ID: 957169360

View in Genome Browser
Species Human (GRCh38)
Location 3:76718046-76718068
Sequence CATAACCTGCCCAAACTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 135}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957169360 Original CRISPR CATAACCTGCCCAAACTGGA TGG Intronic
902176007 1:14651487-14651509 AATAACCTCCCCAACCTGGTAGG - Intronic
903140684 1:21337369-21337391 CAAAACCAGGCCAAACTAGAGGG + Intronic
903362365 1:22784637-22784659 CAAGACCTTCCCCAACTGGATGG + Exonic
903808812 1:26023161-26023183 CATAGCCTGTCCCAGCTGGAAGG - Exonic
904333903 1:29784863-29784885 CATAGCCTTCCCAGACTGGATGG + Intergenic
905501172 1:38438599-38438621 CAAAAACTGACCAAACTGAAAGG - Intergenic
905663125 1:39743816-39743838 CATCATCTGACCAAACTGAAAGG - Exonic
905848597 1:41256562-41256584 TTTAACCTGGCCAAACTGGCTGG - Intergenic
906488580 1:46249772-46249794 AATAACCTGCCTAAACTGAGCGG - Intronic
913364256 1:118018188-118018210 CAGAACCTGCACAATCTGGATGG + Intronic
914935284 1:151973779-151973801 CGTAACTTAGCCAAACTGGAAGG - Intergenic
920789601 1:209077106-209077128 GATAACATGCACAGACTGGATGG - Intergenic
1063561194 10:7129934-7129956 CATAATCTACCCAAATTAGAAGG - Intergenic
1068860107 10:61839372-61839394 AAAAAAATGCCCAAACTGGAAGG + Intergenic
1069480150 10:68774276-68774298 CATCACCTTCCCAAAATGCAGGG + Intronic
1071476303 10:86028308-86028330 CATAACCTTCCCAGAATGAAAGG - Intronic
1072472636 10:95727093-95727115 CATAACCTGACTAAACTGCTTGG - Intronic
1074323168 10:112422258-112422280 CATAAACTGCCCACGCTGGGAGG + Intronic
1075285970 10:121186301-121186323 CATGACCTGTCCAAGCTGGAAGG + Intergenic
1075392433 10:122102098-122102120 CATAAACTGCCCAAACCGACGGG - Intronic
1077798294 11:5513997-5514019 CATAACATGCTCAAACAGAAAGG - Intronic
1077895862 11:6452775-6452797 CCTGAGCTGCTCAAACTGGAGGG - Intronic
1078294944 11:10058153-10058175 CTTAACTAGGCCAAACTGGATGG + Intronic
1078341152 11:10498749-10498771 CACAACTGGCCCAAACTGGAGGG - Intronic
1080182154 11:29438352-29438374 CATAATAAGCTCAAACTGGAAGG + Intergenic
1083434188 11:62631381-62631403 CTTAACCACCCCAAACTGGTGGG - Intronic
1084682336 11:70673673-70673695 GATCACCTGCCCAACCTGGATGG + Intronic
1086064110 11:82729056-82729078 CATTATGTGCCCAGACTGGAAGG + Intergenic
1086745895 11:90426375-90426397 CATAAGCTCACCAAACTCGATGG + Intergenic
1087083726 11:94196527-94196549 CATGACCTGCCCAAACCACACGG + Intergenic
1088531704 11:110817748-110817770 CATCACATGCCCAAACTCTATGG - Intergenic
1090638340 11:128707745-128707767 CATACCCTGTCCAAACTGATAGG - Intronic
1091951343 12:4595746-4595768 CATAAAATGTCCAAACTGAAAGG + Intronic
1092846029 12:12586089-12586111 CATTCCCTTCCCAGACTGGAAGG - Intergenic
1093445914 12:19258596-19258618 TGTCACCTGCCCAGACTGGAGGG + Intronic
1094202611 12:27808946-27808968 CATGACCTGCCCAGACCAGAAGG - Intergenic
1099285079 12:80707385-80707407 TCTAAACTGCCCAAAATGGAAGG + Intergenic
