ID: 957163558

View in Genome Browser
Species Human (GRCh38)
Location 3:76641490-76641512
Sequence TAGATCATGAAGGACAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 420
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 391}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957163555_957163558 -5 Left 957163555 3:76641472-76641494 CCTTTTTTCAAAAGTACATAGAT 0: 1
1: 0
2: 1
3: 37
4: 611
Right 957163558 3:76641490-76641512 TAGATCATGAAGGACAAGGAAGG 0: 1
1: 0
2: 1
3: 27
4: 391
957163554_957163558 -2 Left 957163554 3:76641469-76641491 CCACCTTTTTTCAAAAGTACATA 0: 1
1: 0
2: 3
3: 32
4: 433
Right 957163558 3:76641490-76641512 TAGATCATGAAGGACAAGGAAGG 0: 1
1: 0
2: 1
3: 27
4: 391
957163551_957163558 30 Left 957163551 3:76641437-76641459 CCAGATTAAGAGTTCATCCTTGG 0: 1
1: 0
2: 0
3: 10
4: 93
Right 957163558 3:76641490-76641512 TAGATCATGAAGGACAAGGAAGG 0: 1
1: 0
2: 1
3: 27
4: 391
957163553_957163558 13 Left 957163553 3:76641454-76641476 CCTTGGAATAACTGACCACCTTT 0: 1
1: 0
2: 1
3: 14
4: 122
Right 957163558 3:76641490-76641512 TAGATCATGAAGGACAAGGAAGG 0: 1
1: 0
2: 1
3: 27
4: 391

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957163558 Original CRISPR TAGATCATGAAGGACAAGGA AGG Intronic
901962088 1:12835321-12835343 TACTTCATGAAGGTCAAGGTTGG + Intergenic
901968704 1:12890098-12890120 TACTTCATGAAGGTCAAGGTTGG + Intronic
901976797 1:12951487-12951509 TACTTCATGAAGGTCAAGGTTGG + Intronic
901984068 1:13059978-13060000 TACTTCATGAAGGTCAAGGTTGG + Intergenic
901997743 1:13166792-13166814 TACTTCATGAAGGTCAAGGTTGG - Intergenic
902008373 1:13250283-13250305 TACTTCATGAAGGTCAAGGTTGG - Intergenic
902202262 1:14842518-14842540 TCGATGATGTAGGACAACGAGGG - Intronic
902444210 1:16451835-16451857 TAGAACATGAAGAAGAAGGAAGG + Exonic
902546766 1:17195144-17195166 CAGATCATGAGGGATCAGGATGG + Intergenic
902645747 1:17796724-17796746 TAGATCAAGAAGCACACGGCTGG - Intronic
904440734 1:30527874-30527896 TGGAAGATGAAGGACAGGGAGGG - Intergenic
905033275 1:34901809-34901831 TCGATTATGAAGGACATGGAAGG + Intronic
905858603 1:41331165-41331187 TAGAGGAAGAGGGACAAGGAAGG + Intergenic
905952914 1:41966934-41966956 AAGATCAAAAAAGACAAGGAAGG + Intronic
906317633 1:44798581-44798603 GTGGTCATGAAGGACAAGGTTGG + Intergenic
910563832 1:88621078-88621100 TAGATCAAAAAAGACAAAGAAGG + Intergenic
911243010 1:95485463-95485485 AAGATCAAGAAAGACAAAGAAGG + Intergenic
911284386 1:95972698-95972720 AAGATCACGAAAGACAAAGAAGG - Intergenic
916612579 1:166407692-166407714 AAGATCAAAAAGGACAAAGAAGG - Intergenic
917482966 1:175428242-175428264 AAGACCATTAAGGACAAAGAGGG - Intronic
918162684 1:181915891-181915913 AAGATCATGACGGATTAGGATGG - Intergenic
918527656 1:185482539-185482561 AAGGTCATGAAAGAGAAGGAAGG - Intergenic
918652580 1:186983906-186983928 TATATCATGTAGGATCAGGATGG + Intronic
921277260 1:213532504-213532526 GAGATAAAGAAGGACAAGAAAGG + Intergenic
922368700 1:224888952-224888974 TAGATGTTGAAGGAGCAGGAGGG - Intergenic
923236942 1:232043139-232043161 TAGTTCCTGAGGGACAATGAAGG - Intergenic
923300763 1:232638531-232638553 TAAAGCATGAGGGAGAAGGAGGG - Intergenic
923877822 1:238069100-238069122 AAGGTCATGAAAGACAAGGAAGG - Intergenic
924377182 1:243423920-243423942 GAGATCATGAATGTAAAGGATGG + Intronic
1064738346 10:18406843-18406865 TAGCTCTTGAAGTACAAAGAGGG + Intronic
1065162664 10:22939109-22939131 TTGATTGTGAAAGACAAGGAAGG + Intronic
1065473508 10:26108943-26108965 AAGATCTTGATGGACAAAGATGG - Intronic
1065481222 10:26195719-26195741 TTGATCATGAAAGACAAGAAGGG - Intronic
1065527032 10:26633225-26633247 TAGAGGATGAAGGAAAAGCAAGG + Intergenic
1065839104 10:29685792-29685814 CAGATCATGATGGAAAGGGAGGG - Intronic
1066673066 10:37859914-37859936 AAGGTCATGAAAGACAAGGTAGG - Intergenic
1069379961 10:67833047-67833069 CAGGTCATGAAAGACAAAGAAGG + Intronic
