ID: 957173047

View in Genome Browser
Species Human (GRCh38)
Location 3:76764757-76764779
Sequence TGCATAGGAGATTAGAGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 205}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957173047 Original CRISPR TGCATAGGAGATTAGAGAGG TGG (reversed) Intronic
900004371 1:35032-35054 TGGAGGGGAGACTAGAGAGGTGG + Intergenic
900024096 1:205548-205570 TGGAGGGGAGACTAGAGAGGTGG + Intergenic
903086701 1:20867306-20867328 TACATAGTAGATTAAAGAGCTGG - Intronic
903424135 1:23240777-23240799 TGCATAGGAGCTGGGCGAGGTGG + Intergenic
903648512 1:24909290-24909312 TGGAGAGGAGCTTAGAGCGGTGG - Intronic
904098087 1:27997735-27997757 TGCAAAGGAGATGTGAGATGTGG - Intronic
907330282 1:53666548-53666570 TGAAGATGAGATTAGAGAGGAGG - Intronic
908879328 1:68712753-68712775 TGAATAGGAGTTGTGAGAGGGGG - Intergenic
909488375 1:76198984-76199006 TGAAGAGGAGATTTCAGAGGAGG + Intronic
910456317 1:87400985-87401007 TGCAGAGGAGATAAGGGAGCAGG + Intergenic
910507967 1:87971827-87971849 TTCACTGGAGATTAGAGAGATGG + Intergenic
911710541 1:101066676-101066698 AGGAAATGAGATTAGAGAGGTGG + Intergenic
914741217 1:150466775-150466797 AGCATAAGAGAGTAGAGAGTAGG - Intronic
915782019 1:158562825-158562847 TGCATAGGTGAAGAGAGTGGAGG + Exonic
920279450 1:204831646-204831668 TTCTTAGGAAATCAGAGAGGGGG + Intronic
921300547 1:213747453-213747475 TGCAAAGGAGATCAAAGAGTTGG + Intergenic
923497080 1:234535046-234535068 GGGAGAGGGGATTAGAGAGGTGG - Intergenic
924422034 1:243918536-243918558 TGTTTAGGAGAACAGAGAGGAGG + Intergenic
1063895643 10:10678733-10678755 TGGATAGGTGATTAAATAGGGGG + Intergenic
1064498895 10:15946930-15946952 TGCCTAGGAGAGGAGAGAGTTGG + Intergenic
1069728375 10:70595731-70595753 TGGGCAGGAGATTAGGGAGGTGG - Intergenic
1069737292 10:70665164-70665186 GGGATAGGAGATGAGAGTGGTGG + Intergenic
1070413850 10:76170822-76170844 TTTATATGAGGTTAGAGAGGAGG + Intronic
1070420533 10:76232449-76232471 TTCATAGGGGAGAAGAGAGGGGG + Intronic
1070513341 10:77180831-77180853 TGAATAGGAAATAAAAGAGGTGG - Intronic
1071109393 10:82137137-82137159 TACAGAGGAGCTTAGGGAGGGGG - Intronic
1071277872 10:84072624-84072646 TGAATAGGAGTTTTGAGAGAGGG + Intergenic
1073817370 10:107222811-107222833 TTCATAGGAAAATAGAGAGGAGG - Intergenic
1073994410 10:109299308-109299330 GGCATAGGAGCTTAGAGGAGAGG - Intergenic
1074275734 10:112000167-112000189 TGCATTGCAGACTAGAGATGGGG - Intergenic
1075334319 10:121597790-121597812 TGCATAGGTGATGGGGGAGGTGG - Intronic
1076033516 10:127178945-127178967 TGAATAGGAGATCAGAGTGAAGG - Intronic
1076281628 10:129251312-129251334 TGAACAGGAGGGTAGAGAGGAGG - Intergenic
