ID: 957177591

View in Genome Browser
Species Human (GRCh38)
Location 3:76831387-76831409
Sequence GCCTTAGCACATAAACAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 186}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957177591 Original CRISPR GCCTTAGCACATAAACAATA TGG Intronic
905590498 1:39159128-39159150 GCCTAAACGCATAAAAAATAGGG - Intronic
906170043 1:43717386-43717408 ACATGAGCAGATAAACAATATGG + Intronic
906592526 1:47039845-47039867 CACTTAGAACTTAAACAATAGGG + Intronic
909646763 1:77925187-77925209 GATTGAGGACATAAACAATACGG + Exonic
911272557 1:95820908-95820930 GCTTTTGCACAAAAACTATAAGG + Intergenic
911466662 1:98263090-98263112 GACTTAGCACAGAAAAAACATGG + Intergenic
912056092 1:105599627-105599649 GCATTTTTACATAAACAATAGGG + Intergenic
915958355 1:160242547-160242569 GCCTTACCACATTAACATAAGGG + Intronic
916603417 1:166316549-166316571 GCCTGAGCAGATAAACAAAGAGG - Intergenic
918951785 1:191149965-191149987 GCATTTTTACATAAACAATAGGG - Intergenic
921006341 1:211097125-211097147 ACCTTAGCATATAAAGAAAAGGG + Intronic
923973531 1:239233216-239233238 GCATTTCTACATAAACAATAGGG - Intergenic
1063003917 10:1950811-1950833 GCCATAGCACAAAAGCAAGATGG + Intergenic
1063273203 10:4535259-4535281 TCCTTATCACATACACTATAAGG - Intergenic
1064756920 10:18579832-18579854 GCATTTTTACATAAACAATAGGG + Intronic
1064828071 10:19428615-19428637 ACTTTAGCACCTAAACCATAAGG - Intronic
1066496798 10:35950062-35950084 GCATTAGCACATAGAGAAAAGGG - Intergenic
1066624440 10:37391936-37391958 GCATTAGCACATAGAGAAAAGGG - Intergenic
1066697050 10:38088269-38088291 TCCATTGTACATAAACAATATGG - Intergenic
1071926732 10:90417693-90417715 GCATTTTTACATAAACAATAGGG - Intergenic
1073200857 10:101734034-101734056 GCCTTAGAAAAGAAACAATAAGG - Intergenic
1074379008 10:112963189-112963211 GACTTAGCCCATGAACAACATGG + Intronic
1075563099 10:123482732-123482754 GCTTTAACAAATAAAAAATAAGG - Intergenic
1076089176 10:127665171-127665193 ACTTGAGTACATAAACAATATGG + Intergenic
1079286836 11:19141705-19141727 ACCTTAGCAGAAAACCAATACGG - Intronic
1080946605 11:36981256-36981278 TCATTATCACAAAAACAATATGG + Intergenic
1081529764 11:43950034-43950056 GCATTTTTACATAAACAATAAGG - Intergenic
1094614493 12:32023899-32023921 GCATTTTTACATAAACAATAGGG + Intergenic
1094745818 12:33343095-33343117 GCATTTTTACATAAACAATAGGG + Intergenic
1094772801 12:33684943-33684965 GCATTTTTACATAAACAATAGGG - Intergenic
1095768908 12:45928817-45928839 GCATTAGCACATACTCAAGAAGG - Exonic
1095828936 12:46562056-46562078 GCATTTTTACATAAACAATAGGG - Intergenic
1096904749 12:54925136-54925158 GCATTTTTACATAAACAATAAGG + Intergenic
1098486061 12:71023339-71023361 GCATTTTTACATAAACAATAGGG + Intergenic
1098700184 12:73614025-73614047 GCATTTTTACATAAACAATAGGG + Intergenic
1101147561 12:101855461-101855483 TCCTTAACACATACACAGTAAGG - Intergenic
