ID: 957176936

View in Genome Browser
Species Human (GRCh38)
Location 3:76823880-76823902
Sequence CCTGATTAGCAGTTGTTTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 128}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957176936 Original CRISPR CCTGATTAGCAGTTGTTTTA TGG Intronic
906743387 1:48204686-48204708 CATTATAAGCAGTTGTTTAAGGG + Intergenic
907381039 1:54089205-54089227 GCTGATTAGAAGTTATTTAATGG + Intronic
908147999 1:61267825-61267847 CCTGATTAGGAGCTTTTTGAGGG + Intronic
908409145 1:63845277-63845299 CCTGAGTAGCTGTTCTTTCAGGG - Intronic
908494554 1:64681171-64681193 CCTGCTGAGCACTTGTTTGATGG - Intronic
909906090 1:81197137-81197159 CATGATTAGCAAATGTTATATGG + Intergenic
911526152 1:98988949-98988971 CTTGAACAGCAGTTGTGTTAGGG - Intronic
911557225 1:99359830-99359852 CCTGAGCTGCAGTTGTCTTATGG - Intergenic
911627341 1:100139610-100139632 CATTATTAACAGTTCTTTTATGG + Intronic
915102767 1:153512627-153512649 CATTCTTAGCGGTTGTTTTATGG - Intergenic
918591068 1:186241755-186241777 CCTGATTAGCTAATTTTTTAGGG + Intergenic
921940684 1:220835784-220835806 TTTGTTTAGCAGTTGTTCTAGGG - Intergenic
923621008 1:235579446-235579468 CCTGACCAGCACTTGTTTTCTGG - Intronic
1064233515 10:13551443-13551465 ATTTTTTAGCAGTTGTTTTAAGG - Intergenic
1069333349 10:67319524-67319546 AATGATTAGCACTTTTTTTAGGG - Intronic
1071198912 10:83194846-83194868 CTTGATTGGCAGTTGGTTGAAGG - Intergenic
1071691371 10:87823463-87823485 CCTCATTAGCAGAAGTTTTAAGG + Intronic
1071865908 10:89731473-89731495 CCTGATTAACAGTTGATCTAGGG + Intronic
1074543004 10:114381349-114381371 GTAGATTAGTAGTTGTTTTAGGG + Intronic
1078567880 11:12432622-12432644 CCAGATAAGCAGTTATTTTTTGG - Intronic
1080186069 11:29488618-29488640 CCTGGTTAGCTATTATTTTATGG + Intergenic
1080237322 11:30086263-30086285 CCTGATTAGGAGCTGTTGTCAGG + Intergenic
1083901049 11:65643705-65643727 CCGGATAAGCAGGTGTTTTCTGG + Intronic
1085710394 11:78824096-78824118 CCGGATTGGCAGTTGTGGTATGG - Intronic
1086212406 11:84336431-84336453 CCTGAGTAGGAGCTCTTTTATGG - Intronic
1088283462 11:108161584-108161606 CCTTATTAGCTGTTGCTTTATGG + Exonic
1090464736 11:126924118-126924140 CTTGATAAGCAGTGGTCTTATGG + Intronic
1091258909 11:134218210-134218232 CCTGGTGAGCAGATGGTTTAGGG - Intronic
1093257192 12:16883911-16883933 CTTCCTTAGCAGTTCTTTTATGG + Intergenic
1098337384 12:69417905-69417927 CCCCATCAGCAGTTTTTTTAAGG - Intergenic
1100119390 12:91351057-91351079 CCTGGATAGTAGTTGATTTAGGG - Intergenic
1101196581 12:102389425-102389447 TTTGTTTAGGAGTTGTTTTATGG - Intergenic
1101583698 12:106066564-106066586 CCTGTTTGGCATTTGCTTTATGG - Exonic
1102004321 12:109579438-109579460 GCTAATTAACAGTAGTTTTAAGG - Intronic
1102444360 12:112990399-112990421 CCTGATTAGCAGTTAGTTGAAGG + Intronic
1105673517 13:22645008-22645030 GCTGCATAGCATTTGTTTTAAGG + Intergenic
1109755486 13:66753551-66753573 CCTCATTAGTATTTATTTTATGG - Intronic
1109997498 13:70147985-70148007 TCTGATTGGCAGTTGGTTGAAGG + Intergenic
1112474709 13:99720920-99720942 TCTCATTAGCATTTGTTGTAAGG + Intronic
1114376075 14:22148177-22148199 CCTGATGGCAAGTTGTTTTATGG + Intergenic
1115613155 14:35068297-35068319 GGTGATTAGAAGTAGTTTTATGG - Intronic
1115622066 14:35150420-35150442 CCTGAATGGTAATTGTTTTAGGG - Intronic
1121940121 14:98062683-98062705 CATGATTAGCATTAGTTTGAAGG + Intergenic
