ID: 957166246

View in Genome Browser
Species Human (GRCh38)
Location 3:76677280-76677302
Sequence GAGAAGAAAAAGGATGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3057
Summary {0: 1, 1: 4, 2: 37, 3: 380, 4: 2635}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957166246 Original CRISPR GAGAAGAAAAAGGATGAGGA GGG Intronic
Too many off-targets to display for this crispr