1102031979 12:109744954-109744976 GCTATAGCACAGAAGCAATAGGG - Intronic
1103855528 12:123966987-123967009 GCCTTTGCCCTCAAACAATATGG + Intronic
1104309814 12:127644357-127644379 GCATTTTTACATAAACAATAGGG + Intergenic
1107341218 13:39408634-39408656 GCCATAGCAGTTCAACAATAAGG - Intronic
1108190567 13:47934234-47934256 GCATTTTTACATAAACAATAGGG + Intergenic
1108271663 13:48767033-48767055 GCATTTTTACATAAACAATAGGG + Intergenic
1108607234 13:52051962-52051984 GCATTTTTACATAAACAATAGGG - Intronic
1109296456 13:60537695-60537717 GCCTTAGCACAATTACACTATGG + Intronic
1109423164 13:62139505-62139527 GCATTTTTACATAAACAATAGGG - Intergenic
1109831195 13:67791224-67791246 TCCTTAGCACATGAGCAGTAAGG - Intergenic
1110605442 13:77426832-77426854 GCATTTTTACATAAACAATAGGG - Intergenic
1110644963 13:77871947-77871969 GCTTTAGGACATAAAGAAAAAGG + Intergenic
1110965159 13:81685541-81685563 GCATTTTCACATAAACAGTAGGG + Intergenic
1111896211 13:94144978-94145000 GCTTTTGCCCATAAGCAATAAGG - Intronic
1115491960 14:33966408-33966430 GCATTTTTACATAAACAATAGGG + Intronic
1115869115 14:37779866-37779888 GCCTTATCCCATTACCAATATGG + Intronic
1116481465 14:45396056-45396078 TCCTTAGCACATGGATAATAAGG + Intergenic
1117926873 14:60790376-60790398 GCATTTTTACATAAACAATAGGG - Intronic
1117962831 14:61179638-61179660 GGCTTAGAACATACATAATAGGG - Intergenic
1118027626 14:61785801-61785823 GCATTTTCACATAAGCAATAGGG + Intronic
1120309600 14:82812905-82812927 GTCTAAGTACATAAACATTATGG - Intergenic
1123883327 15:24696401-24696423 GCATTTTTACATAAACAATAGGG + Intergenic
1124045411 15:26145254-26145276 TCCTTAGCTCATAGACAGTAGGG + Intergenic
1125043762 15:35222680-35222702 GCATTTTTACATAAACAATAGGG + Intronic
1126667222 15:51086381-51086403 GCATTAGCCTATAAACAAAATGG - Intronic
1127153553 15:56104704-56104726 GCCTTAATACAGAAAGAATAAGG + Intronic
1131547541 15:93328526-93328548 GCATTATTACATAAAAAATAAGG - Intergenic
1139314176 16:66054225-66054247 GCATTTTTACATAAACAATAGGG - Intergenic
1141290886 16:82717226-82717248 GCCAAATCACATAAAAAATAAGG + Intronic
1143998261 17:11027927-11027949 GCCTAAGCACAAAAACAAAATGG + Intergenic
1145223153 17:21105689-21105711 GCATTTTCACATAAGCAATAGGG + Intergenic
1148999909 17:51746783-51746805 GCCTTAACACACTAAAAATAAGG + Intronic
1149406533 17:56357464-56357486 GCCTTTCCACATAACCAATATGG + Intronic
1150200380 17:63350069-63350091 GCTTTAGGAGAAAAACAATAAGG + Intronic
1155736919 18:29235665-29235687 GCCTTAACACATGCACAGTAAGG + Intergenic
1158768515 18:60485773-60485795 GCCTTCACACATAAAGATTATGG - Intergenic
1161911069 19:7194442-7194464 GCCTTATTACAAAATCAATATGG + Intronic
1166627244 19:44369607-44369629 GCATTACTACATAAACAATAGGG - Intronic
1168342609 19:55634232-55634254 GCGTTACCACCTAACCAATAGGG + Intergenic
925308111 2:2864503-2864525 GCATTTTTACATAAACAATAGGG - Intergenic
926979945 2:18558700-18558722 GCATTTTCACATAAACAATACGG - Intronic