1076418340 10:130308670-130308692 TGAATATGATATTGGAGAGGTGG - Intergenic
1076607914 10:131701410-131701432 TGGAGAGGAGGTTAGAGAGACGG - Intergenic
1078515227 11:12016243-12016265 TGCATAGTAAATTAGAAAAGGGG + Intergenic
1080434172 11:32224517-32224539 TGCAAAAGAGATAAGAGAGGAGG - Intergenic
1080576142 11:33600895-33600917 TCCATAGAAGATGAGAGAGTGGG + Intronic
1081435267 11:43020915-43020937 TGGACAGGAGATTGGAGAGATGG + Intergenic
1085718765 11:78895539-78895561 TGGATAGGAGATTTGAGGGGAGG - Intronic
1086814428 11:91351162-91351184 AGCAGGGGAGATTAGAGAGAAGG - Intergenic
1090712214 11:129397389-129397411 TGCACAGGAGATTGTATAGGTGG + Intronic
1091111856 11:132976879-132976901 TTCAAAAGAGATTAGAGAAGGGG + Intronic
1091377792 12:37080-37102 TGGAGGGGAGACTAGAGAGGTGG + Intergenic
1091593303 12:1858216-1858238 TGCAAAGGTGATGAGAAAGGAGG - Intronic
1094083154 12:26559755-26559777 TGCAAAGGTGCTTAGACAGGAGG - Intronic
1094284501 12:28777725-28777747 TGAATAGGGGATTGGAGAGGGGG - Intergenic
1096220597 12:49826320-49826342 TGAAGAGGAGCTGAGAGAGGAGG - Intronic
1097102122 12:56597193-56597215 AGCACAGGAGAGTAGGGAGGAGG - Exonic
1103004422 12:117409606-117409628 TGGATAGGTGAATGGAGAGGTGG + Intronic
1104264167 12:127215437-127215459 TTCATAGGAAATAAGAGAGAAGG + Intergenic
1105834073 13:24193174-24193196 TGGATAGGAGAGTAGAAAAGTGG + Intronic
1106337681 13:28798622-28798644 CACATAGGAGATAAGAAAGGGGG - Intergenic
1107492687 13:40896603-40896625 TGCAGAGGAGACTTTAGAGGTGG - Intergenic
1107585593 13:41844443-41844465 TGCATAGGAGTTATGAGAGTGGG - Intronic
1108138912 13:47397357-47397379 TGGACAGGAGAGTAGGGAGGAGG - Intergenic
1108388920 13:49928504-49928526 AGCCTAGGAGATAAGAGAGTGGG + Intronic
1108509902 13:51147233-51147255 TGTGTAGGAGATAAGAAAGGGGG - Intergenic
1108862559 13:54880222-54880244 TGGACAGCAGATTAGAGGGGAGG - Intergenic
1109373465 13:61456905-61456927 TGCAGAGGAAACTAGAGAGGTGG - Intergenic
1110158365 13:72345310-72345332 TGAATAGGGGAGCAGAGAGGAGG + Intergenic
1111330742 13:86760269-86760291 TGCAGAGGAGATGACAGATGAGG + Intergenic
1111604161 13:90516358-90516380 TGCAAAGGAAATTAGAGAAGGGG + Intergenic
1112820730 13:103331955-103331977 GGCATAGGAGAACAGAGAGCAGG + Intergenic
1112957239 13:105074690-105074712 TTCATGGGAGATTTGAGAGAAGG + Intergenic
1115518151 14:34205997-34206019 AGCATAGGAGGTTATGGAGGTGG - Intronic
1116386776 14:44340549-44340571 TCCAAAGGAGATGAGAGAGCAGG + Intergenic
1116663150 14:47738302-47738324 CTCTCAGGAGATTAGAGAGGAGG + Intergenic
1116777118 14:49193922-49193944 TCCATAGGAAATAAGAGAAGAGG - Intergenic
1119078751 14:71672191-71672213 TGAATAGGAGATTAGTGAAGAGG + Intronic