1071340165 10:84638900-84638922 AAGATCAAAAAGGACAAAGAAGG + Intergenic
1074492099 10:113947463-113947485 TAGATCAGGGATGACAAGGCAGG - Intergenic
1075933460 10:126319544-126319566 TAGGTCATCAAGGACAAGGAAGG + Intronic
1075987491 10:126800256-126800278 CAGGTCATCAAGGACAAGGGAGG - Intergenic
1077347259 11:2068375-2068397 TAGATCATGAAGTTTAAGGGAGG - Intergenic
1077560413 11:3256908-3256930 GAGATTAGGAAGGAAAAGGAAGG + Intergenic
1077566310 11:3302725-3302747 GAGATTAGGAAGGAAAAGGAAGG + Intergenic
1077661205 11:4070139-4070161 AAGATGATGAAGGACTTGGAGGG + Exonic
1078309447 11:10225125-10225147 TAGATTATCAGGGACAACGAAGG - Intronic
1078633875 11:13030833-13030855 CAGATCATAAAGGATAAGTAGGG - Intergenic
1081925050 11:46819387-46819409 CAGATCATGCAGGACTATGAAGG + Intronic
1083288311 11:61675176-61675198 TATAGCAGGAGGGACAAGGAAGG + Intergenic
1084870901 11:72097993-72098015 TAGATGGTGATGGAGAAGGAGGG + Intronic
1087606742 11:100386137-100386159 AAGATCAAGAAAGACAAAGAAGG + Intergenic
1087624806 11:100584367-100584389 TAGTTGGTGAAGGACAGGGAAGG - Intergenic
1087734919 11:101821026-101821048 TATTTCATGAAGGATAATGAAGG + Intronic
1088294221 11:108275124-108275146 AAGATCAAGAAAGACAAAGAAGG - Intronic
1088494366 11:110418694-110418716 TTGAACATGCAGGAGAAGGAGGG - Intergenic
1089223020 11:116891058-116891080 TGGCTCATGGAGGTCAAGGAGGG + Intronic
1089529190 11:119115634-119115656 TAAATCATGAAGGGAAAGGTAGG - Intronic
1089710852 11:120313441-120313463 GATGTCATGAAGGAAAAGGAGGG + Intronic
1089836194 11:121372762-121372784 TGGAACATGCAGGAGAAGGAGGG + Intergenic
1090436290 11:126689381-126689403 TAGATCATGAGATGCAAGGATGG - Intronic
1090821640 11:130347806-130347828 TTGGTCATGAGGGACAGGGATGG - Intergenic
1090991858 11:131824876-131824898 TAGATGCTGGAGGACAAGGAAGG + Intronic
1092680606 12:10975807-10975829 AAGATCAAAAAAGACAAGGAAGG + Intronic
1093451413 12:19319994-19320016 AAGATAATGAAGGAAAAGGATGG - Intronic
1094055506 12:26265432-26265454 TAGATCATGAAGGACCTTGCAGG + Intronic
1094484341 12:30912351-30912373 TAGATCATGAGGGTCAGGGTAGG - Intergenic
1095824097 12:46513838-46513860 AAGATCAAAAAAGACAAGGAAGG - Intergenic
1096261564 12:50095632-50095654 TAAATCTTGAAGGACAAAGTGGG + Intronic
1097079898 12:56422275-56422297 AAGAACAGGAAGGACAAGGCAGG + Intronic
1097583214 12:61483447-61483469 AAGATCAGAAAAGACAAGGAAGG + Intergenic
1097908620 12:64946127-64946149 TGGATAATGAAGGGAAAGGAAGG - Intergenic
1098485349 12:71014968-71014990 TACAGCATGCAGTACAAGGAGGG + Intergenic
1099496992 12:83360804-83360826 TAGAAGATGAAGGAGAAGCAAGG - Intergenic
1100211450 12:92402583-92402605 AAGAACATGAAGAAGAAGGAGGG - Intergenic
1100220491 12:92499793-92499815 TAGACCTTGTAAGACAAGGAAGG + Intergenic
1101643128 12:106602771-106602793 TAGAGAATGAGAGACAAGGAGGG - Intronic
1103149392 12:118623791-118623813 AAGATCTTGAAGGAATAGGATGG + Intergenic
1104057624 12:125242708-125242730 GAGATCTTGAAGGACAAAGGAGG - Intronic
1104539866 12:129653994-129654016 TAGATCCTCAAAAACAAGGAAGG - Intronic
1105334468 13:19453323-19453345 GAGAGAATGAAGGACAGGGATGG - Intronic
1105636372 13:22219692-22219714 TAGATGATGAACGTCAGGGAAGG + Intergenic
1105789304 13:23781838-23781860 AAGATCAAAAAAGACAAGGAAGG + Intronic
1106122097 13:26868836-26868858 TAGGTCAAGAAGGAAGAGGATGG - Intergenic
1106446374 13:29835923-29835945 TAGATCATGCAGGACCCTGAAGG + Intronic
1107037956 13:35920613-35920635 GAGACCATGGAGGACAAGAAGGG + Intronic
1107331157 13:39302319-39302341 GAGACCATGAAGGACACAGAAGG + Intergenic
1107447612 13:40482524-40482546 TATCTCATGAAGGACAACAAAGG + Intergenic
1108188298 13:47910344-47910366 AAGATCAAAAAGGACAAAGAAGG + Intergenic
1109325901 13:60867797-60867819 AAGATCAAAAAAGACAAGGAAGG - Intergenic
1109891454 13:68619338-68619360 AAGATCAAAAAGGACAAAGAAGG + Intergenic
1109943239 13:69398451-69398473 AAGATCAAAAAGGACAAAGAAGG + Intergenic
