ID: 957169787

View in Genome Browser
Species Human (GRCh38)
Location 3:76723567-76723589
Sequence TTGTATGAGAATGAAGTGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 294}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957169787 Original CRISPR TTGTATGAGAATGAAGTGGG CGG (reversed) Intronic
900004259 1:34355-34377 TTCTATGAGAAAGAAGGGGAGGG + Intergenic
900023986 1:204871-204893 TTCTATGAGAAAGAAGGGGAGGG + Intergenic
900707413 1:4089318-4089340 TTGTAGGAGAAAGCAGAGGGTGG - Intergenic
901004420 1:6165067-6165089 TTGTCAGAGAAAGAAGCGGGAGG + Intronic
902352805 1:15870618-15870640 TTGTGTGAGAATGAAGTGTGTGG + Intronic
904113705 1:28146514-28146536 TTGTGGGAGGCTGAAGTGGGAGG - Intergenic
906048314 1:42850273-42850295 GTGTTTGAGAATGTAGTGGAGGG + Intronic
906340432 1:44974969-44974991 CTTTAGGAGACTGAAGTGGGAGG + Intronic
906406702 1:45548072-45548094 GTTTAGGAGACTGAAGTGGGAGG - Intergenic
906932521 1:50183661-50183683 TGGCAAGAGAAAGAAGTGGGAGG - Intronic
908422911 1:63977053-63977075 AAGAATGAGAGTGAAGTGGGGGG + Intronic
912648252 1:111415376-111415398 TAGGATGAGAATGAAGTGGTAGG - Intronic
912865204 1:113250365-113250387 ATGTATGCAACTGAAGTGGGTGG + Intergenic
914736418 1:150421731-150421753 TTTTAGGAGGCTGAAGTGGGAGG + Intronic
915174501 1:154003729-154003751 TTTTAGGAGGCTGAAGTGGGAGG - Intronic
917128596 1:171715763-171715785 TTCTGGGAGACTGAAGTGGGAGG + Intronic
918036480 1:180878134-180878156 ATGAAAGAGAAAGAAGTGGGTGG - Intronic
918344953 1:183599136-183599158 CTTTAGGAGACTGAAGTGGGAGG + Intergenic
918572156 1:186009601-186009623 TGCTATGAGAATGAAGCAGGTGG + Intronic
919046914 1:192463971-192463993 TTGTATTACAAAGAAGTGGCCGG + Intergenic
919814909 1:201431198-201431220 TTGGAGGAGAATGGAGCGGGAGG - Intergenic
920620215 1:207538389-207538411 AGGCAGGAGAATGAAGTGGGAGG + Intronic
920621997 1:207556946-207556968 AGGCAGGAGAATGAAGTGGGAGG + Intronic
921765336 1:218965792-218965814 ATGAATGAGAATGAAGTTTGGGG - Intergenic
921900142 1:220441339-220441361 TTGTTTGAGGATGAGGAGGGTGG + Intergenic
922181434 1:223236792-223236814 TTGAAGGAGAACAAAGTGGGAGG - Intronic
922354561 1:224763624-224763646 TTGTATGAGAACGAAGTCAGGGG - Intergenic
922587246 1:226743650-226743672 TTGAAAAAGAATGCAGTGGGAGG + Intergenic
922771790 1:228189182-228189204 TTGAAAGAAAAGGAAGTGGGAGG - Intergenic
923766533 1:236897191-236897213 GTGAATGAGAATAAAGTGAGGGG + Intronic
1063714127 10:8510457-8510479 TTGAATGAGAGTGAAGAGGATGG - Intergenic
1063728700 10:8670180-8670202 TAGTTTGTGAATGGAGTGGGGGG - Intergenic
1064468571 10:15611821-15611843 TTGTATAAGACTGAAGTGTGTGG - Intronic
1066058044 10:31699618-31699640 TGGTATGAGGGTGAAATGGGAGG + Intergenic
1066302520 10:34109367-34109389 TTGGATGAGGATGGAGAGGGGGG - Intergenic
1067990155 10:51202763-51202785 TTGTCTGGGAAAGAAGTGGAAGG + Intronic