1119140551 14:72263467-72263489 TGCATAAGAGGATAGAGAAGGGG - Intronic
1120433178 14:84445090-84445112 TGGTTAGGAGAAAAGAGAGGAGG - Intergenic
1120546466 14:85818299-85818321 TGCATGGGAGGTAAGGGAGGAGG + Intergenic
1122390557 14:101379116-101379138 TGCTTTGCAGATTAGTGAGGAGG + Intergenic
1125830930 15:42716710-42716732 TGGATAGGGGATGAGCGAGGAGG + Exonic
1126350749 15:47742655-47742677 TGCATATGACATGAAAGAGGTGG + Intronic
1128418756 15:67471751-67471773 AGCATAGGAGTATTGAGAGGAGG - Intronic
1128599505 15:68983900-68983922 GGCACAGGAGATCAGAGAGATGG - Intronic
1132449134 15:101955912-101955934 TGGAGGGGAGACTAGAGAGGTGG - Intergenic
1134378206 16:13699376-13699398 TCCATAGGGCATTTGAGAGGAGG - Intergenic
1136644517 16:31599036-31599058 TGCATAAAAGATTAGAGGGATGG - Intergenic
1140675373 16:77323472-77323494 TGCACATGAGATTAGGGAGTTGG + Intronic
1140928389 16:79604240-79604262 TTTATAGGAGATTTGTGAGGGGG + Intergenic
1141473879 16:84258780-84258802 TGAAGAGGAGAAGAGAGAGGGGG + Intergenic
1142525524 17:537555-537577 AGCCTGGGAGATGAGAGAGGTGG + Intronic
1143409966 17:6702885-6702907 TGCAGAGGAGCAGAGAGAGGTGG + Intronic
1143727521 17:8859628-8859650 TGAATAGGAGAAGAGGGAGGAGG + Intronic
1146133677 17:30299396-30299418 TATATAGGAGATAAGAGATGAGG + Intergenic
1150881140 17:69029823-69029845 TCCAAAGAAGATGAGAGAGGAGG + Intronic
1151706280 17:75769976-75769998 TGAATAGGAGAAGAGAGAGCAGG + Intergenic
1152866633 17:82727554-82727576 TGCACAGGAGAGCAGGGAGGAGG - Exonic
1153101478 18:1475573-1475595 TGGATACAAGATTAGAAAGGAGG + Intergenic
1157387773 18:47273816-47273838 TGCATTGGAGATAAGGTAGGGGG - Intergenic
1160044484 18:75373922-75373944 TGCACATGAGCTCAGAGAGGTGG - Intergenic
1160096844 18:75881279-75881301 TGCAGAGGAGATTAGTTAGAAGG - Intergenic
1160317425 18:77860302-77860324 TGCCTACGAGGTTAGAGAGAGGG + Intergenic
1160636123 19:76641-76663 TGGAGGGGAGACTAGAGAGGTGG + Intergenic
1162332370 19:10038193-10038215 TGCACAGGATATTAGAGGAGTGG - Intergenic
1162813381 19:13178381-13178403 AGAAAAGGAGATAAGAGAGGTGG - Intergenic
1163870510 19:19817292-19817314 TGCAAACAAGATTAGAAAGGAGG - Intronic
1164135624 19:22413190-22413212 TGAATAGGAGTGTTGAGAGGAGG - Intronic
1164162792 19:22639890-22639912 TGAATAGGAGTGTTGAGAGGAGG + Intronic
1164702017 19:30292138-30292160 TGCAAAATGGATTAGAGAGGAGG - Intronic
1166376280 19:42329048-42329070 TGCATAGGAGTTTATTGAGTGGG + Intronic
925689833 2:6510623-6510645 TGCAGAAGGGAATAGAGAGGAGG + Intergenic
927544184 2:23939006-23939028 TGAACAGGAGATGAGGGAGGTGG + Intronic
929027728 2:37621166-37621188 TGCATAGGAGATCATAGGAGAGG - Intergenic
930343906 2:50153625-50153647 TGCAGAGGAAATTAGAAAGTCGG - Intronic