1110027354 13:70557665-70557687 GAGATGATGAAGGACAATGAAGG - Intergenic
1110664168 13:78096397-78096419 TAGAACAAAAAGGAGAAGGAAGG + Intergenic
1111352017 13:87043647-87043669 AAGATCATAAAAGACAAAGAAGG + Intergenic
1111469545 13:88660564-88660586 AAGATCAAAAAGGACAAAGAAGG - Intergenic
1112117670 13:96374768-96374790 TTGATCATGAGGCACAAGGGAGG - Intronic
1113094219 13:106646629-106646651 GAGATCATGAAAGATAAAGATGG + Intergenic
1114195735 14:20474681-20474703 TACATCGTGAAAGAAAAGGAAGG - Intronic
1114530096 14:23390052-23390074 CAGATCATCAAGGCCAAGGCAGG - Exonic
1114535526 14:23419840-23419862 CAGATCATCAAGGCCAAGGCAGG - Exonic
1115195639 14:30796055-30796077 TAGAACATGAAAGAGAAAGAAGG - Intergenic
1115207157 14:30920869-30920891 CAGATCATGAAGCACATGAAAGG - Intronic
1115968039 14:38913954-38913976 AAGACCATAAAGGACAAGGAAGG + Intergenic
1116504583 14:45663234-45663256 AAGATCAAAAAAGACAAGGAAGG - Intergenic
1116786327 14:49293035-49293057 TAGAACATGAAGGTCATGAAAGG + Intergenic
1117094343 14:52282300-52282322 TAGAACATGCAGGAGAAGGAGGG - Intergenic
1117188230 14:53264145-53264167 TAGATCAAAAAAGACAAAGAAGG - Intergenic
1117547094 14:56802393-56802415 TAGTTCCTTAAGGACAAGAATGG + Intronic
1117639139 14:57778361-57778383 AAGATCAAAAAAGACAAGGAAGG + Intronic
1117845076 14:59902804-59902826 AAGATCAAAAAGGACAAAGAAGG + Intergenic
1117965125 14:61199218-61199240 TAGTTCATCAAGGAAAAGAAAGG - Intronic
1118843298 14:69528255-69528277 GAGGTCATGAAGGACTGGGACGG - Exonic
1119941606 14:78647287-78647309 TAGAACATGAAGGGCAGGGGCGG - Intronic
1121160816 14:91738113-91738135 AAGATCATGAAGGAGAAGAATGG + Intronic
1122297768 14:100714792-100714814 GGTAGCATGAAGGACAAGGACGG - Intergenic
1125300425 15:38249065-38249087 TAGATGATGAAGGACTAAAAAGG + Intergenic
1126964800 15:54039848-54039870 GAGATGATGAAGGCAAAGGATGG - Intronic
1128355175 15:66921351-66921373 TATCTCATGAAGGCCATGGAAGG + Intergenic
1128968333 15:72084248-72084270 AAGATGAAGAAGGACAAAGAAGG - Intronic
1129306496 15:74668172-74668194 TAGGTCATCAAAAACAAGGAAGG + Intronic
1130333830 15:82942077-82942099 TAAATCTTGAAGGATAAAGAGGG - Intronic
1130569716 15:85030766-85030788 TAAATCTTGAAGGAAAAGTAGGG - Intronic
1130810336 15:87370219-87370241 ATCATCAGGAAGGACAAGGAAGG + Intergenic
1130882681 15:88068765-88068787 CAGAGCAAGAAGGGCAAGGAGGG + Intronic
1132635128 16:940409-940431 CATATCATGGAGGACAAGGCAGG + Intronic
1133313441 16:4866818-4866840 GAGCTCATGAAAGACAAGAATGG - Intronic
1134269904 16:12724122-12724144 CAGGTCAGGAATGACAAGGAAGG + Intronic
1134827977 16:17299743-17299765 TATATAATGAAGGCCCAGGAAGG + Intronic
1134868930 16:17634070-17634092 CAGATCTTAAAGGACCAGGATGG + Intergenic
1135610447 16:23861762-23861784 TTGACCATGAGGGACAAGGTTGG + Intronic
1137336194 16:47551971-47551993 AAGATCAAGAAAGACAAAGAAGG - Intronic
1138362175 16:56440510-56440532 AAGATCATCAAACACAAGGAAGG - Intronic
1138586965 16:57976752-57976774 TAGATCATGGAGGAGCAGGGAGG - Intronic
1139404719 16:66709022-66709044 AAGGTCATAAAAGACAAGGAGGG - Intergenic
1139790700 16:69432090-69432112 TAGTGAATGAAGGACAAGAATGG + Intronic
1140235367 16:73153899-73153921 TTAATAATTAAGGACAAGGATGG + Intergenic
1140722831 16:77786950-77786972 TAGACCTTGAAGGATAAGGCAGG - Intergenic
1141118368 16:81331274-81331296 AAGGTCATGAAAGACAAGGAAGG + Intronic
1141294134 16:82751037-82751059 AAGATCAGGAAGGAGGAGGATGG - Intronic
1141491300 16:84375643-84375665 TACATCATGAGGGGCAAAGATGG - Intronic
1142354678 16:89596867-89596889 GAGATCATGAGGGACTTGGAGGG + Exonic
1142508139 17:378776-378798 AAGAACATGAATGACAAGGTGGG - Intronic
1143540823 17:7567769-7567791 TAGATCATGTAAGACATGTACGG + Intronic
1143546347 17:7598554-7598576 TAGATCATGTAAGACATGTACGG - Intronic
1143804005 17:9410364-9410386 TAGATAATGAATGTTAAGGAAGG - Intronic
1143963324 17:10738506-10738528 GAGATAATGAAGGCCAATGAGGG + Intergenic