1069668009 10:70177262-70177284 TTTTAGGAGACTGAAGTGAGAGG + Intergenic
1070271493 10:74960755-74960777 TTTTATGGGAATGAAATGTGAGG + Intronic
1071790876 10:88952820-88952842 TTGTTTGGGAAGCAAGTGGGAGG - Intronic
1074401306 10:113143083-113143105 ATGTATGCCATTGAAGTGGGAGG - Intronic
1074605569 10:114961179-114961201 TTGGAGGAGAATGAATTTGGAGG + Intronic
1076660183 10:132050673-132050695 TTGTATGGGAATGATCAGGGTGG - Intergenic
1078901748 11:15649055-15649077 TTGAAAGAGAATGAAGGAGGAGG - Intergenic
1079435161 11:20439831-20439853 TCTTATGAGAATAAGGTGGGAGG + Intronic
1081673794 11:44956722-44956744 TTGTATCAGAATCACGTGGGGGG - Intergenic
1081847110 11:46248662-46248684 TTGACTGAGAATGGAGGGGGTGG - Intergenic
1083046436 11:59740210-59740232 TTTTGGGAGACTGAAGTGGGCGG - Intronic
1086095661 11:83047876-83047898 CAGTATGACAATGAAGTGTGTGG - Intronic
1086387726 11:86326684-86326706 TTGGATGGGATGGAAGTGGGTGG + Intronic
1086846083 11:91751360-91751382 TTTTGAGAGAAGGAAGTGGGAGG - Intergenic
1089342245 11:117765990-117766012 ATGGATGAGAATGAAGGGGCAGG - Intronic
1089832512 11:121341072-121341094 TTGTATGTGTGTGCAGTGGGTGG - Intergenic
1089975020 11:122724781-122724803 CTGCATGAAAAGGAAGTGGGAGG + Intronic
1090055660 11:123422148-123422170 TTGTAGGAGAGGGATGTGGGGGG + Intergenic
1091377682 12:36403-36425 TTCTATGAGAAAGAAGGGGAGGG + Intergenic
1091576984 12:1746784-1746806 TTTTACGAGACTGAAGTGGGAGG + Intronic
1094744141 12:33324297-33324319 GTGCATGAGAATTAAGAGGGAGG - Intergenic
1097132632 12:56823937-56823959 TTGGATGAGAGTGAACTGGGAGG + Intergenic
1097345646 12:58489039-58489061 TTGTATGAAAACAAAGTGAGAGG - Intergenic
1097750919 12:63351613-63351635 TTGTCCTAGAATGAAGGGGGTGG + Intergenic
1097870379 12:64597008-64597030 TTGTAGGAGGCCGAAGTGGGTGG - Intergenic
1098451480 12:70622935-70622957 TTCTATGAGAATTTAGGGGGGGG + Intronic
1098501839 12:71202090-71202112 CTTTATGAGAAGGAAGTGGATGG + Intronic
1098849942 12:75584056-75584078 ATGTGGGAGACTGAAGTGGGAGG + Intergenic
1099397050 12:82153349-82153371 ATGTATGAGAATGAAGTTATAGG + Intergenic
1100822593 12:98445337-98445359 TTTTATGAGGATGAGGTGGGTGG - Intergenic
1101757695 12:107633980-107634002 TTTTATGAGTATTAAGTGAGGGG + Intronic
1102282879 12:111632373-111632395 TTTTGGGAGAATGAGGTGGGTGG + Intergenic
1102602105 12:114039309-114039331 CTGTAGGAGAAACAAGTGGGTGG - Intergenic
1103646801 12:122400199-122400221 ATGAATGTGAATGAAGTGGAAGG - Intronic
1104863454 12:131938198-131938220 CTTTATGAGACTGAGGTGGGAGG + Intronic
1106302362 13:28480517-28480539 TTCTATTAGAATAAAGTTGGAGG + Intronic
1107339554 13:39391312-39391334 TTGTATGGTAATGAAAAGGGTGG + Intronic
1110604686 13:77418427-77418449 TTGTAGGGGATTGAGGTGGGAGG - Intergenic
1110672009 13:78191520-78191542 TTGTATGCTAATGAGGTGGCTGG - Intergenic
1111173402 13:84560420-84560442 CTTTAGGAGACTGAAGTGGGAGG + Intergenic