931261332 2:60622147-60622169 TGAATAGGAAAATAGAGGGGTGG - Intergenic
936565358 2:113578409-113578431 TGGAGGGGAGACTAGAGAGGTGG - Intergenic
938774860 2:134532466-134532488 AGCAAAGGAGCTTAGGGAGGAGG - Intronic
939872796 2:147543468-147543490 TTCATAGGAATTTAGAGATGAGG - Intergenic
939891209 2:147738454-147738476 TGCAGAGGGGATTAAAGATGGGG + Intergenic
941079574 2:161045176-161045198 TGGAAAGGAGGTCAGAGAGGTGG - Intergenic
947475957 2:230447884-230447906 TGAACATGAGATTAGAGGGGTGG - Intronic
947624541 2:231611589-231611611 TGCCTTGGAGCTCAGAGAGGGGG + Intergenic
1168728860 20:60071-60093 TGGAGGGGAGACTAGAGAGGTGG + Intergenic
1169502861 20:6177728-6177750 AGGATAGGAGATGAGAGAGATGG + Intergenic
1172778557 20:37422515-37422537 TGAATAAGAGAGTAGAGAGTGGG - Intergenic
1172877567 20:38175122-38175144 TGACTAGGAAATTAGAAAGGTGG - Intergenic
1173545302 20:43893279-43893301 TGCACAGGAGACTAGACAGGTGG - Intergenic
1173823755 20:46034516-46034538 GGCATAGGAGATGTCAGAGGGGG + Intronic
1174852193 20:54006255-54006277 TGCATGTGAGTTTAGGGAGGAGG - Intronic
1174942611 20:54947219-54947241 TGCATAGAAGAAAAGACAGGAGG - Intergenic
1175455835 20:59113229-59113251 TGCAGAGGGGAGTAGTGAGGTGG - Intergenic
1180914243 22:19474235-19474257 TGCACTGGAGATTAGAAACGGGG + Intronic
1181971467 22:26693599-26693621 TACATAGGAGATTGCAGAGGGGG + Intergenic
1184822751 22:46922961-46922983 TGAATAGGAGTTTTGAGAGTGGG + Intronic
1185001350 22:48248411-48248433 GTCACAGGAGACTAGAGAGGGGG + Intergenic
949522623 3:4870541-4870563 TGCATTGGAAATTGGGGAGGAGG + Intronic
952142489 3:30495349-30495371 TGAACAGGAGAATAGAGAGATGG + Intergenic
952244662 3:31573891-31573913 AACAGAGAAGATTAGAGAGGTGG + Intronic
955015386 3:55064536-55064558 TGCACAGGAGTGGAGAGAGGAGG - Intronic
956032060 3:65049098-65049120 TGACTTGGAGCTTAGAGAGGAGG + Intergenic
956204161 3:66738704-66738726 TGCCTTGGAGTTTAGGGAGGTGG - Intergenic
956396861 3:68835085-68835107 TGCAGAGGCCATGAGAGAGGAGG - Intronic
957173047 3:76764757-76764779 TGCATAGGAGATTAGAGAGGTGG - Intronic
957700769 3:83708091-83708113 TGAATAGGAGTGGAGAGAGGGGG - Intergenic
960560457 3:119077631-119077653 TGAATAGGAGAGTTGAGAGTAGG - Intronic
962287906 3:134103802-134103824 TGCAGGGGAGATCAGAGAGGAGG - Intronic
962347349 3:134627914-134627936 TGAAAAGGAGAGTAAAGAGGAGG - Intronic
964297206 3:155246707-155246729 AGCAGAGGAGATTAGGCAGGTGG - Intergenic
965847795 3:172985128-172985150 TGCATGGGGGATAAGGGAGGAGG - Intronic
966563381 3:181348292-181348314 TACATAGTAAATTAGAGAAGGGG - Intergenic
966650315 3:182293463-182293485 TGCAAAAGAGATTACAGAAGAGG + Intergenic
