ID: 957157345

View in Genome Browser
Species Human (GRCh38)
Location 3:76561948-76561970
Sequence AACTTCATATAGAAGTCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 117}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957157342_957157345 17 Left 957157342 3:76561908-76561930 CCTTCTTCAAAATTCAGGACAAC 0: 1
1: 0
2: 0
3: 16
4: 267
Right 957157345 3:76561948-76561970 AACTTCATATAGAAGTCTGCTGG 0: 1
1: 0
2: 0
3: 10
4: 117
957157340_957157345 22 Left 957157340 3:76561903-76561925 CCAGACCTTCTTCAAAATTCAGG 0: 1
1: 0
2: 0
3: 7
4: 183
Right 957157345 3:76561948-76561970 AACTTCATATAGAAGTCTGCTGG 0: 1
1: 0
2: 0
3: 10
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957157345 Original CRISPR AACTTCATATAGAAGTCTGC TGG Intronic
909443789 1:75725264-75725286 AAGTTCACATAAAATTCTGCAGG - Intronic
910912539 1:92253065-92253087 TAATTCATATAGAAGTCATCCGG + Intronic
915523986 1:156465103-156465125 AACTCCGTCTAGAAGCCTGCAGG + Exonic
919581820 1:199385945-199385967 AAGTTCATATAAATGTGTGCTGG + Intergenic
923578564 1:235185115-235185137 AACTTTATAAATAAGTCAGCAGG - Intronic
924785731 1:247197012-247197034 AACATCATATAGAAAGCTGAAGG + Intergenic
1063658225 10:8012675-8012697 AACTTCCTAAAGAAATCTGTGGG - Intronic
1066329110 10:34398160-34398182 AACTTGACTTAGAACTCTGCTGG - Intronic
1070619153 10:77993751-77993773 TAATTCATATTGAAGTCTGCAGG - Intronic
1077647941 11:3942801-3942823 TACCTCATAAAGAGGTCTGCTGG - Intronic
1082271084 11:50170066-50170088 AATTTAAAAAAGAAGTCTGCTGG + Intergenic
1082549664 11:54379523-54379545 AACATCACAAAGAAGTTTGCGGG - Intergenic
1086355848 11:85998405-85998427 AAAATCACATAGAAGTCGGCCGG - Intronic
1088668188 11:112115690-112115712 AACTCTAAAAAGAAGTCTGCAGG - Intronic
1090112239 11:123925406-123925428 AACTACATATCAAAATCTGCAGG - Intergenic
1091524148 12:1280238-1280260 AACTGCATATAAAAATCAGCGGG - Intronic
1092138643 12:6167456-6167478 AGCTGCACATAGGAGTCTGCTGG - Intergenic
1092489638 12:8933315-8933337 GACTGCATATAGAAGGCAGCAGG - Exonic
1093533353 12:20193939-20193961 AACTTCATATGTAAGTCTGTTGG + Intergenic
1093795982 12:23311488-23311510 AACTTCATTAAGAGGTCTGATGG - Intergenic
1094286127 12:28795846-28795868 AGTTTCATATAGAAGTCTGAAGG - Intergenic
1095809936 12:46362324-46362346 AACTTGATATAGAAGGCAGAAGG + Exonic
1096946297 12:55412857-55412879 GACTGCATATAGAAGGCAGCAGG + Intergenic
1098319843 12:69232225-69232247 ATGTCCAGATAGAAGTCTGCTGG + Intergenic
1099142089 12:78990809-78990831 AACTTCATACAGAAGTTGGATGG - Intronic
1103472516 12:121193165-121193187 GACATCATTTAGAAGTCAGCTGG + Intergenic
1105582693 13:21715038-21715060 AAATTCATATAGAAGTGTGGAGG + Intergenic
1105655136 13:22428512-22428534 AACTTCATATAAACGTCTTTGGG + Intergenic
1109927846 13:69169254-69169276 AACTTGAAATAGCAGTGTGCAGG - Intergenic
1111071618 13:83175179-83175201 AACTTCATATAGAAGTGATATGG - Intergenic
1112102180 13:96201097-96201119 ATCTGCATATAGCTGTCTGCGGG - Intronic
1112381122 13:98891219-98891241 AGCTTCACATAGAACTCTTCAGG + Intronic
1114266184 14:21074034-21074056 ACCTGCAGATAGAAGTCTCCTGG - Exonic
1117701489 14:58417959-58417981 AACTTCATAAAGAAGTTGTCAGG - Intronic
1118487943 14:66231876-66231898 AAATTCTAATAGAAATCTGCAGG + Intergenic