1112331550 13:98480830-98480852 TTTTGGGAGACTGAAGTGGGAGG - Intronic
1112453795 13:99538788-99538810 CTGTAGGAGGCTGAAGTGGGAGG + Intronic
1115223368 14:31079376-31079398 TTGGGTGAGAATGATGTAGGTGG + Intronic
1115962933 14:38856035-38856057 TTGTATGATAAAGGTGTGGGAGG - Intergenic
1117445022 14:55795775-55795797 TTTTATGAGAGAGAGGTGGGGGG + Intergenic
1117525482 14:56598170-56598192 TTGTCTGAGAATGAAATCTGGGG + Intronic
1118384328 14:65243247-65243269 GTGTGTGAGAGTGAGGTGGGTGG + Intergenic
1120311442 14:82832955-82832977 TTGAATTACAATGAAGTTGGAGG + Intergenic
1123436129 15:20255878-20255900 TAGTATGAGAACGAGGTGCGGGG - Intergenic
1124099797 15:26682735-26682757 TTGTTAGACAATGAGGTGGGAGG + Intronic
1127113333 15:55698293-55698315 CTGTCTAAGAATGGAGTGGGTGG - Intronic
1127288217 15:57548781-57548803 AGGTGTGAGAATGAGGTGGGAGG + Exonic
1127868483 15:63050313-63050335 TTGAATGAAGAGGAAGTGGGCGG + Intronic
1128066337 15:64767025-64767047 CTTTAGGAGACTGAAGTGGGTGG - Intronic
1128090689 15:64916883-64916905 TGGTCTGAGAATGAGGTGGTGGG + Intronic
1130453870 15:84084549-84084571 TTGTAGGTGAACGAATTGGGTGG + Intergenic
1131145869 15:90011507-90011529 TTGTATGACAATGGAATGTGGGG - Intronic
1132136240 15:99342331-99342353 TTGTATCAGAATGATGTGTTGGG + Intronic
1132306906 15:100822160-100822182 TTGTATTATAAAGGAGTGGGGGG - Intergenic
1132449245 15:101956589-101956611 TTCTATGAGAAAGAAGGGGAGGG - Intergenic
1133518156 16:6530146-6530168 TTATCTTAGAATGAAGAGGGAGG + Intronic
1133562400 16:6962246-6962268 TTGTAAGAGAAAGGAGAGGGAGG - Intronic
1133762149 16:8807736-8807758 TTTTGGGAGAGTGAAGTGGGAGG - Intronic
1134185235 16:12079817-12079839 TGGAATGAGAATGAAATGGCTGG - Intronic
1135232170 16:20719017-20719039 TTGTCTGAGAGTAGAGTGGGAGG - Intronic
1135787174 16:25360615-25360637 TTGGATGATAATGAAGTTAGAGG - Intergenic
1136670330 16:31850685-31850707 TTGAACGGGAATGAAGCGGGAGG + Intergenic
1138252255 16:55509934-55509956 GTTTATGAGAGTGTAGTGGGAGG + Intronic
1138317798 16:56085340-56085362 TAGTACGAAAAAGAAGTGGGAGG + Intergenic
1139920000 16:70453860-70453882 TTGTTTAAGAATAAAATGGGAGG + Intergenic
1141252569 16:82371558-82371580 TGGTGTGAGAAGGAGGTGGGTGG - Intergenic
1141882335 16:86868265-86868287 TTGTGTGAGGGTGAGGTGGGCGG + Intergenic
1146904400 17:36608785-36608807 GTGTATGAGAATGTGGGGGGTGG + Exonic
1148541177 17:48481890-48481912 TTGAATGAGAGTGGAGTGGGAGG + Intergenic
1149895219 17:60423707-60423729 TTTTAGGAGGCTGAAGTGGGTGG - Intronic
1149912600 17:60580137-60580159 TTTTAGGAGACTGAGGTGGGCGG + Intronic
1150973015 17:70051846-70051868 TTGTAGCAAAATTAAGTGGGAGG + Intergenic
1151253246 17:72854295-72854317 TTGACTGGGGATGAAGTGGGGGG + Intronic
1151747727 17:76020673-76020695 TTTTATGGGGATGAGGTGGGGGG - Intronic
1203162833 17_GL000205v2_random:67302-67324 TTTTAGGAGATTGAGGTGGGAGG + Intergenic