1123925576 15:25106765-25106787 CCTGATTACTAGGTGTTTGAAGG - Intergenic
1124210443 15:27759280-27759302 CCTTCTTAGCAGTACTTTTAGGG - Intronic
1131192056 15:90324708-90324730 CCTGATTAGCAGCAGTTGTGAGG - Intergenic
1131323534 15:91420934-91420956 CCTGATCAGCAGTGGTATTTAGG - Intergenic
1134794553 16:17023119-17023141 CCTGATTTGCTTTTGTTATATGG + Intergenic
1135922466 16:26663528-26663550 CCTCTTAAGCAGTTGTTTAATGG - Intergenic
1145392221 17:22464404-22464426 TCTGATTTGCAGTTGGTTAAAGG + Intergenic
1146794090 17:35769424-35769446 CCTGATTAGCAGATGCTCTTGGG - Intronic
1148671136 17:49411135-49411157 ACTGTTTTGCAGTTGTTTTCAGG - Intronic
1149010628 17:51853220-51853242 CCTGATTAGCAGTTTCTGTGGGG - Intronic
1155214077 18:23627305-23627327 CCTGAATAACAATTCTTTTAGGG + Intronic
1158092437 18:53729600-53729622 ACTGATTAGCACTTTATTTAGGG - Intergenic
1158268967 18:55691975-55691997 ACTGATCAGCTATTGTTTTAGGG + Intergenic
1163060896 19:14760951-14760973 TCTGATTGGCAGTTGGTTGAAGG - Intronic
926791900 2:16582024-16582046 CCTGATCAGTAGCTGTTTTTGGG + Intronic
928972666 2:37047323-37047345 CCTAAAGAGCAGTTGTTTTGAGG + Intronic
933695728 2:85215829-85215851 CCTGCTCAGCAGTGTTTTTAAGG + Intronic
935418388 2:102842419-102842441 CCTGATAAGCAGCTGTGTGAGGG - Intronic
937017586 2:118619813-118619835 CCTAATTTGCAGTGATTTTAGGG - Intergenic
938161880 2:128992933-128992955 TCTAATTACTAGTTGTTTTATGG - Intergenic
939800890 2:146706565-146706587 CCTCACTAGCATTTTTTTTATGG - Intergenic
939935278 2:148284417-148284439 CCTCATTATCTGTTGTTTTGAGG - Intronic
941840982 2:170084219-170084241 CATAATTAGTAGTTGCTTTAGGG + Intergenic
946922290 2:224592442-224592464 CAATATTAGAAGTTGTTTTATGG + Intergenic
1169674368 20:8136683-8136705 GGTGATTAGCAGGTGTTCTATGG + Intronic
1173155665 20:40606490-40606512 CCAGCTTAGCAGTTGTGTAAGGG + Intergenic
1174675153 20:52346672-52346694 GCTGATTTGTAGTTGTATTAGGG + Intergenic
1175397703 20:58678345-58678367 TCTGATTAGAAACTGTTTTAAGG + Exonic
1176735547 21:10542888-10542910 CCTACTAAGCAGTTTTTTTATGG + Intronic
1177475774 21:21619933-21619955 CATAAATAACAGTTGTTTTATGG + Intergenic
1178090772 21:29160806-29160828 CCTGACTATCAGTGCTTTTATGG - Intronic
1182879164 22:33718603-33718625 CCTGATCCACAGTTATTTTATGG + Intronic
1183138860 22:35917000-35917022 CCTTTATAGAAGTTGTTTTATGG - Intronic
1183533610 22:38380544-38380566 CCTACTAAGCAGTTTTTTTATGG - Intronic
1185214755 22:49592187-49592209 TCTGATTGGCAGTTGGTTGAAGG - Intronic
957176936 3:76823880-76823902 CCTGATTAGCAGTTGTTTTATGG + Intronic
959697627 3:109265532-109265554 CCTGATTAGTTCTTTTTTTAAGG - Intergenic
960185772 3:114636608-114636630 GATGATTATAAGTTGTTTTATGG + Intronic
960823596 3:121759560-121759582 ACTGCTTAGAAGTTATTTTAAGG - Intergenic
961161212 3:124727986-124728008 TCTGATTATCATTTGTATTAGGG - Intergenic
961918426 3:130401056-130401078 CATGATGAGCAGTTGTGTTAAGG - Exonic
966801174 3:183765573-183765595 CATGATTAGCAGTTGAGATAAGG + Intronic
972338948 4:38134051-38134073 CCTGTTAAGGAGTTGTTTTGAGG + Intronic
977980774 4:103318896-103318918 CCTGATATGCACTTCTTTTAAGG + Intergenic
980437501 4:132797439-132797461 TCTGATTAGCACTTTTTTTCAGG - Intergenic
980707003 4:136511241-136511263 CCTAATTAGCCTTTGGTTTAAGG + Intergenic
982385883 4:154801833-154801855 CCTGATTAGGTGTTTTCTTAGGG - Intronic
982592476 4:157332329-157332351 ACTGATCTGCAGTGGTTTTAGGG - Intronic