1104616626 12:130275783-130275805 CATAACCTGCCCAAGAAGGATGG - Intergenic
1106226246 13:27789439-27789461 CAAAAACTGCTCAAATTGGAGGG - Intergenic
1106717033 13:32401225-32401247 CATAACCAGCTCAATATGGATGG - Exonic
1107531059 13:41282751-41282773 TATCACCTGCCAAATCTGGAAGG + Intergenic
1112369977 13:98785666-98785688 CATCACCTGCCCCACCTGGGTGG - Intergenic
1117459765 14:55933771-55933793 CATATCCTGCCCACACTCAAAGG - Intergenic
1120856132 14:89214151-89214173 CGAAACCTGCCCAGACTGGTTGG - Intronic
1121135030 14:91489272-91489294 AACAACCTGCCCAAATTAGATGG + Intronic
1122525089 14:102376197-102376219 CATATCCTGTCCAACCTGGTGGG + Intronic
1124882736 15:33657252-33657274 CATAAACTGCCCAAACTCCAGGG - Intronic
1126752832 15:51894790-51894812 AATAAACATCCCAAACTGGAAGG - Intronic
1129952626 15:79605549-79605571 AATTACCTTCCCAAACTGGTAGG + Intergenic
1130852847 15:87814599-87814621 CATAATAACCCCAAACTGGAAGG + Intergenic
1132209406 15:100008817-100008839 CAAAAACGGCACAAACTGGAGGG - Intronic
1132402397 15:101520787-101520809 AATAACCTCCCAAAACAGGAAGG - Intronic
1132687416 16:1168165-1168187 CATCAACCGCCCCAACTGGAGGG - Intronic
1132808813 16:1788030-1788052 CTTCACCTGCCCACACTGCACGG + Exonic
1136275313 16:29176290-29176312 CATCATCTGCCCAGCCTGGATGG - Intergenic
1142079674 16:88142358-88142380 CATCATCTGCCCAGCCTGGATGG - Intergenic
1142605921 17:1081003-1081025 CACAGCCTGCCCACCCTGGAGGG - Intronic
1144765051 17:17728009-17728031 CAACACATGCCCAAGCTGGAAGG - Intronic
1145749273 17:27343526-27343548 CATAATCAGCCCAAACTGCATGG + Intergenic
1146643991 17:34564265-34564287 CAAAACCTGCCAAAAATGGGAGG + Intergenic
1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG + Exonic
1157540469 18:48499986-48500008 CAAAAACTGACCAAACTGAAGGG + Intergenic
1158862172 18:61603351-61603373 CATAACCTGCTCCACCAGGAAGG - Intergenic
1160155021 18:76426954-76426976 CATAACCTGTCCATACGGAAAGG - Intronic
1163013690 19:14440954-14440976 CCTGACCTCCCCAAACTGGGAGG - Intronic
1165115486 19:33525791-33525813 TATCACCTGCCCAACCTGGTCGG - Intergenic
1166227514 19:41405844-41405866 CACAACCTGCCCGCTCTGGATGG - Intronic
926011145 2:9408986-9409008 CATATCCTGCCCAGATGGGAAGG + Intronic
926323162 2:11763006-11763028 CAAATACTGCCCAAACAGGAAGG - Intronic
927312198 2:21643848-21643870 CATAACCTACCCAAAGTGGCAGG - Intergenic
928921149 2:36529309-36529331 CAGAAACTGGCCAATCTGGAAGG + Intronic
939727547 2:145741585-145741607 CATAACCTGTAAAAACTGGATGG - Intergenic
943098657 2:183459688-183459710 CATAACCTTCCCACAAGGGATGG - Intergenic
943768429 2:191688595-191688617 TAGAACCTGCCCAAACAAGAAGG - Intronic
944335757 2:198531970-198531992 TATAAACTCCCCAAACTGGGTGG - Intronic
1169346566 20:4833668-4833690 AATAACCAGCCCAAATTGAATGG + Intergenic
1170082334 20:12490889-12490911 CATAACCTCACCCAACTGAAAGG + Intergenic