1154472801 18:14721390-14721412 TTTTAGGAGGCTGAAGTGGGAGG + Intergenic
1154984140 18:21532292-21532314 TTTTATGAGAATGTAATGTGAGG - Intronic
1155009387 18:21760235-21760257 TTAGATGAAAATGAATTGGGTGG + Intronic
1155236828 18:23828431-23828453 TAGTATTAGAATGAAGTAGAGGG - Intronic
1155828236 18:30477201-30477223 TTTTGTGAGGATGAGGTGGGAGG - Intergenic
1156965380 18:43085049-43085071 TAGAATGAGAAGGAAGCGGGAGG + Intronic
1157165968 18:45358817-45358839 TTGTGGGAGATTGAGGTGGGAGG - Intronic
1158147324 18:54330030-54330052 TTCTATGTGAATGCAGAGGGGGG + Intronic
1160636011 19:75964-75986 TTCTATGAGAAAGAAGGGGAGGG + Intergenic
1161509588 19:4663110-4663132 TAGAATGAGGATGAGGTGGGTGG - Intronic
1162175205 19:8825071-8825093 GTGTGTGAGAATGAAGAGTGTGG - Exonic
1162198356 19:9003166-9003188 TTATTTGGGAATGAAATGGGAGG - Intergenic
1162256686 19:9496235-9496257 TTTTCTGAGATTGAGGTGGGAGG + Intronic
1162476477 19:10903302-10903324 TTGAAAAAGAATGAAGTTGGAGG - Intronic
1164753929 19:30675964-30675986 ATGTAAGAGGCTGAAGTGGGAGG - Intronic
1165503421 19:36208441-36208463 TTTTAGGAGGCTGAAGTGGGAGG - Intronic
1165723738 19:38098326-38098348 TGGTATGAGAATGAAATGTTTGG - Intronic
1165993844 19:39831264-39831286 TTGAAGCAGGATGAAGTGGGAGG - Intronic
1168529560 19:57117024-57117046 TTGTAGGAGATTGGGGTGGGTGG + Intergenic
926078830 2:9966861-9966883 TTGTATGTGACTGAGGTGGTTGG - Intronic
926441433 2:12892860-12892882 TTTTATGAGAGTGATTTGGGAGG - Intergenic
928357711 2:30635154-30635176 CTTTGGGAGAATGAAGTGGGAGG + Intronic
929326394 2:40616562-40616584 TTGTATGAGAAATGAGGGGGGGG - Intergenic
929938145 2:46309936-46309958 TAGTGTGAGCATCAAGTGGGTGG + Intronic
930028596 2:47044787-47044809 TTGGTAGAGAATGAAGAGGGTGG - Intronic
933246073 2:79976052-79976074 TTGTATGTTAATGAGGTGGCTGG - Intronic
936073220 2:109384877-109384899 CTGTGTGAGAATGAACTGTGGGG - Intronic
936272923 2:111065057-111065079 TTGAAAAAGAATAAAGTGGGAGG + Intronic
936565469 2:113579086-113579108 TTCTATGAGAAAGAAGGGGAGGG - Intergenic
937274478 2:120675056-120675078 TGAGATGAGAATGAAGTTGGGGG + Intergenic
937717927 2:125056225-125056247 TTTCAGGAGAATGTAGTGGGTGG - Intergenic
938379473 2:130828511-130828533 ATGTCTGATAATGGAGTGGGAGG + Intergenic
939072955 2:137565709-137565731 CTGTATCAAAATGAAGTGGAGGG + Intronic
941486785 2:166091963-166091985 TTGTGTTAGAATGAGATGGGTGG - Intronic
942183460 2:173402474-173402496 GTGTATGAGGATAAAGTGGCTGG + Intergenic
943389024 2:187239367-187239389 TTTAAAGAGAATGAAGGGGGAGG - Intergenic
944014388 2:195017058-195017080 TTGGAAGAGGAGGAAGTGGGAGG - Intergenic
944155817 2:196606428-196606450 ATGTATGACAAGAAAGTGGGAGG - Intergenic
944200476 2:197101972-197101994 GTGTATGAGGATGAAGAGGAAGG - Intronic
947428653 2:230006659-230006681 ATGGCTGGGAATGAAGTGGGAGG + Intronic
947442966 2:230139509-230139531 TTTTAGGAGGCTGAAGTGGGAGG - Intergenic