931402020 2:61940194-61940216 GCCTTAGCCCACAAAATATAGGG - Intronic
932727556 2:74192642-74192664 GCATTTTTACATAAACAATAGGG + Intergenic
933613666 2:84462215-84462237 GCATTTTTACATAAACAATAGGG - Intergenic
934108238 2:88716118-88716140 GCATTTGTACATAAACAATAGGG - Intronic
936115741 2:109701577-109701599 GCATTTTTACATAAACAATAGGG + Intergenic
937011213 2:118564450-118564472 GCATTTTTACATAAACAATAGGG - Intergenic
938546254 2:132334946-132334968 GCATTATTACAGAAACAATAGGG + Intergenic
939304427 2:140392412-140392434 GCATTTTTACATAAACAATAGGG - Intronic
944715074 2:202369853-202369875 GCTCTAGCAGACAAACAATATGG - Intergenic
944722138 2:202434451-202434473 GCTTTAGCAGAAAAACACTAGGG + Intronic
946190123 2:218003536-218003558 GCCTTAACACAGAAGAAATAGGG + Intergenic
947655018 2:231819590-231819612 TGCTTAGCACATAATCCATAAGG + Intergenic
948005056 2:234601446-234601468 GCATTTTTACATAAACAATAAGG + Intergenic
1169117394 20:3074519-3074541 GCATTTTTACATAAACAATACGG + Intergenic
1169938026 20:10905663-10905685 GCCCTGCCACATAACCAATAAGG - Intergenic
1170684682 20:18558766-18558788 GCCTCAGCAAAGAAACAACAAGG - Intronic
1172496922 20:35394035-35394057 ACATTTGCACATAAACACTAAGG + Intronic
1172864198 20:38082782-38082804 CCATTAGCAAACAAACAATAAGG - Intronic
1177254663 21:18645413-18645435 GCATTTTTACATAAACAATAGGG + Intergenic
1179668364 21:42927975-42927997 GCATTTTTACATAAACAATAGGG + Intergenic
1179892307 21:44342265-44342287 GCATTTTTACATAAACAATAAGG + Intergenic
1182453927 22:30437753-30437775 GCATTTTTACATAAACAATAAGG + Intergenic
1182938721 22:34253343-34253365 GTCTTTGCACATAAATAACATGG + Intergenic
1184585325 22:45444046-45444068 GCATTTTCACATAAACAATAGGG + Intergenic
1184724136 22:46333332-46333354 GCATTTTCACATAAACAATAGGG - Intronic
950841961 3:15976313-15976335 GATTTAGCAAATAAAAAATATGG + Intergenic
951040790 3:17987011-17987033 GCCTTAAAACTTAAACAATTTGG - Intronic
951809250 3:26681451-26681473 GCCTGAGCTCATAGACATTATGG - Intronic
952776831 3:37054757-37054779 GCTTTGGCACTTAAACAATATGG - Intronic
953441131 3:42918498-42918520 TCCTTAACACATACACAGTAAGG - Intronic
955261142 3:57391614-57391636 CCCTTTGCACATCAACATTATGG + Intronic
957177591 3:76831387-76831409 GCCTTAGCACATAAACAATATGG + Intronic
957287611 3:78237102-78237124 GTTTTATCACATAAACAACAAGG + Intergenic
958186873 3:90132696-90132718 CCCTTAAGAAATAAACAATAAGG - Intergenic
960177946 3:114539463-114539485 ACCTTAGGACATAAGCAATGTGG + Intronic
960712810 3:120547760-120547782 GCATTTTCACATAAACAACAGGG + Intergenic
964336592 3:155661191-155661213 GCCTTAGCCAAAAATCAATAAGG - Intronic
965935684 3:174107709-174107731 GCCTCAGCTGAAAAACAATATGG - Intronic
966958228 3:184907279-184907301 GCATTTTTACATAAACAATAGGG + Intronic
969953212 4:10861857-10861879 GCCTTATCAATTAAAAAATAGGG - Intergenic