1144165629 17:12607560-12607582 TAGGTCATGAAGTTCAAAGAAGG - Intergenic
1144294889 17:13864714-13864736 TAGCACATGAAGGAAATGGACGG + Intergenic
1145211642 17:21017627-21017649 TAGACCATGGAGGAAGAGGAAGG + Intronic
1146507893 17:33421357-33421379 CAGATCATCAAGGATATGGATGG - Intronic
1146529557 17:33596687-33596709 AAGAGGATGAAGGAAAAGGAAGG - Intronic
1149229474 17:54516917-54516939 AAGATCAAGAAAGACAAAGAAGG - Intergenic
1149395567 17:56238538-56238560 AAGATCACAAAGGACAAAGAAGG - Intronic
1149938141 17:60830420-60830442 TAGATCATGAAGGGGAAAAATGG + Intronic
1152160590 17:78666163-78666185 GACATCAAAAAGGACAAGGATGG + Intergenic
1155675879 18:28428009-28428031 AAGATCAAGAAGGACAATGAAGG - Intergenic
1156001402 18:32388717-32388739 TATATCACGAAAGACAAAGACGG + Intronic
1156539059 18:37892100-37892122 GAGATAATGGAGGCCAAGGATGG - Intergenic
1156720257 18:40061431-40061453 TCGTTCATCAAGGACAAGTATGG - Intergenic
1156892911 18:42210468-42210490 TAGTCCATGAAAGAAAAGGAAGG - Intergenic
1157133759 18:45034107-45034129 GAGGTCATGAAGGAAAAGTAGGG - Intronic
1159909672 18:74133849-74133871 TAGAGCAAGAACTACAAGGAAGG + Intronic
1160598557 18:79994840-79994862 TGGAACCTGAAGGAAAAGGACGG - Intronic
1162273999 19:9638756-9638778 TAGATGTTGAAGGAGCAGGAGGG + Intronic
1162286866 19:9745321-9745343 TAGATGTTGAAGGAGCAGGAGGG - Intergenic
1163914332 19:20226946-20226968 AAGATCATAAAAGACAAAGAAGG - Intergenic
1164058911 19:21648119-21648141 AAGATCAAAAAAGACAAGGAAGG - Intergenic
1164067799 19:21735707-21735729 AAGATCAAAAAAGACAAGGAAGG + Intronic
1164868482 19:31624713-31624735 AAGTTCTTGAAGGACAGGGAAGG - Intergenic
1165991491 19:39817613-39817635 AAGGTCATGAAAAACAAGGAAGG + Intergenic
1166588715 19:43975378-43975400 TAGATCATCCAGGACATGGATGG + Intronic
1167857407 19:52253817-52253839 TTGATCAAGAAGAACAAGGCTGG + Intergenic
925280771 2:2683063-2683085 TAGAACGGGACGGACAAGGAGGG + Intergenic
925489755 2:4377942-4377964 TAGAACAAGAAGGCCATGGATGG - Intergenic
926956843 2:18311099-18311121 GAGACAATGAAGGAGAAGGACGG + Intronic
930478313 2:51913676-51913698 AAGATCAAGAAAGACAAAGAAGG + Intergenic
930705497 2:54501227-54501249 TAGCTCATGTGGGATAAGGAAGG - Intronic
930743502 2:54857696-54857718 TAGAACCTGAAGGAGAATGAAGG + Intronic
931201704 2:60103933-60103955 TAGATGAAGAAGGCCAGGGAGGG - Intergenic
931996299 2:67842345-67842367 TACATCTTGAAGGACAGGAAGGG - Intergenic
932201923 2:69836182-69836204 TACATTATGGAGGACTAGGATGG - Intronic
932512052 2:72302584-72302606 AAGATCAAGAAAGACAAAGAAGG - Intronic
933080617 2:77980035-77980057 AAGATCATAAAAGACAAAGAAGG + Intergenic
933453351 2:82487867-82487889 GAGATCATGAAGGACAGTGAGGG + Intergenic
934843879 2:97649211-97649233 CAGGTCATGAACAACAAGGATGG - Intergenic
936382651 2:112000445-112000467 AAGATCATCAAAGACAAGGAAGG - Intronic
937795416 2:126012555-126012577 TAGACAATGAAAGACAGGGAGGG + Intergenic
938626988 2:133121222-133121244 TAAAATATGAAGGAAAAGGAAGG + Intronic
938917879 2:135962073-135962095 TAAAATATGAAGGACTAGGAAGG - Intronic
939136711 2:138304716-138304738 AAAATCATAAAGGACAATGAGGG - Intergenic
939769323 2:146295837-146295859 TACAACATGAAGGACAAATAGGG - Intergenic
940437056 2:153668000-153668022 AAGATCAAAAAGGACAAAGAAGG + Intergenic
940681319 2:156788894-156788916 TAGATGATGAAAGAAAAGAATGG - Intergenic
941608709 2:167633568-167633590 AAGATCAAGAAAGACAAAGAAGG + Intergenic
942783103 2:179669684-179669706 GTGATCATGAAACACAAGGATGG + Intronic
943981437 2:194556690-194556712 TAGATCATGAATATCAGGGAAGG - Intergenic
944488297 2:200230430-200230452 AAGACCATGAAGGAGAAGGAGGG + Intergenic
945671624 2:212809321-212809343 TAGATCATGAAGCTCAGGAATGG - Intergenic
946284623 2:218693706-218693728 TAGAACCTGAGGGAGAAGGAAGG - Exonic
946548861 2:220777994-220778016 TAGATCATTCTGGACAACGAAGG + Intergenic
947017450 2:225637168-225637190 GAGATGATGAAGGAAAAGGCAGG - Intronic