948227376 2:236321873-236321895 TTGTATGAGTGTGAAGTTGGTGG - Intergenic
948479868 2:238242565-238242587 TTGTCTGACAGTGGAGTGGGTGG + Intergenic
948691865 2:239711336-239711358 TTGAATGAAACTGAAGGGGGAGG - Intergenic
1168888605 20:1278510-1278532 TTGCCTGAGGATGAAGGGGGAGG - Intronic
1170010022 20:11712857-11712879 CTGTCTGGGGATGAAGTGGGAGG - Intergenic
1170516827 20:17138594-17138616 TTGAAAGAGAAAGAAGTGAGAGG + Intergenic
1173457295 20:43213758-43213780 TTGTAATAGTATGAAGAGGGTGG + Intergenic
1173630434 20:44509979-44510001 CTGAATGAGGATGAAGAGGGCGG + Exonic
1174206993 20:48847344-48847366 TTATAAGAGAAGGAAGAGGGAGG - Intergenic
1174602708 20:51737943-51737965 TCTTAGGAGACTGAAGTGGGAGG + Intronic
1174654697 20:52161058-52161080 ATGTAATAGAATGAGGTGGGAGG + Intronic
1175196666 20:57248531-57248553 TTGCATGAGGATGAACTGGCTGG + Intronic
1175411789 20:58775089-58775111 TTGTTGATGAATGAAGTGGGGGG + Intergenic
1175984464 20:62757485-62757507 TTGTAAGAAAATAAAGTTGGAGG - Intronic
1176338965 21:5625267-5625289 TTTTAGGAGATTGAGGTGGGAGG - Intergenic
1176340373 21:5688340-5688362 TTTTAGGAGATTGAGGTGGGAGG - Intergenic
1176472627 21:7120493-7120515 TTTTAGGAGATTGAGGTGGGAGG - Intergenic
1176504454 21:7636116-7636138 TTTTAGGAGATTGAGGTGGGAGG + Intergenic
1178331540 21:31699030-31699052 TTGAAAAAGAGTGAAGTGGGAGG + Intronic
1179565386 21:42244680-42244702 TCGTCTGAGAATGAGCTGGGAGG + Intronic
1181176383 22:21039294-21039316 TTGTGGGAGACTGAGGTGGGAGG + Intergenic
1181756827 22:25029790-25029812 TAGTGTGTGAGTGAAGTGGGCGG + Intronic
1182769228 22:32781863-32781885 TTGTAAGAGAATGAAAAAGGAGG - Intronic
949276271 3:2286239-2286261 TTGTATGTGTATGTTGTGGGGGG - Intronic
949364651 3:3267733-3267755 TTCTATGGGAAGGTAGTGGGTGG + Intergenic
949420930 3:3864924-3864946 AGGTATGAGAATGAGATGGGAGG - Intronic
951206285 3:19929280-19929302 TTTTGTGAGGCTGAAGTGGGAGG - Intronic
952352800 3:32556775-32556797 TTTTAGGAGACTGAAGTGGGAGG - Intronic
953160478 3:40415081-40415103 TTGTAAGAAATTGAAGGGGGTGG + Intronic
954718218 3:52537725-52537747 TGCTGTGAGAAGGAAGTGGGAGG + Intronic
955472638 3:59301834-59301856 TTGAATCAGGAGGAAGTGGGAGG + Intergenic
957150061 3:76475334-76475356 TTGAATGAGGATGAAGTGGAAGG + Intronic
957169787 3:76723567-76723589 TTGTATGAGAATGAAGTGGGCGG - Intronic
958605933 3:96358474-96358496 TTGAATAGGAATGAGGTGGGAGG + Intergenic
959675660 3:109032418-109032440 TTGTATGAAAATGAACTGGAAGG + Intronic
959718787 3:109463591-109463613 TTGTACTAGACTGTAGTGGGTGG - Intergenic
960072794 3:113450817-113450839 TTGTGTGAGATCGAGGTGGGTGG - Intronic
961339298 3:126206655-126206677 TAGTAAGAGAATAAAGTGGCTGG - Intergenic
963077670 3:141362394-141362416 TTTTATGTTAATGATGTGGGGGG - Intronic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
966729670 3:183140161-183140183 CTGTGTGAGACTGAGGTGGGTGG + Intronic