967072050 3:185971014-185971036 AGAATAAGAAATTAGAGAGGTGG - Intergenic
968931156 4:3580220-3580242 TGGATAGGAGGATAGAGAGAAGG - Intronic
969286919 4:6208380-6208402 TGCATAGGAGATGAAAGGAGGGG - Intergenic
969483906 4:7461090-7461112 ATCAGAGGACATTAGAGAGGAGG + Intronic
975213617 4:71729287-71729309 TGCATTGGAGGATAGTGAGGTGG + Intergenic
977539297 4:98297173-98297195 ATCATAGAAGATTAGAGATGTGG - Intronic
977673312 4:99720398-99720420 GGGAAAGGAGATTAGAGTGGAGG + Intergenic
977823725 4:101505477-101505499 TGCATGGGGGATGAGAGAGGAGG + Intronic
978991830 4:115093186-115093208 TGGATAGAACATTAGAGCGGTGG + Intronic
980273647 4:130619955-130619977 TTCATAGGAAATTAGACATGTGG - Intergenic
983152303 4:164299774-164299796 TACAGAGGAAAATAGAGAGGTGG + Intronic
985994368 5:3589201-3589223 TACATAGGGGTTTAGGGAGGGGG - Intergenic
986784743 5:11103880-11103902 TGCATTGGAGATCAGAGACTAGG - Intronic
986789457 5:11145657-11145679 TGGAGAGAGGATTAGAGAGGTGG - Intronic
987451197 5:18086060-18086082 TGCAAAGGAGATGAGGCAGGGGG + Intergenic
991127950 5:63088691-63088713 TAAACAGGAGACTAGAGAGGGGG - Intergenic
991544043 5:67761638-67761660 TGCATAGGAGTTGTGAGAGAGGG - Intergenic
991727783 5:69553204-69553226 TGAATAGGGGATAAGAGAGATGG - Intronic
991867174 5:71074670-71074692 TGAATAGGGGATAAGAGAGATGG + Intergenic
991940707 5:71849676-71849698 AGGATATGAGATTTGAGAGGGGG - Intergenic
996077439 5:119213535-119213557 TACATAGGAGACTAGAGAAATGG - Intronic
997336841 5:133114602-133114624 TGCATAAGTGAGTAGAGAGAGGG + Intergenic
998757722 5:145399102-145399124 TATATGGGAGATTTGAGAGGAGG - Intergenic
999767183 5:154750087-154750109 TGCATGAGAGACTAGAGAGCTGG - Intronic
999883102 5:155889459-155889481 TGCATAGAAGATTCAGGAGGTGG + Intronic
1000995115 5:167950603-167950625 TGGATGGGAGTTGAGAGAGGGGG + Intronic
1001322257 5:170692296-170692318 TGCAGTGGAAATTACAGAGGAGG - Intronic
1002534978 5:179871091-179871113 TGCAGAGGACATCAGAGATGGGG + Intronic
1002567577 5:180120355-180120377 TGCGGAGAAGAGTAGAGAGGAGG - Intronic
1005453281 6:25994211-25994233 TGCATATGGGATTGGAGGGGAGG + Intergenic
1006654343 6:35577425-35577447 TCCCAAGGAGATTTGAGAGGGGG + Intronic
1006709967 6:36059878-36059900 TGCATGGGCGATAAAAGAGGAGG - Intronic
1007658393 6:43466992-43467014 TGTACAGGAGGTTAGAGAGTGGG + Intergenic
1016524722 6:144988874-144988896 TGAATAGGAGATCAGGGAGCTGG - Intergenic
1026455720 7:70570927-70570949 TGCATGGGGCCTTAGAGAGGTGG - Intronic
1027347188 7:77272709-77272731 TGAAGACGAGAGTAGAGAGGAGG - Intronic
1030300718 7:107971721-107971743 TGCACAAGAGATTAGAGGGCAGG + Intronic
1031845308 7:126798783-126798805 TGCACAGGAGGTCAGAGAGCAGG + Intronic