947295234 2:228623656-228623678 AAGATCATGAGGGAACAGGAAGG + Intergenic
947691400 2:232139934-232139956 TAGGGCATGAGGGAGAAGGATGG + Intronic
1170690730 20:18613003-18613025 TTGATCATGACGGAGAAGGCAGG - Intronic
1170894814 20:20403529-20403551 TAGATCACCACGGAGAAGGAAGG - Intronic
1172230416 20:33332398-33332420 TTGGGCATCAAGGACAAGGATGG + Intergenic
1173412553 20:42826942-42826964 AAGATCAAAAAAGACAAGGAAGG + Intronic
1173749401 20:45465037-45465059 AAGATCATGAAGGACCCTGAAGG - Intergenic
1174139337 20:48401810-48401832 TAGAGCATGGGGGACAGGGAAGG + Intergenic
1174602522 20:51736223-51736245 GAGAAGATAAAGGACAAGGAGGG + Intronic
1174973792 20:55307613-55307635 AAGATCAAAAAGGACAAAGAAGG + Intergenic
1175061252 20:56245482-56245504 TGGATCTTGAAGAATAAGGAGGG + Intergenic
1175243286 20:57565481-57565503 TGGTTCCGGAAGGACAAGGAAGG + Exonic
1177673258 21:24261894-24261916 AAGATCAGGAAAGACAAAGAAGG - Intergenic
1180754006 22:18147687-18147709 TAGATAAAGAAGTACAAGGCGGG - Intergenic
1180901482 22:19376519-19376541 CAGATCATGGAGGAGAAGAATGG - Intronic
1181583549 22:23841064-23841086 TGGAACCTGGAGGACAAGGAGGG + Intergenic
1182408001 22:30154648-30154670 AAGGTCATGAAAGTCAAGGAAGG - Intronic
1182938705 22:34253195-34253217 AAGATCATAAAAGACAAAGAAGG - Intergenic
1182950365 22:34369402-34369424 AAGATCAAAAAAGACAAGGAAGG - Intergenic
1184955408 22:47882912-47882934 TAGGTCATGAAAAACAAGGAAGG - Intergenic
949792598 3:7809567-7809589 CACACCATGATGGACAAGGATGG - Intergenic
949994681 3:9607218-9607240 TAGCTGATGAAGGCCAAGCATGG - Intergenic
950551002 3:13665832-13665854 GAGGTCATGAAGGACGGGGACGG + Intergenic
951644669 3:24875899-24875921 AAGACCTTGAAGGACAAGGGAGG - Intergenic
951724341 3:25740102-25740124 TTGATCCTGAAGTACAAGGGAGG + Intronic
951822668 3:26829658-26829680 AAGATCAAAAAGGACAAAGAAGG + Intergenic
952211210 3:31231138-31231160 CAGAGCAGGGAGGACAAGGAGGG + Intergenic
953839130 3:46374691-46374713 TAGATCATGAAGAACCTTGACGG + Exonic
954642279 3:52107997-52108019 AAGGTCATGAAAGACAAGGGAGG - Intronic
954920834 3:54189490-54189512 TAGATCTCAAAGGACATGGAAGG - Intronic
955116419 3:56009436-56009458 TAGATGAAGAAGGAAAAGAATGG - Intronic
956516590 3:70055782-70055804 CAGATCCTGAAAGAAAAGGAAGG - Intergenic
957122317 3:76111114-76111136 GAGATCATGCTGGAGAAGGAGGG + Intronic
957163558 3:76641490-76641512 TAGATCATGAAGGACAAGGAAGG + Intronic
957703187 3:83745178-83745200 TAGATGCTGAATGACAAGGAAGG - Intergenic
958656241 3:97007361-97007383 GAGATCAAAAAAGACAAGGAAGG - Intronic
960276997 3:115740179-115740201 AAGATCAAAAAAGACAAGGAAGG - Intergenic
960458170 3:117899524-117899546 TAGATCACTAGGGACCAGGAAGG + Intergenic
960758547 3:121047610-121047632 AAGATCAAAAAAGACAAGGAAGG - Intronic
962254570 3:133861596-133861618 CAGGGCATGAAGGACAGGGAGGG - Intronic
963044048 3:141089479-141089501 TAGAGCCTGGAGGAGAAGGAGGG + Intronic
963629060 3:147710915-147710937 AAGATCATAAAAGACAAAGAAGG - Intergenic
964314941 3:155433860-155433882 TAGATCTTGAAGCAGAAAGAGGG - Intronic
964535050 3:157711758-157711780 TAGTTCATGAGGGTTAAGGAAGG + Intergenic
966573573 3:181475129-181475151 TAGATCAAAAAAGACAAAGAAGG - Intergenic
969658369 4:8510775-8510797 TAGCACATGGAGGCCAAGGAGGG + Intergenic
969923500 4:10562776-10562798 ATGATAATGCAGGACAAGGAAGG - Intronic
972689867 4:41386311-41386333 TAGATCCTGACTGACAAGGCTGG + Intronic
972825969 4:42759501-42759523 AAGATCTTGAAAGACAAGGAAGG - Intergenic
972866570 4:43240392-43240414 TGGACCAGGAAGGAGAAGGAAGG + Intergenic
973203529 4:47532696-47532718 TAGAGCATGAAGATCAAAGAAGG - Intronic
974291489 4:59937459-59937481 GAGATGATGAAAGACAAGGCAGG - Intergenic
975188480 4:71431484-71431506 AAGACCATGGAGGACATGGAGGG + Intronic
976823059 4:89228741-89228763 TTGACCATGTAGGACAAGGTTGG + Intergenic
977539174 4:98294994-98295016 TAGATACTGAAGGACATGAAGGG + Intronic