1120089934 14:80320001-80320023 AATTACATATAGAAGACTGAAGG + Intronic
1124909842 15:33908837-33908859 TGATTCATACAGAAGTCTGCAGG + Intronic
1126851481 15:52799511-52799533 CCCTTCATATAAAAGTCTGGAGG - Intergenic
1126979093 15:54220692-54220714 AACTACATTTACAAGTGTGCAGG - Intronic
1130666597 15:85874571-85874593 GGCTCCATATAGAAGTCTGAGGG - Intergenic
1130785412 15:87090510-87090532 AAGTTCATATAGTGATCTGCAGG - Intergenic
1145020149 17:19423806-19423828 AACCTCATTTAGAAATCTGCTGG - Intergenic
1146307245 17:31739943-31739965 AACCTCATCTTGAAGTCTACTGG + Intergenic
1150025409 17:61668998-61669020 GACTTCATTTTGAAGACTGCAGG + Intergenic
1155206756 18:23565142-23565164 AAATTCACATAGAAGTTTGAGGG - Intronic
1155592213 18:27440323-27440345 AACTTCACATAAAACTCAGCTGG + Intergenic
1157057161 18:44243995-44244017 AAAATCATGTTGAAGTCTGCAGG + Intergenic
1160887797 19:1359737-1359759 AACTAAATAAAGAACTCTGCTGG - Intronic
1164736997 19:30548941-30548963 AACTGCTTGTAGAAGTCTGATGG - Exonic
1165598321 19:37030633-37030655 ATTTTCATATACAAGTATGCAGG + Intronic
1166581315 19:43902617-43902639 AACTTAATATCGTAGTCTACTGG + Intergenic
926160498 2:10485292-10485314 AACTTCAAATAGAATTCTGATGG - Intergenic
927007790 2:18868141-18868163 AATTTCCTTTAGAAGTCTGATGG + Intergenic
927273047 2:21234361-21234383 AACTTCATTTCTAAGTCTTCTGG - Intergenic
931013481 2:57946935-57946957 ATCTTCATGAAGAAGTCTTCAGG + Intronic
933000817 2:76920436-76920458 AATTTCCTATAGAATTCTGAAGG + Intronic
934336157 2:92188833-92188855 AACATCACAAAGAAGTTTGCTGG - Intergenic
934339619 2:92243874-92243896 AACTTCACAAAGAAGTTTCCGGG - Intergenic
934361497 2:92590568-92590590 AACATCACAAAGAAGTTTGCTGG - Intergenic
934361542 2:92591250-92591272 AACTTCACAAAGAAGTTTACTGG - Intergenic
934365685 2:92657678-92657700 AACTTCACAAAGAAGTTTCCTGG - Intergenic
934411296 2:93391678-93391700 AACTTCACAAAGAAGTTTACTGG - Intergenic
934413068 2:93420201-93420223 AACATCACAAAGAAGTTTGCTGG - Intergenic
934425223 2:93615720-93615742 AACATCACAAAGAAGTTTGCTGG - Intergenic
934433273 2:93745556-93745578 AACATCACAAAGAAGTTTGCTGG - Intergenic
934449803 2:94012486-94012508 AACTTCACAAAGAAGTTTACTGG - Intergenic
938787355 2:134643687-134643709 AACTACAAATAGAAGACTTCTGG + Intronic
941515842 2:166476603-166476625 ATCATCATTTAGAAATCTGCTGG + Intronic
942861006 2:180612100-180612122 ATCTTCATATAGACCTCTGCAGG - Intergenic
944376010 2:199042880-199042902 AACTTCATTTACAAGTCACCAGG - Intergenic
945228368 2:207557161-207557183 ATCATCATAAAGAAGCCTGCTGG - Intronic
948418316 2:237834121-237834143 AACTGCATCCAGAAGTCAGCAGG + Exonic
1174785961 20:53433101-53433123 AGGTTCATGTAGAATTCTGCTGG - Intronic
1177740033 21:25143373-25143395 AACTTCATATAAATGTCAACAGG + Intergenic
1180237719 21:46474121-46474143 CACTTCACACAGAAGCCTGCTGG - Intronic
1180973526 22:19830658-19830680 AACTCCATAAAGAAGCTTGCTGG - Intronic
949731225 3:7115625-7115647 GACTTCCCATAGAAGTCTCCAGG - Intronic
952639181 3:35570968-35570990 AACTTAATATATAAGAATGCTGG + Intergenic
954985358 3:54785913-54785935 AAGATCACTTAGAAGTCTGCAGG - Intronic
956911634 3:73823775-73823797 ATCTGGAAATAGAAGTCTGCTGG + Intergenic
957141187 3:76360048-76360070 AACTTCATAGAGAACTACGCTGG - Intronic
957157345 3:76561948-76561970 AACTTCATATAGAAGTCTGCTGG + Intronic
