ID: 957175640

View in Genome Browser
Species Human (GRCh38)
Location 3:76804406-76804428
Sequence GTCGGTTTTCTAACAAGGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 46}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957175635_957175640 29 Left 957175635 3:76804354-76804376 CCTTTCGGCAGAATTGAACATGG 0: 1
1: 0
2: 0
3: 2
4: 76
Right 957175640 3:76804406-76804428 GTCGGTTTTCTAACAAGGATAGG 0: 1
1: 0
2: 0
3: 2
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957175640 Original CRISPR GTCGGTTTTCTAACAAGGAT AGG Intronic
908687787 1:66741553-66741575 GTTGGTTTTCTAATTGGGATGGG - Intronic
912538074 1:110390814-110390836 GTTGGTTTTCTAACAACGACTGG - Intronic
917166471 1:172118221-172118243 GTGGGTTCTCTATGAAGGATTGG + Intronic
1068811141 10:61257191-61257213 GTCAGTTTTAGAACATGGATGGG + Intergenic
1079031190 11:16987540-16987562 GTGGGTTTCCTAGCAGGGATAGG - Intronic
1086368562 11:86133366-86133388 GTCCATTTTTTAACAATGATGGG - Intergenic
1102659586 12:114514180-114514202 GTGGATATTCTAACCAGGATGGG + Intergenic
1103147239 12:118605721-118605743 GTAGGTTTTCTAGCCAGGAATGG + Intergenic
1129142695 15:73614957-73614979 GTTTGTTTTCTAACAAGCAAGGG + Intronic
1138832616 16:60393494-60393516 GTATGTTTTCTAACATGGAGTGG - Intergenic
1141947790 16:87322502-87322524 GTCGGTTTGCTCCCATGGATTGG - Intronic
1146540768 17:33692354-33692376 GTTGCTTTTTTAACTAGGATAGG - Intronic
1164873792 19:31668753-31668775 TTCATTTTCCTAACAAGGATTGG + Intergenic
1166149619 19:40862954-40862976 GACTGTCTTCTACCAAGGATGGG - Intronic
1167692246 19:50993030-50993052 GTCTCTTTTGGAACAAGGATTGG + Intergenic
934626964 2:95867783-95867805 GTCAGTTTTCTAAATAGCATAGG - Intronic
934830914 2:97523669-97523691 GTCAGTTTTCTAAATAGCATAGG - Intronic
940118416 2:150235981-150236003 TTCGATTTTCTAATAAGAATGGG + Intergenic
1179334570 21:40438377-40438399 GTAGGCTTTCAAACAATGATTGG + Intronic
957175640 3:76804406-76804428 GTCGGTTTTCTAACAAGGATAGG + Intronic
960321706 3:116244692-116244714 GTTTGTTTTCTAATAAGGAGGGG - Intronic
961099334 3:124185413-124185435 GTCCCTTTTCTAACTAGGAAGGG - Intronic
961726876 3:128936730-128936752 GGAGGTTTTATAACAAGGAGGGG - Intronic
967659753 3:192092133-192092155 GTTGGCTTTCTAGCAAGGTTGGG - Intergenic
971266861 4:25103406-25103428 GTGTGTTTTCTAAAAATGATAGG - Intergenic
973555784 4:52081306-52081328 TTGGATTTTCTAACAATGATTGG + Intronic
977252361 4:94703495-94703517 GTAGGTTTTCTAACTAGGGATGG + Intergenic
983128337 4:163982618-163982640 GTTTGGTTTTTAACAAGGATTGG + Intronic
992368285 5:76115781-76115803 TTGGGTTTTCTAAGAAAGATGGG - Intronic
996899316 5:128525591-128525613 GCCAGTTTTCTAGCAAGAATAGG - Intronic
1008433772 6:51451265-51451287 GTAGGTTTTCTACTAAGTATTGG + Intergenic
1009904949 6:69858989-69859011 TTAGGTTTTCTAAGAAGGAAAGG + Intergenic
1010243056 6:73634857-73634879 GTTGGTTTTCTAACAACTAATGG + Intronic
1011908221 6:92400613-92400635 TTCGGTTTTCTAAGAAAGTTTGG - Intergenic
1013263060 6:108466057-108466079 GTTTATTTTTTAACAAGGATTGG - Intronic
1016218633 6:141636451-141636473 ATCAATTTTCTAACAAAGATTGG - Intergenic
1017476682 6:154801446-154801468 GTCTGTTTTTTAACAGGGGTGGG + Intronic
1043653422 8:82629858-82629880 TTCCCTTTCCTAACAAGGATAGG - Intergenic
1050051123 9:1602550-1602572 GTCTGTTTGCTACCAAGGAGAGG + Intergenic
1050712087 9:8476392-8476414 GTCGGGTTCCTAACAAGGTTAGG + Intronic
1051397997 9:16647271-16647293 GTAGGTTACATAACAAGGATTGG + Intronic
1059382684 9:113939495-113939517 GTTGGCTTTGTAACAAGAATTGG + Intronic
1186179122 X:6955599-6955621 GTCGCTTTTATAATTAGGATGGG + Intergenic
1188582373 X:31729608-31729630 GTAAGTTTTTTAACAAGCATGGG - Intronic
1188798285 X:34493946-34493968 GTCTGTTTTTCAACAAGGAGAGG + Intergenic
1193287145 X:79726050-79726072 GTGGATTTTCTAACAAGACTTGG - Intergenic
1195644726 X:107216526-107216548 TTCTGTTTTATAACAATGATGGG + Intronic
1195813641 X:108861062-108861084 GTTGGTTTTCTCACATGCATTGG + Intergenic
1201062557 Y:10060042-10060064 GTTGGTTTTCTATGAAGAATGGG - Intergenic