978206411 4:106085351-106085373 AAGATCATAAAAGACAAAGAAGG + Intronic
979518093 4:121634863-121634885 AAGGTCATCAAAGACAAGGAAGG - Intergenic
979530080 4:121760811-121760833 CAGATCCTGAAGGACATGGGTGG - Intronic
979687430 4:123526225-123526247 TAGAACAAGAGGGAAAAGGAAGG - Intergenic
980985034 4:139686855-139686877 CAGATCATGAAAGACAAAGTGGG - Intronic
982059493 4:151590260-151590282 TAGGTCATTGAGGAAAAGGATGG - Intronic
982563653 4:156962480-156962502 TAGACCATGAAGTAAAAGGAAGG + Intronic
983044262 4:162967624-162967646 AAGATCAAAAAGGACAAAGAAGG - Intergenic
983718938 4:170821613-170821635 GAGATCATGGTGGACAAGGAAGG + Intergenic
983746244 4:171203842-171203864 TGGCTCCTGAAGGACAACGAAGG - Intergenic
984049161 4:174842279-174842301 GAGACCTTGAAGGACAATGAAGG + Intronic
984112909 4:175642571-175642593 GAGAGCATGAAGGAAAAGGTGGG - Intronic
984289229 4:177771989-177772011 TAGATGACTAAGGAAAAGGAGGG + Intronic
984697019 4:182789310-182789332 TAGATTATGACGGACAGGGGAGG + Exonic
985037585 4:185856826-185856848 TAGAAGATGAAGGAGAAGCAAGG + Intronic
985193762 4:187406177-187406199 AAGATCAAAAAAGACAAGGAAGG - Intergenic
985956216 5:3268139-3268161 CAGATCATGAAGGCAGAGGAAGG - Intergenic
987190656 5:15474088-15474110 TATACCTTGAAAGACAAGGAGGG - Intergenic
988555553 5:32232900-32232922 CAGATCAGGCAGGATAAGGATGG + Intronic
989194411 5:38702013-38702035 CAGATCAAAAAAGACAAGGAAGG + Intergenic
989681972 5:44040845-44040867 AAGATCAAGAAGGACAAATAAGG - Intergenic
989715806 5:44461418-44461440 AAGATCATGAGGGAGAATGATGG - Intergenic
990500536 5:56391996-56392018 AAGATCAAAAAAGACAAGGAAGG + Intergenic
992217406 5:74539571-74539593 TAGATCTTGAATGACCAGTAAGG - Intergenic
992516923 5:77503259-77503281 AAGATCAAGAGAGACAAGGAAGG + Intronic
993133884 5:83932757-83932779 AAGATCAAAAAAGACAAGGAAGG + Intergenic
994030082 5:95131499-95131521 GAGATCATAAATGAAAAGGATGG + Intronic
994917817 5:106002806-106002828 AAGATCATAAAAGACAATGAAGG - Intergenic
995110790 5:108426608-108426630 AAGATCAAGAAAGACAAAGAAGG - Intergenic
995394825 5:111676203-111676225 TAGATAATTCAGGAGAAGGAGGG + Intronic
996719859 5:126619246-126619268 TAAATCATGAAGGAAAATGTGGG - Intronic
997217607 5:132127169-132127191 AAGATCATAAAAGACAAAGAGGG - Intergenic
997983612 5:138486726-138486748 TATATAATAAAGAACAAGGAAGG - Intergenic
998379984 5:141717486-141717508 TAGCTCCTGAAGGAGGAGGAGGG + Intergenic
998755382 5:145372604-145372626 AAGATCAAGAAAGACAAAGAAGG - Intergenic
999063038 5:148655443-148655465 TAGACCATGAGGAAGAAGGAAGG - Intronic
999780071 5:154842090-154842112 TGGATCATTAAGCACAAGGGAGG + Intronic
1000819966 5:165971415-165971437 AAGATCAAAAAGGACAAAGAAGG - Intergenic
1000897069 5:166868244-166868266 GAGATCATGAAGGACACAGCAGG - Intergenic
1001374063 5:171237825-171237847 TGGAGCAGGGAGGACAAGGAGGG + Intronic
1003457136 6:6293401-6293423 CAAATCATGAAAGGCAAGGAGGG - Intronic
1003527741 6:6911934-6911956 TAGATGATGCAGGAAAAGGAGGG - Intergenic
1005080056 6:21947774-21947796 TTGATCAGGAAGGAGAAGGGAGG + Intergenic
1005120780 6:22387726-22387748 AAGATCAAAAAGGACAAAGAGGG - Intergenic
1005296160 6:24429352-24429374 TAAATCATAAAGGAGAAGTAGGG + Intronic
1005378526 6:25209612-25209634 AAGATCAAAAAGGACAATGAAGG + Intergenic
1009502623 6:64434938-64434960 CAAATCATGAAGGACATAGATGG - Intronic
1009677294 6:66842088-66842110 AAGATCAAGAAAGACAAAGAAGG + Intergenic
1010034747 6:71311850-71311872 CAGATAATGAAGGTGAAGGATGG + Intergenic
1010482983 6:76377247-76377269 AAGATCAAAAAGGACAAAGAAGG - Intergenic
1010750369 6:79610817-79610839 TGCAACAGGAAGGACAAGGATGG - Intergenic
1010778337 6:79912261-79912283 TGCATCATGAATGACAAAGAAGG + Intergenic
1011716681 6:90112988-90113010 AAGATCAAAAAAGACAAGGAAGG + Intronic
1012249202 6:96961021-96961043 AAAAAAATGAAGGACAAGGAAGG + Intronic
1012610479 6:101212976-101212998 AAAATTATGAAGGACAAGGTGGG - Intergenic
