCAAATGGGCCATGAACTGG + Intergenic
1192764641 X:74128611-74128633 CTGCTAAGTGGGCCATGAACTGG + Intergenic
1195841441 X:109180339-109180361 CTGCCAAATGAGCCATGAACTGG - Intergenic
1196221028 X:113112495-113112517 CTGCCAAATGAGCCATGAACTGG + Intergenic
1198965876 X:142228458-142228480 CTGCCAAACGGGCCATGAACTGG - Intergenic
1199205846 X:145147066-145147088 CCATCTAGTGGGCCATGTATAGG + Intergenic
1201724858 Y:17140470-17140492 TTGCCAAATGGGCCATGAACTGG + Intergenic
1201937089 Y:19420862-19420884 CCACTAAGCGGGCCATGAACTGG - Intergenic
1202062048 Y:20898483-20898505 CTGTTAAGTGGGCCATGAACAGG - Intergenic
1202076558 Y:21042893-21042915 CTGCTAAGTGGGCCATGAACTGG + Intergenic