968846422 4:3044752-3044774 TTGTATGTTAATGAGGTGGCTGG + Intergenic
968905295 4:3448026-3448048 TTGGATGAGAGTGAGTTGGGAGG + Exonic
969684545 4:8663669-8663691 TTTTGGGAGGATGAAGTGGGAGG + Intergenic
972462192 4:39315049-39315071 GTGAAGGAGAAAGAAGTGGGAGG - Intronic
974283749 4:59836425-59836447 ATGTATGAGAATTAACTTGGTGG - Intergenic
974310399 4:60200902-60200924 CTGAATCAGAATGAAGTGGAGGG - Intergenic
975653631 4:76619714-76619736 TTGTAGTAGAATGAAGTAGAGGG + Intronic
978407879 4:108398982-108399004 TTAGATGTGAATGAAGTGGGTGG + Intergenic
979910136 4:126354825-126354847 ATGTAGGAGAATAAAATGGGTGG + Intergenic
981036429 4:140174318-140174340 TTGAAAAAGAATGAATTGGGAGG - Intergenic
981227875 4:142318203-142318225 GTGTGTGAGAAAGAAATGGGGGG + Intronic
982714046 4:158788153-158788175 TGGTATGAGATTTAAGTGGGTGG + Intronic
982715361 4:158801479-158801501 TGGTATGAGAATGAGCAGGGTGG + Intronic
983039917 4:162913745-162913767 TTGTATAAAAATTAAGTGAGAGG + Intergenic
983316325 4:166136670-166136692 TAGCATGAGAATGAATTGGGAGG - Intergenic
987176287 5:15313942-15313964 ATGTCTGAGAATTAAGTGGAAGG - Intergenic
987662239 5:20892092-20892114 TTGTATGATAAGAAAGTGTGGGG + Intergenic
988126035 5:27038787-27038809 TTGCAAGCGAATGAAGTGGGAGG + Intronic
988437508 5:31193683-31193705 TTGCAAGTGAATGAAGTGGGAGG - Intergenic
988646885 5:33104863-33104885 CTGAACGAGAATCAAGTGGGTGG + Intergenic
989713813 5:44434922-44434944 ATGTATGAGAAACTAGTGGGTGG + Intergenic
990317005 5:54592181-54592203 ATGTGTGGGAAGGAAGTGGGAGG - Intergenic
990450186 5:55926260-55926282 ATGTGGGAGACTGAAGTGGGAGG - Intergenic
990783223 5:59390716-59390738 TTGTATGAGAAGGAGGTAAGGGG + Intronic
991246734 5:64516623-64516645 CTGTATCAGAATCATGTGGGTGG + Intronic
992258291 5:74944318-74944340 TTGAATGAGAACGAACTGAGAGG + Intergenic
995405722 5:111793342-111793364 TAGTATGAGTCTGAAGGGGGAGG + Intronic
996066061 5:119080530-119080552 TTGTATAAGAAAAATGTGGGAGG - Intronic
996171725 5:120301242-120301264 TTGTGAGACAATGAAGTGGGAGG + Intergenic
996368343 5:122726405-122726427 CAGTATGAGAATGAAGTGAGGGG + Intergenic
996395828 5:123012919-123012941 GTGTATCAGAGTGAACTGGGTGG - Intronic
997868809 5:137488939-137488961 GTTTTTGAGAATGAAGTGAGAGG + Intronic
998046403 5:138990561-138990583 TGGTTGGAGACTGAAGTGGGAGG - Intronic
1000054040 5:157588245-157588267 TTGAAGGAGAACGAAGTTGGAGG - Intergenic
1002035068 5:176462031-176462053 CTTTATGAGACTGAGGTGGGAGG + Intronic
1003385292 6:5661723-5661745 TGGGTTGAAAATGAAGTGGGAGG + Intronic
1003760171 6:9171145-9171167 GTCTATGAGAATGCTGTGGGAGG + Intergenic
1004084275 6:12429266-12429288 TTGTGTGTGCATGAAGAGGGTGG + Intergenic
1004707871 6:18141266-18141288 TGCTTTGAGAATGAGGTGGGAGG + Intronic
1004735004 6:18396791-18396813 TTGTTTAAGCATGAACTGGGAGG + Intronic