958547277 3:95570403-95570425 AACTTCAGATAGAAGACTCAAGG - Intergenic
959934033 3:112011657-112011679 AAGTTCTGATAGAAGGCTGCAGG - Intronic
964103750 3:153018129-153018151 AATTTCAAATAAAAGTATGCAGG - Intergenic
964602824 3:158521264-158521286 AACTTCACATGGAGATCTGCTGG - Intronic
966575788 3:181501130-181501152 AACTTCACATATAACTCTGTTGG + Intergenic
967729132 3:192891096-192891118 AAGTTCTTATAGAAGTTTTCTGG + Intronic
974829552 4:67173419-67173441 AACTCCAAATACAAGACTGCTGG + Intergenic
975667954 4:76752771-76752793 AACATCATATAAAAGTCTATTGG + Intronic
977293476 4:95188160-95188182 AACTCCATATTGGAGACTGCTGG + Intronic
979708851 4:123753431-123753453 AACTTCCTTTAAAAATCTGCTGG - Intergenic
981909643 4:149964287-149964309 ATCTTCATATAGAACACTTCAGG - Intergenic
982272966 4:153610154-153610176 AACTTCATTTAGAGGACTGCTGG - Intronic
982744142 4:159088928-159088950 AAATAAATATAGAAGTCTGGAGG + Intergenic
984586813 4:181574229-181574251 ACCTTCATATAAATGTCTTCCGG + Intergenic
986385460 5:7229223-7229245 AACTTCATATATAACACTGTTGG - Intergenic
991463771 5:66887886-66887908 AACATCATCTGGAAGTATGCAGG - Intronic
1002356243 5:178631483-178631505 ACCTTCTTATAAAAGTCTCCTGG + Intergenic
1003024308 6:2540107-2540129 ATCATAATATATAAGTCTGCAGG - Intergenic
1003263242 6:4543500-4543522 AAATTCATATAGAAGTGTAAAGG + Intergenic
1004509429 6:16273176-16273198 AACTTCATATAAAAGGATGTGGG - Intronic
1008912480 6:56750103-56750125 AGCCTCAGAGAGAAGTCTGCGGG - Intronic
1010799672 6:80160593-80160615 AACTTCATATTAAAATCAGCAGG - Intronic
1015646585 6:135397823-135397845 AACTTCATAAACAATTCTTCAGG - Intronic
1017270768 6:152501871-152501893 AACATTATAAAGAATTCTGCAGG - Intronic
1018339454 6:162835726-162835748 AAGTTCATATAGATGACGGCAGG - Intronic
1025272438 7:57537232-57537254 ACCTTCATAGAGAAGTCTAAAGG - Intergenic
1026972077 7:74474560-74474582 AGCTTCAAAGTGAAGTCTGCTGG - Intronic
1027533989 7:79372750-79372772 AACTAAATATAGACTTCTGCTGG + Intronic
1027911311 7:84254872-84254894 AACTTCATATAAATGTCTTTTGG - Intronic
1030630778 7:111893631-111893653 AACTACATATACTAGACTGCGGG - Intronic
1033176989 7:139133925-139133947 GACTTCACACAGAAGTGTGCTGG - Intronic
1036562824 8:9911969-9911991 ATCTGCATATATAACTCTGCTGG + Intergenic
1038066587 8:23969711-23969733 GACTTCATATAGAAAACTGAAGG + Intergenic
1044274934 8:90288065-90288087 AAGTTCATCTAGGAGTCTGAAGG + Intergenic
1044773468 8:95662367-95662389 AACTTCAGATAGATGTATGAGGG + Intergenic
1046778704 8:118192091-118192113 AACTTCATAGAAAAATTTGCTGG - Intronic
1047048793 8:121085374-121085396 ACCTTCATATTGTAGTCTGCAGG + Intergenic
1052519190 9:29522629-29522651 AAGTTAATAGAGAAGTCTGACGG + Intergenic
1056206716 9:84326475-84326497 AACTTCAGAGAGTAGGCTGCAGG - Intronic
1059623637 9:116036573-116036595 AACTTCATAAAGGAGTCTGTGGG - Intergenic
1062644614 9:137541169-137541191 AACTTCATAAAGAATTTTCCTGG - Intronic
1186307689 X:8281494-8281516 AAAATCATATTGAAGTCAGCTGG - Intergenic
1189293406 X:39901801-39901823 AACTTCATGTTGGAGTCAGCTGG - Intergenic
1194549676 X:95281395-95281417 AACTTCATAAATAATTCTGTAGG - Intergenic
1199924213 X:152445576-152445598 AACTTTATACAGAATTCTGAAGG - Intronic
1201516744 Y:14826054-14826076 AACTTCAAAGAGAAGTCCACAGG + Intronic