972222214 4:36968699-36968721 GCATTTTTACATAAACAATAGGG + Intergenic
974506765 4:62784570-62784592 GCATTAGCACATCAATAATTAGG - Intergenic
975329433 4:73097824-73097846 AACTTAGCACATGAAAAATATGG - Intronic
976026513 4:80693993-80694015 ATCTTTGCATATAAACAATAGGG - Intronic
976695916 4:87919528-87919550 GCATTTTTACATAAACAATAGGG - Intergenic
979015352 4:115424998-115425020 CCCTTAGCACATGTGCAATAAGG + Intergenic
980821088 4:138018820-138018842 CCCTTAACACATGCACAATAAGG + Intergenic
981039834 4:140212883-140212905 GCCTTTTTACCTAAACAATAGGG - Intergenic
982921063 4:161275908-161275930 TCCTAAGAACGTAAACAATAAGG + Intergenic
983178653 4:164622109-164622131 GCCTTGGCAGATAGACAATCTGG + Intergenic
983583721 4:169334402-169334424 GCATTTTCACCTAAACAATAGGG - Intergenic
983668081 4:170205028-170205050 GCTATAGCATACAAACAATATGG + Intergenic
983961610 4:173761556-173761578 GCTTTAGAACATAAATAATGTGG + Intergenic
986163660 5:5253435-5253457 GCATTTTTACATAAACAATAGGG + Intronic
991531218 5:67616943-67616965 TCCTTAACACAAAAACAAAAAGG - Intergenic
994798412 5:104336979-104337001 GCCTTAAAACATAAACAAAATGG + Intergenic
995105146 5:108369132-108369154 GCATTTTTACATAAACAATATGG - Intronic
995608922 5:113888892-113888914 GCCTTAGGACAGAGAAAATATGG - Intergenic
996115380 5:119612567-119612589 GCCTTAGCCCAGAAACATAAAGG - Intronic
996183811 5:120452035-120452057 ACTTTAGTACATAACCAATAAGG + Intergenic
996425086 5:123305333-123305355 GCCTTAGCAGATATTCAATAGGG + Intergenic
999450427 5:151673572-151673594 GCATTTTTACATAAACAATAGGG - Intronic
1001706686 5:173746197-173746219 GCATTTTTACATAAACAATAGGG - Intergenic
1004522433 6:16374751-16374773 GCCCCAGCACATAAATATTAGGG + Intronic
1005352765 6:24952875-24952897 GCGTTATCACATTAACTATATGG - Intronic
1005621633 6:27625825-27625847 GCATTTTTACATAAACAATAGGG + Intergenic
1005624340 6:27649213-27649235 GCATTTTTACATAAACAATAAGG - Intergenic
1005641119 6:27797357-27797379 GCATTTTTACATAAACAATAGGG - Intergenic
1007156339 6:39748326-39748348 GCATTTTTACATAAACAATAGGG + Intergenic
1007340350 6:41187381-41187403 GCATTTTTACATAAACAATAGGG + Intergenic
1008996176 6:57661971-57661993 GCCATAGCACATAAATAAATAGG - Intergenic
1010558517 6:77316686-77316708 GCAATAGCACATAAACATTCTGG + Intergenic
1010875010 6:81092025-81092047 GCACCAGTACATAAACAATAAGG - Intergenic
1011192085 6:84739757-84739779 GTCATACCACATACACAATATGG + Intronic
1013888115 6:114995925-114995947 GATTTAGCACATAAATTATACGG - Intergenic
1014930716 6:127332708-127332730 GCATTTTTACATAAACAATAGGG + Intronic
1015302330 6:131667884-131667906 CCCTTGGCACATAAAGAAGAAGG - Intronic
1017559320 6:155609996-155610018 CCCTTAACACATATGCAATAAGG - Intergenic
1023855019 7:44177633-44177655 GCTTTAGCAAATAAAAAATTAGG - Intronic
1024589843 7:50871823-50871845 GTATTTTCACATAAACAATAGGG + Intergenic
1025849247 7:65232381-65232403 GCATTTTTACATAAACAATAGGG + Intergenic