1175397065 20:58672762-58672784 AATAACCTGCCAAAATTAGAAGG - Intronic
1175855681 20:62119731-62119753 GGTATCCTGCCCAAAGTGGAGGG - Intergenic
1180985301 22:19900814-19900836 CATATCCTGCCCTAAATGCAAGG + Intronic
1181053129 22:20247018-20247040 CATGTCCTGCCCAAGCAGGAAGG + Intronic
1182035006 22:27191232-27191254 CATAAAATGCCTGAACTGGAAGG - Intergenic
1183515680 22:38264490-38264512 CATACCCTGCACAAGCTGCAGGG + Intronic
1185245316 22:49770099-49770121 AATAACCTCCCCAAACCAGAGGG + Intergenic
949338821 3:3006438-3006460 CATAAATTGCCCCAACTAGAAGG + Intronic
950691363 3:14660662-14660684 TATAACTTGCCCAAACTTGCAGG - Intronic
950779546 3:15379535-15379557 CAAAAGCTGCCCAAACTTGAGGG - Intergenic
953482987 3:43268267-43268289 AATAACCTGCCCCAGCTGAAAGG - Intergenic
957169360 3:76718046-76718068 CATAACCTGCCCAAACTGGATGG + Intronic
958855486 3:99379250-99379272 CACAACATGCCCAAACTGATGGG + Intergenic
960342467 3:116490650-116490672 CATAAAAAGCCCAAACTAGACGG + Intronic
961802742 3:129465256-129465278 CATATTCTGCCCAAACTTGGAGG - Intronic
963053143 3:141159335-141159357 CTTAACCAGGCCAAACTGGCTGG + Intergenic
965745502 3:171920726-171920748 CATAGCCTACCCAAATTAGAAGG + Intronic
967502940 3:190221621-190221643 CTTAACCAGGCCAAACTGGCTGG - Intergenic
967508274 3:190279177-190279199 CCTAACATGCCCAGACTGGAAGG + Intergenic
970229860 4:13898542-13898564 CATAAACTGGACAAACTGGATGG - Intergenic
971995408 4:33957686-33957708 CTTAACCAGACCAAACTGGCTGG - Intergenic
973662859 4:53125881-53125903 CATACTCTTCCCAACCTGGATGG - Intronic
973854323 4:54995614-54995636 TTTAACCTGCCCAAAGTAGAAGG + Intergenic
975062031 4:70015293-70015315 CATAACCTACCCAAATGAGAAGG - Intergenic
977461707 4:97333854-97333876 CAGATCCTGCCCAAACTCAAAGG - Intronic
977863786 4:101999221-101999243 CAAAATATGCCCAAACTGGAGGG - Intronic
979044983 4:115851754-115851776 CCTAACCTGACCTAACTGGGTGG + Intergenic
980711599 4:136575989-136576011 CATGACATGCCAAAACTGGATGG - Intergenic
981658255 4:147136915-147136937 CACAACCTCTCCAGACTGGAGGG + Intergenic
982161571 4:152575529-152575551 CATCCCCTGCCCAGACTTGAAGG - Intergenic
983994513 4:174165331-174165353 TAGAAGCTGTCCAAACTGGAAGG + Intergenic
984597844 4:181691527-181691549 TGTAACTTGCCTAAACTGGAGGG + Intergenic
984683897 4:182644224-182644246 CAGATCCTGCCAAAAATGGATGG - Intronic
984842335 4:184080047-184080069 AATAACCTGCCCCATGTGGAAGG - Intergenic
987119805 5:14756400-14756422 CAGATCCTGCCCAAACTTGAAGG - Intronic
987577821 5:19753059-19753081 CATAACCTACCCAAATGAGAAGG + Intronic
988412112 5:30899669-30899691 CATAGTCTGCTCAAAATGGATGG + Intergenic
990486226 5:56261534-56261556 GATGGCCTGCCCTAACTGGAGGG + Intergenic
991491068 5:67183041-67183063 GAAAACCTGCACAAACTTGAAGG - Exonic
992690551 5:79236779-79236801 CATAACCTGCCACAACCGGACGG + Exonic
996288258 5:121821188-121821210 TATCAGGTGCCCAAACTGGAAGG + Intergenic