1005550425 6:26907264-26907286 TTTTCCGAGAATGAAATGGGTGG - Intergenic
1006749815 6:36369795-36369817 TTGCAAGAGGCTGAAGTGGGAGG + Intronic
1007229976 6:40341465-40341487 TTGTATGATAATGAAATGACTGG + Intergenic
1009025025 6:57988929-57988951 TTGTATGTGAAGGGAGTGAGGGG - Intergenic
1009200591 6:60740385-60740407 TTGTATGTGAAGGGAGTGAGGGG - Intergenic
1009813046 6:68694466-68694488 TGGTATGGGAGTGAGGTGGGGGG + Intronic
1010573156 6:77502717-77502739 TTTTAGGAGAACGAGGTGGGTGG - Intergenic
1011343900 6:86347784-86347806 GAGAATGAGAATGAAGTGAGAGG + Intergenic
1011377284 6:86703127-86703149 TTGAATAAGAATGAAGAGAGAGG + Intergenic
1011840146 6:91487496-91487518 TTGTCTGTGAATGAGATGGGCGG + Intergenic
1013362415 6:109406293-109406315 CTGTGGGAGACTGAAGTGGGAGG - Intronic
1014925486 6:127266116-127266138 TTGTAGGAAAATGAAGAGGGTGG - Intergenic
1015200353 6:130572768-130572790 TTGTTTGAAAATGGAGTGAGTGG - Intergenic
1015629310 6:135215544-135215566 TTGTGTGAGAATTAAATGAGAGG + Intronic
1015838343 6:137447255-137447277 TTGAACGAGAATGAAGTGCAAGG - Intergenic
1016876990 6:148875557-148875579 TTTTGGGAGACTGAAGTGGGCGG + Intronic
1019754065 7:2755204-2755226 TTGAAAAAGAATAAAGTGGGAGG - Intronic
1020207298 7:6129053-6129075 TTGTGTGAGCCTGAGGTGGGCGG - Intronic
1022001073 7:26226718-26226740 TTCTATGAGCATGAAATGTGAGG - Intergenic
1022016619 7:26355260-26355282 TTGAAAAAGAATAAAGTGGGAGG - Intronic
1023197694 7:37659578-37659600 ATGTATGGAAAGGAAGTGGGGGG + Intergenic
1024475375 7:49803313-49803335 CTTTATGAAAATGAAGTGGCAGG + Intronic
1024581037 7:50801255-50801277 TGTTTTGAGAATGAAGAGGGAGG - Intergenic
1024595891 7:50937151-50937173 TTGTGAGACACTGAAGTGGGAGG - Intergenic
1026021630 7:66712030-66712052 TTGAATAAGAATAAAGTTGGAGG - Intronic
1026892332 7:73989514-73989536 TTGCTTCAGAATGAAGTGGTTGG + Intergenic
1027416617 7:77980899-77980921 TGGAATGAGCAGGAAGTGGGGGG + Intergenic
1027911611 7:84259373-84259395 TGTTCTCAGAATGAAGTGGGTGG - Intronic
1028568782 7:92263127-92263149 TTGTATGGGAATGAAATGACAGG + Intronic
1030275062 7:107711846-107711868 TAGTATGAGAATGAATTAGAGGG - Intronic
1030498320 7:110327910-110327932 ATGTTTGAGAATGAAGAAGGTGG + Intergenic
1030553096 7:110989291-110989313 TTTTAGGAGACCGAAGTGGGAGG + Intronic
1032307967 7:130754679-130754701 TTCTATGACCAGGAAGTGGGGGG - Intergenic
1032518591 7:132525490-132525512 TTTTGTGAGACTGAGGTGGGAGG - Intronic
1033959129 7:146891333-146891355 TTGTGTGACACTGAAGTTGGGGG - Intronic
1034199185 7:149271338-149271360 TTATAGGATAATGAAGTGGTAGG - Intronic
1036110574 8:5896269-5896291 ATGTGTGAGAGAGAAGTGGGTGG - Intergenic
1036216726 8:6886149-6886171 TTGAAAAAGAATGAAGTTGGAGG + Intergenic
1037074858 8:14702026-14702048 TTGAATGAGACTGAAGAAGGTGG - Intronic
1037488764 8:19376317-19376339 TTGGATGAGATTTAAATGGGAGG - Intronic
1037638604 8:20722523-20722545 TGGGCTGAGAATGAAGTGGTAGG + Intergenic