1027886302 7:83910163-83910185 GAATTACCACATTAACAATAGGG - Intergenic
1030385301 7:108860978-108861000 CCCTCAGCACATAATCTATATGG + Intergenic
1030467821 7:109924751-109924773 GCCTGAGTACATAAACAAAGCGG - Intergenic
1031176166 7:118353926-118353948 GCATTTCTACATAAACAATAAGG + Intergenic
1031197968 7:118640697-118640719 GCATTTTTACATAAACAATAGGG - Intergenic
1032801262 7:135318939-135318961 GCATTTTTACATAAACAATAGGG - Intergenic
1034724247 7:153320498-153320520 GCCTAATGACATAAACAAAAGGG - Intergenic
1035215659 7:157364636-157364658 GAATTAGCACACAAACAACAAGG - Intronic
1037762049 8:21748015-21748037 GCCTTATCACTTAAACACTGAGG + Intronic
1040913571 8:52545367-52545389 GCATTTTTACATAAACAATAGGG - Intronic
1043577348 8:81673252-81673274 GCATTTTTACATAAACAATAGGG - Intronic
1045448871 8:102299058-102299080 ACATAAGCACATAGACAATAGGG + Intronic
1047091866 8:121583934-121583956 GCATTTCTACATAAACAATAGGG - Intergenic
1047136086 8:122079910-122079932 GCATTTCTACATAAACAATAGGG + Intergenic
1049250318 8:141584954-141584976 GCATTTTTACATAAACAATAGGG - Intergenic
1051876220 9:21796612-21796634 GCATTTTTACATAAACAATAGGG + Intergenic
1053058894 9:35012977-35012999 GCATTTTTACATAAACAATAGGG + Intergenic
1053060585 9:35027990-35028012 GCATTTTTACATAAACAATAGGG + Intergenic
1053536413 9:38930935-38930957 TGCTTTGTACATAAACAATAGGG + Intergenic
1054629721 9:67433013-67433035 TGCTTTGTACATAAACAATAGGG - Intergenic
1055936692 9:81610707-81610729 CTCTTGGCACATAAACAGTAGGG - Intronic
1057977764 9:99624378-99624400 GGCTTAACATATAAACAGTATGG - Intergenic
1058275360 9:103035169-103035191 GAATAAGCACAGAAACAATAAGG - Intergenic
1188843623 X:35046342-35046364 AACTTAACACATAAACAAAAAGG - Intergenic
1188909103 X:35823632-35823654 GCATTTTTACATAAACAATAGGG - Intergenic
1189203322 X:39216508-39216530 GGATTAGCACATAAACATTTGGG - Intergenic
1189848933 X:45160043-45160065 TCCTTATCACAAGAACAATAAGG - Intronic
1192117073 X:68421806-68421828 GCCTTAGGATAAAAATAATATGG + Intronic
1194148672 X:90296247-90296269 GCCTTTGAACATTAAAAATATGG + Intergenic
1194485403 X:94479925-94479947 GCATTTATACATAAACAATAGGG - Intergenic
1195327279 X:103767986-103768008 GCATTTTTACATAAACAATAAGG + Intergenic
1196866370 X:120074760-120074782 GCCTGAGCAAATAAATAAAAAGG + Intronic
1196876728 X:120161521-120161543 GCCTGAGCAAATAAATAAAAAGG - Intronic
1197565339 X:128077286-128077308 GCATTTTTACATAAACAATAAGG + Intergenic
1197710053 X:129659551-129659573 ACCTTAGCACTTAAAAAATTAGG - Intergenic
1198160673 X:134004750-134004772 GTCTTAGCCTATAAGCAATAAGG + Intergenic
1199356917 X:146873484-146873506 GCATTTTTACATAAACAATATGG - Intergenic
1199398415 X:147367653-147367675 GCATTTTTACATAAACAATAGGG + Intergenic
1200495044 Y:3872979-3873001 GCCTTTGAACATTAAAAATATGG + Intergenic
1201523237 Y:14900998-14901020 ACCTTGGCACATAAACCATTGGG + Intergenic