996865999 5:128123072-128123094 CATAAACTGGCAAAACTGAAAGG - Intronic
998591746 5:143486192-143486214 CATGACCTGCCAGAACTGAAAGG + Intergenic
999841942 5:155437617-155437639 CATTACATGCCCAAAGTGCAAGG + Intergenic
999942749 5:156562398-156562420 CATATCCTGGCCAAAGTGAAAGG + Intronic
1004791486 6:19031714-19031736 CATAACCTGACAGAACTGAAAGG + Intergenic
1008352339 6:50506693-50506715 CACAATCTGCCCATAATGGAAGG - Intergenic
1008823817 6:55666808-55666830 CATCATCTGCCAAAACTGCATGG + Intergenic
1010578852 6:77568438-77568460 AATAAACAGCCCAAACTGAAAGG - Intergenic
1012968098 6:105697359-105697381 CATTACTTACCCAATCTGGAGGG + Intergenic
1014813274 6:125908322-125908344 CATAACATGCCCACAGTGGCAGG + Intronic
1014828328 6:126072177-126072199 CAAATCCTACTCAAACTGGAAGG - Intergenic
1015865614 6:137723579-137723601 AATAACTTGCCCAAGCTGGTAGG - Intergenic
1016421533 6:143889666-143889688 CAAAAACTGACAAAACTGGAAGG + Intronic
1017196161 6:151703001-151703023 TATAACCTGCCCAAATTGCAAGG + Intronic
1018529036 6:164743502-164743524 CATAACATGCCCAATGTGAAAGG + Intergenic
1021607871 7:22427337-22427359 GACAACCTGGCCTAACTGGAAGG + Intronic
1022726760 7:32988259-32988281 CATAACCTGATGAAACTGGAGGG + Intronic
1022814329 7:33899935-33899957 CATACACTGCACAAACTGGGGGG + Intergenic
1022883432 7:34615898-34615920 CATAACATGCCAAAAATGCATGG + Intergenic
1025046826 7:55699374-55699396 CATAACCTGACGAAACTGGAGGG - Intergenic
1025618737 7:63148266-63148288 CATAACCTACCAACACTGAATGG + Intergenic
1028213268 7:88101282-88101304 CATGAGCTTCCCAAACTGCATGG + Intronic
1028221136 7:88198224-88198246 CATATCATGCCCAAACTGAAGGG + Intronic
1031627001 7:124003657-124003679 CTTAACCAGGCCAAACTGGCTGG - Intergenic
1035654333 8:1294130-1294152 CATCACCTCCCGAAACTGTATGG + Intergenic
1036514991 8:9435542-9435564 CATAATCTGCTCATACTGAAGGG + Intergenic
1047953251 8:129953240-129953262 CCTGACCTTCCCAAGCTGGAAGG - Intronic
1050987819 9:12104859-12104881 CATAGCCTACCCAAATGGGAAGG + Intergenic
1052339009 9:27347082-27347104 CACAACATGCCAGAACTGGAGGG + Intronic
1052566030 9:30153311-30153333 CAAAACCTGCCGAAACAGGAAGG + Intergenic
1052575289 9:30283030-30283052 CAATACCTGCCCAAACAGGTGGG + Intergenic
1053476579 9:38386240-38386262 CATAACCAGCCATAACAGGATGG + Intergenic
1057283508 9:93729268-93729290 CAGATCCTGGCCAAACAGGATGG + Intergenic
1061767241 9:132889142-132889164 CAGAAGTTGCCCAAACAGGATGG + Intronic
1186790896 X:12997569-12997591 CAAAGCCAGCCCAAACTGGTAGG - Intergenic
1186822291 X:13303009-13303031 CAGAAACTTTCCAAACTGGAAGG - Intergenic
1188871321 X:35376718-35376740 CATATACTGCCCAAAGTGGCAGG - Intergenic
1192381185 X:70618317-70618339 CATCACCTTCCAAACCTGGAAGG - Intronic
1193643793 X:84043452-84043474 CAGAACCTACCCAAATGGGAAGG - Intergenic
1197742779 X:129908139-129908161 TATAACCTGCCCTAACTGACGGG - Intronic
1198940971 X:141954677-141954699 CATGACTTACACAAACTGGAGGG + Intergenic