1014352255 6:120359877-120359899 TAGATCAAGCAGAAGAAGGATGG + Intergenic
1014705425 6:124740547-124740569 TAGATCTGGAAGGGCAGGGATGG + Intronic
1014709503 6:124789965-124789987 TAGATCCTGGAGGAGAGGGAAGG - Intronic
1014790488 6:125666623-125666645 AAGATAAAGAAGGACAAGAAAGG - Intergenic
1014960577 6:127679278-127679300 AAGATCAAAAAAGACAAGGAAGG - Intergenic
1015494150 6:133863181-133863203 AAGATAAAAAAGGACAAGGAAGG - Intergenic
1015524243 6:134160298-134160320 TAAGTCATGAAGCACAAAGAAGG + Intergenic
1015687047 6:135876359-135876381 TAGAACATGAAAGACAAGTGTGG - Intronic
1016241697 6:141938882-141938904 TAGATCATGCAGGCAAAGGCTGG - Intergenic
1018778668 6:167043184-167043206 TGGTTCATGAAGGACATGGGAGG + Exonic
1018859628 6:167701847-167701869 TAGATCACAAAGAACAATGATGG + Intergenic
1020519341 7:9167118-9167140 AAGATCAAAAAGGACAAAGAAGG - Intergenic
1020607619 7:10358321-10358343 AAGATCAAAAAGGACAAAGAAGG - Intergenic
1020788465 7:12596035-12596057 TAGAACAGGAAGGAAAAGAAAGG + Intronic
1021218507 7:17946660-17946682 TAAAAAATGAAGGACAAAGATGG - Intergenic
1021415106 7:20374977-20374999 AAGACAATGAAGGGCAAGGATGG + Intronic
1022536979 7:31104453-31104475 GAGATGATGGTGGACAAGGATGG + Intronic
1022793892 7:33716667-33716689 ATGATGATGAAGGAGAAGGAGGG - Intergenic
1022975734 7:35554427-35554449 GAGCTCTTCAAGGACAAGGATGG + Intergenic
1023393398 7:39731568-39731590 CAGATCATGAAGGACTTGAATGG + Intergenic
1026518455 7:71093782-71093804 TGGATCATAAATGACCAGGAGGG + Intergenic
1027233319 7:76284064-76284086 TGGATCACCAAGGACTAGGAGGG - Intronic
1027554446 7:79646219-79646241 ATGATCATGAAGGGCAAGAAAGG - Intergenic
1029304457 7:99608433-99608455 AAGAACAGGAAGGCCAAGGATGG - Intergenic
1029897514 7:104000084-104000106 TAGTTCAGGGAGGAGAAGGATGG - Intergenic
1030414339 7:109221989-109222011 TAGAGCATGAACTACAATGAAGG - Intergenic
1030438429 7:109554295-109554317 TAGATCAAAAAAGACAAAGAAGG + Intergenic
1030703801 7:112669762-112669784 TAGAACAAAAAGGCCAAGGAAGG + Intergenic
1030828439 7:114190347-114190369 TAGAACAGAAAGGCCAAGGAAGG + Intronic
1030838431 7:114317707-114317729 TAGATCCTGAAGCAAAGGGAGGG - Intronic
1031523899 7:122800595-122800617 TAGATCATGAAGTAAAAAAAAGG + Intronic
1032373700 7:131387000-131387022 TAGTACAGGATGGACAAGGATGG + Intronic
1032888035 7:136163279-136163301 TATGACATGAAAGACAAGGATGG + Intergenic
1033291879 7:140092072-140092094 TAGATCCTGAAGGAGGAGGAAGG + Exonic
1033490124 7:141835167-141835189 TGGGACATGTAGGACAAGGATGG - Intergenic
1033617899 7:143034404-143034426 AAGATCAAGAAAGACAAAGAAGG + Intergenic
1034857215 7:154563111-154563133 TAGCTATTGAAGGACATGGAAGG + Intronic
1036097739 8:5742023-5742045 GAGATCATGAAAGACATGCAGGG - Intergenic
1036204476 8:6794896-6794918 TAGGAGATGGAGGACAAGGAAGG - Intergenic
1036704180 8:11034457-11034479 TACCACATGAAGCACAAGGATGG + Intronic
1038155684 8:24987758-24987780 TGGATCTTGAAGGACAGGAACGG - Intergenic
1038233341 8:25727011-25727033 AAGATCAAAAAAGACAAGGAAGG - Intergenic
1038783012 8:30584606-30584628 TAACTCATGTGGGACAAGGAAGG - Intronic
1038907522 8:31922662-31922684 TAGTTAATGAAGGACCAGGTAGG + Intronic
1039492208 8:37956305-37956327 GAGATCATGCTGGACTAGGATGG + Intergenic
1039741442 8:40386660-40386682 CAGAGAATAAAGGACAAGGAGGG - Intergenic
1039758996 8:40553703-40553725 TAGATAATGAATGATATGGATGG + Intronic
1041709942 8:60885243-60885265 TTAATCATCAAGAACAAGGATGG + Intergenic
1041886813 8:62818810-62818832 TAGATCCTAAAGGGTAAGGAGGG + Intronic
1042812660 8:72843694-72843716 AAGATCAAGAAAGACAAAGAAGG - Intronic
1042953418 8:74224061-74224083 TTAATCATGAAGGGCGAGGAGGG - Intergenic
1045034177 8:98164742-98164764 TAAATCCTGCAGAACAAGGAAGG - Intergenic
1045653234 8:104362269-104362291 GAGATCAGGAAGGGCAAGGAAGG - Intronic
1045676353 8:104612459-104612481 AAGATCATAAAGGACAAAAAAGG - Intronic