1038832021 8:31072441-31072463 TAGCAAGAGAATGAGGTGGGTGG + Intronic
1039075695 8:33688983-33689005 CTTTAGGAGGATGAAGTGGGAGG - Intergenic
1039279870 8:35972586-35972608 TTTTATAAGAAGGAAGTAGGGGG + Intergenic
1039550228 8:38438106-38438128 TCCTATGAGGATGAAATGGGAGG - Intronic
1041112808 8:54502345-54502367 TTTTGTGAGGCTGAAGTGGGAGG + Intergenic
1042946984 8:74164966-74164988 TAGTAGGAGACTGAGGTGGGAGG + Intergenic
1043035035 8:75186117-75186139 TTGCATGATGATGAAGTTGGGGG - Intergenic
1044647173 8:94456192-94456214 TTGTGTGAGAATGAAGATGTAGG - Intronic
1047681043 8:127254412-127254434 TTTTGGGAGAATGAGGTGGGTGG + Intergenic
1047843874 8:128785012-128785034 GAGGAAGAGAATGAAGTGGGAGG + Intergenic
1049028187 8:140012147-140012169 TTTTAGAAGAAAGAAGTGGGGGG + Intronic
1049886956 9:34138-34160 TTCTATGAGAAAGAAGGGGAGGG + Intergenic
1050055040 9:1643377-1643399 TTGAAAGAGAACGAAGTTGGAGG - Intergenic
1050307452 9:4319770-4319792 TAGTAGGAGACTGAGGTGGGAGG - Intronic
1056163188 9:83918695-83918717 TTTTAGGAGACTGAGGTGGGAGG + Intronic
1056407643 9:86290883-86290905 TTGTATGTGTATGAAGTATGAGG - Intronic
1056956681 9:91087876-91087898 TTTTAGGAGGCTGAAGTGGGAGG - Intergenic
1057112249 9:92484252-92484274 ATGTATGAGAATGGAGTGTGAGG - Intronic
1057817705 9:98307740-98307762 TTGTGTGTGGATGAAATGGGAGG + Intronic
1058606165 9:106725889-106725911 TTTTAAGAGAATGAAGGAGGGGG + Intergenic
1060044569 9:120329471-120329493 CTTTAGGAGACTGAAGTGGGTGG - Intergenic
1060402968 9:123358832-123358854 TTGGAAGAGAATGCAGTGAGCGG + Intronic
1061162936 9:128906235-128906257 TTTTGGGAGGATGAAGTGGGAGG - Intronic
1061819162 9:133215468-133215490 TTTTTTAAGAATAAAGTGGGAGG + Intergenic
1062026461 9:134342879-134342901 TTGTATGTGAGTGATGTGGGTGG + Intronic
1062296500 9:135831388-135831410 CTTTAGGAGACTGAAGTGGGAGG + Intronic
1203422694 Un_GL000195v1:9653-9675 TTTTAGGAGATTGAGGTGGGAGG + Intergenic
1187369162 X:18690009-18690031 TTTTATGAGAGTGAGGTGGGGGG - Intronic
1187381666 X:18807482-18807504 TTGTAAGAGCAAGAAGAGGGTGG - Intronic
1187905652 X:24063664-24063686 ATGTAGGAGGCTGAAGTGGGAGG + Intronic
1188549923 X:31351894-31351916 TTTTATGTCAATGAAGTCGGGGG - Intronic
1189508175 X:41634190-41634212 TTGTGTGAAAATAAAGTGTGTGG + Intronic
1192813187 X:74567257-74567279 TTGCAGAAGAATAAAGTGGGAGG + Intergenic
1195584344 X:106547399-106547421 TTGAAAAAGAATAAAGTGGGAGG - Intergenic
1195726298 X:107920542-107920564 TTGCATGAGAATGAAAAGGAAGG - Intronic
1196073615 X:111550275-111550297 TTTCATGAGAATGTAATGGGAGG + Intergenic
1197422097 X:126250258-126250280 ATTTATGAGGCTGAAGTGGGAGG - Intergenic
1197921192 X:131596302-131596324 TTGTATGAGAAAGAAGTACATGG - Intergenic
1198735780 X:139783627-139783649 TTGTGGGAGGCTGAAGTGGGAGG + Intronic
1201276330 Y:12302331-12302353 TTGTTTAAGAATCAAATGGGAGG + Intergenic