985689876 5:1301448-1301470 CATTATTAGCAGTTGTTTTAGGG + Intergenic
986842117 5:11709708-11709730 CATCATTTGCACTTGTTTTAAGG - Intronic
988442932 5:31252432-31252454 TTTGATTAGCAATTGTTTAATGG - Intronic
990787184 5:59434779-59434801 CCTGATTAGCAGTTATTGTCTGG - Intronic
991112160 5:62913318-62913340 TCTTATTAGCAGCTGTCTTAAGG + Intergenic
993310698 5:86328542-86328564 CTTGATTGGGAGTTGTTTCATGG - Intergenic
996959756 5:129233318-129233340 CCAGATCACCAGTTGTTTTTGGG - Intergenic
999622219 5:153485166-153485188 CCTGATGGGCAGATGTTTTGAGG + Intergenic
1003760850 6:9177213-9177235 CCTAATTTGCAATTATTTTAGGG + Intergenic
1006787362 6:36677639-36677661 CCTCATTTGCAGATGGTTTATGG - Intronic
1010796966 6:80128244-80128266 CCTGATAATCTGTAGTTTTAAGG + Intronic
1012247147 6:96938520-96938542 CCTGATGACCAGTGGTATTAAGG + Intronic
1012538558 6:100330225-100330247 CCTGATTAGAACTTAATTTAAGG + Intergenic
1012591788 6:100990681-100990703 CCAGGTTTCCAGTTGTTTTATGG + Intergenic
1012954773 6:105557723-105557745 ACTGATCAGCAGTTGATTAAAGG - Intergenic
1013020048 6:106205574-106205596 CCTGTTTAGCATTTTTTTTCAGG - Intronic
1020402510 7:7794999-7795021 TCTGATTGGCAGTTGGTTGAAGG - Intronic
1021215895 7:17914797-17914819 CTTGATTGTTAGTTGTTTTATGG - Intronic
1021243822 7:18237238-18237260 CATGATTAGAAGTTATTTTTAGG + Intronic
1021439323 7:20660344-20660366 CCTGTTTTTCAGTTGTTTAAAGG + Intronic
1021762975 7:23919356-23919378 ACTGATTGGCAGTGGTTTTCTGG + Intergenic
1022819785 7:33948239-33948261 CATGATTAGCAGACCTTTTAGGG - Intronic
1023364411 7:39449370-39449392 CCTAACTAACAGTTGTTTGAAGG + Intronic
1029019887 7:97353549-97353571 CCTGACTTGCAGTTATTTAATGG + Intergenic
1031656985 7:124368355-124368377 CTTGAGGAGCAGTTCTTTTATGG - Intergenic
1033712535 7:143963325-143963347 CATGCTTAGGAGTTGTTTGAAGG - Intergenic
1034050949 7:147983984-147984006 CCTGCTAAGCAGTTTTTTTGTGG - Intronic
1039312761 8:36336741-36336763 CCTGCTTATCAATTCTTTTATGG - Intergenic
1039509746 8:38081528-38081550 TCTGATTTGCAATTGTTTAAGGG - Intergenic
1043010570 8:74877401-74877423 CCTGATTGGCAGTAGTTTATTGG - Intergenic
1043109186 8:76156921-76156943 CCTCATTAGAAGATATTTTATGG - Intergenic
1043185374 8:77141499-77141521 TGTGATTAGAAGTTGTTTTAAGG - Intergenic
1048560207 8:135527834-135527856 TCTTAATAGCAGTTGTTTTCTGG + Intronic
1050874378 9:10615799-10615821 CCTGAATATCAGTTGCTTTGAGG + Intergenic
1051369841 9:16348975-16348997 CCTGACTAACAGTTCTTTGAGGG + Intergenic
1055832752 9:80401531-80401553 CCTGAATGGCAGTTGGTTGAAGG - Intergenic
1056750174 9:89344704-89344726 CCTTCTTAGCAGTTGCTGTAGGG + Intronic
1057760541 9:97870397-97870419 CCTGATTTGCAATTGCTTTCTGG - Intergenic
1059898782 9:118898778-118898800 CCTTATTAGTAGTTGTTTTGGGG - Intergenic
1062641603 9:137521431-137521453 ACTGACTAGCAGGTGCTTTAAGG + Intronic
1188198589 X:27270972-27270994 CCTTATTATCACTGGTTTTATGG + Intergenic
1189851410 X:45180104-45180126 CCTCATCAGCATTTGTGTTAAGG + Intronic
1192838901 X:74833621-74833643 CTTGATTTCCAGTTGTTTTGTGG + Intronic
1194056534 X:89141347-89141369 ACTGATTAGCATATGTTTTATGG + Intergenic
1196008033 X:110856172-110856194 CTTGAATAGAAGTTGTTATAAGG - Intergenic
1198539447 X:137621186-137621208 CCTTATAAGCAGTAATTTTAAGG + Intergenic
1199039062 X:143089083-143089105 CAAGATTGGCAATTGTTTTAGGG + Intergenic
1200411278 Y:2864440-2864462 CTTTATTAGCAGTGGTTTGAGGG + Intronic