1045713940 8:105019580-105019602 TAGATCTGGAAAGACAAGCAAGG + Intronic
1046186722 8:110731451-110731473 TAAATCCTTAAGGACAAAGAGGG + Intergenic
1046785070 8:118257178-118257200 CAGAGCAAGAATGACAAGGAGGG - Intronic
1047600220 8:126418698-126418720 AAGGTCATGAAGAGCAAGGAAGG + Intergenic
1047637577 8:126781336-126781358 ATGAATATGAAGGACAAGGAGGG + Intergenic
1048015436 8:130492370-130492392 AAAATAATGAAGGAAAAGGATGG - Intergenic
1049595065 8:143479553-143479575 TGGATAATGAAGGCCAGGGAGGG + Intronic
1050091949 9:2024337-2024359 AAGATCCTGCAGGACACGGAGGG - Intronic
1050451087 9:5781851-5781873 AAGATCAAGAGGGACAAAGAAGG + Intronic
1050497195 9:6256002-6256024 CATATTATGAAGGACAAAGAAGG - Exonic
1050839065 9:10123536-10123558 TGGTTCATGAAGGACAGGGCTGG - Intronic
1051461763 9:17326838-17326860 AAGGTCATGAAAGACAAGGAAGG + Intronic
1051832982 9:21301398-21301420 AAGATCAAAAAAGACAAGGAAGG + Intergenic
1051921954 9:22276887-22276909 TAGATCATGAATAATTAGGAGGG + Intergenic
1052460708 9:28759327-28759349 TTGAAAATGAAGGACAAAGAGGG + Intergenic
1052990261 9:34514831-34514853 TAGGTCAGGAAGGAGAAGGCGGG + Intronic
1053166151 9:35845644-35845666 TAGCTCATTAAGGAGAAGGAGGG - Intronic
1054902702 9:70386804-70386826 CAGATGCTGAAGGAGAAGGAGGG - Exonic
1055564662 9:77556367-77556389 GAGATCATGAGGGAAAAAGAGGG + Intronic
1056818211 9:89817094-89817116 CATTTCATGATGGACAAGGAAGG - Intergenic
1057320920 9:94011757-94011779 TCAATCATGAAGGATGAGGAAGG + Intergenic
1058452821 9:105113040-105113062 AAGAAGATGAAGGAGAAGGAGGG + Intergenic
1059588750 9:115634431-115634453 AAGATCATGAAAGACAAAAAAGG - Intergenic
1059745977 9:117202097-117202119 AAGATCAAAAAAGACAAGGAAGG - Intronic
1186540257 X:10393079-10393101 AAGATCCGGTAGGACAAGGATGG - Intergenic
1188228213 X:27628225-27628247 TAGATCATGTAGGAAATGAAAGG - Intronic
1188300901 X:28504922-28504944 TAAATGCTGAAGGACCAGGAGGG + Intergenic
1188455028 X:30354453-30354475 AAGATCATAAAAGACAAAGAAGG - Intergenic
1188623529 X:32256243-32256265 AAGATCAAGAAAGACAAAGAAGG - Intronic
1189238173 X:39504989-39505011 TACATCATGGAGGAAAAGGGAGG + Intergenic
1189328778 X:40130148-40130170 TAGATGAAGAGGGACAGGGAAGG - Intronic
1189454803 X:41176260-41176282 CAGACCATGAAGGAGGAGGAGGG - Intronic
1189994842 X:46628521-46628543 TAGCTCATGTGGGAAAAGGAAGG - Intronic
1190124098 X:47687874-47687896 AAGGTCATGAAAGGCAAGGAAGG - Intergenic
1190915664 X:54809461-54809483 TAGGTGGAGAAGGACAAGGATGG - Intronic
1191692796 X:63958352-63958374 TGGAACCTGAAGGACAAGAAAGG + Intergenic
1192620357 X:72672971-72672993 AAGGTCATGAAAGACAAGTAAGG + Intronic
1192702955 X:73495794-73495816 AAGATCAAGAAAGACAAAGAAGG - Intergenic
1193251925 X:79301106-79301128 TAAATGAAGAAGGACAATGAGGG + Intergenic
1194287039 X:92022413-92022435 AAGATCAAGAAAGACAAAGAAGG + Intronic
1195223822 X:102771720-102771742 TAGATACTGAAGGACCAAGAGGG - Intergenic
1195373572 X:104203373-104203395 TTGAACATGAAGGTAAAGGAGGG - Intergenic
1196727785 X:118912786-118912808 TAGACCATAAAGCACAAGGAAGG - Intergenic
1198081298 X:133242239-133242261 TGGATCTTGAAGGATAAGCAAGG + Intergenic
1198428559 X:136543402-136543424 CAGATCATGCAGGCCAAGGTTGG + Intronic
1198883538 X:141307596-141307618 TAGATCAGAAAGGAAAAGTATGG - Intergenic
1199303446 X:146239580-146239602 TAAAACATGAAGGACAATGGTGG - Intergenic
1200604580 Y:5246974-5246996 AAGATCAAGAAAGACAAAGAAGG + Intronic
1201280534 Y:12338559-12338581 AAGATCATCATGGAGAAGGATGG - Intergenic
1201782174 Y:17735684-17735706 TAGATCATAAAAGACAAAGTAGG - Intergenic
1201819379 Y:18170304-18170326 TAGATCATAAAAGACAAAGTAGG + Intergenic
1202341976 Y:23879398-23879420 TAGATCAAAAAAGACAAAGAAGG - Intergenic
1202346394 Y:23932538-23932560 TTAATTAAGAAGGACAAGGATGG - Intergenic
1202524377 Y:25737552-25737574 TTAATTAAGAAGGACAAGGATGG + Intergenic
1202528793 Y:25790687-25790709 TAGATCAAAAAAGACAAAGAAGG + Intergenic