1032314660 7:130824389-130824411 GGCATAGGTGAGTAGAGAAGTGG - Intergenic
1035483785 7:159206725-159206747 TGCAAAGGAGAGAAGAGAGAGGG + Intergenic
1035483817 7:159206909-159206931 TGCAAAGGAGAGAAGAGAGAGGG + Intergenic
1037872130 8:22508144-22508166 TACTTAGAAGATTAGACAGGAGG + Intronic
1038453704 8:27657474-27657496 TGCATACTAGATGGGAGAGGAGG - Intronic
1038463844 8:27741760-27741782 AGCAAACAAGATTAGAGAGGTGG + Intronic
1038777174 8:30541639-30541661 TGAATTGGAGTTTAGGGAGGGGG - Intronic
1039954446 8:42196247-42196269 TGAATAAGAGATAAGAGAGCAGG + Intronic
1042384294 8:68154869-68154891 TTCATAGGCGATGGGAGAGGTGG + Intronic
1044159980 8:88901009-88901031 TGAATAGGAGTTGTGAGAGGGGG - Intergenic
1044414172 8:91917512-91917534 TGCAGAGGAGAGTAGTGAGGTGG - Intergenic
1045713347 8:105012068-105012090 GGAATAGTAGAATAGAGAGGTGG - Intronic
1046159605 8:110342856-110342878 TGCAGAGGAGATATGGGAGGGGG + Intergenic
1048124798 8:131622060-131622082 TGAATAGGAGAGGAGAGAGAGGG + Intergenic
1048301560 8:133255002-133255024 TGGCTTGGAGATGAGAGAGGAGG - Intronic
1048773087 8:137916506-137916528 AGAAGAGCAGATTAGAGAGGAGG - Intergenic
1049887066 9:34815-34837 TGGAGGGGAGACTAGAGAGGTGG + Intergenic
1050289130 9:4135773-4135795 TGCATAGCAGATGGGAGAGAAGG - Intronic
1050809749 9:9729318-9729340 TGCAAAGGAGATTGTAGAGGAGG - Intronic
1050864104 9:10476086-10476108 TGAATAGGAGAGGTGAGAGGGGG - Intronic
1052610473 9:30766625-30766647 TGCATAGGAGAAGAGAGGTGGGG - Intergenic
1052869997 9:33495537-33495559 TGCAGAGGAGACTTTAGAGGTGG - Intergenic
1055288381 9:74755770-74755792 TGCATTAGAGATTCCAGAGGTGG - Intronic
1055405464 9:75969357-75969379 TACTTTGGAGAGTAGAGAGGAGG + Intronic
1057688399 9:97259542-97259564 TGCAGAGGAGACTTTAGAGGTGG + Intergenic
1059835078 9:118142634-118142656 TGCATAGGCAATTTGAGAAGGGG + Intergenic
1060776750 9:126380260-126380282 TGCAAAGGAGATGGGAGAGGAGG - Intronic
1060781701 9:126417877-126417899 TGAATAGGAGTTTGGAGAGTCGG + Intronic
1061654529 9:132079025-132079047 TGGTTAAGAGATTAGAGAGTAGG + Intronic
1061669154 9:132179000-132179022 TTCATAGGAAATGAGAGGGGGGG - Intronic
1062158908 9:135069135-135069157 TGCAAAGGAGGACAGAGAGGTGG + Intergenic
1185865630 X:3621477-3621499 TGCATAGGTGATTTAAGAGCCGG - Intronic
1186595136 X:10972911-10972933 TAGACAGGAGTTTAGAGAGGGGG + Intergenic
1187543334 X:20221692-20221714 TGCATTGAAGATTAGAGAACAGG - Intronic
1192546806 X:72021179-72021201 TGAATAAGTGATTGGAGAGGTGG - Intergenic
1193007356 X:76635303-76635325 TGAATAGGAGTGGAGAGAGGGGG + Intergenic
1195225943 X:102793451-102793473 TGAATAGGAGTTTTGAGAGAGGG + Intergenic
1201511861 Y:14773021-14773043 TGAATAGGAGTTTTGAGAGAGGG - Intronic