ID: 957187347

View in Genome Browser
Species Human (GRCh38)
Location 3:76958935-76958957
Sequence CTGACCTAGGAGAAGTGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 187}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957187347_957187353 18 Left 957187347 3:76958935-76958957 CCCCACCACTTCTCCTAGGTCAG 0: 1
1: 0
2: 0
3: 15
4: 187
Right 957187353 3:76958976-76958998 TAACAACATTCACAGCTAATAGG 0: 1
1: 0
2: 2
3: 20
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957187347 Original CRISPR CTGACCTAGGAGAAGTGGTG GGG (reversed) Intronic
902007823 1:13246206-13246228 CTGGCTCAGGAGGAGTGGTGGGG + Intergenic
902015772 1:13306298-13306320 CTGGCTCAGGAGGAGTGGTGGGG + Intronic
902026801 1:13390001-13390023 CTGGCTCAGGAGGAGTGGTGGGG + Intronic
902488271 1:16762335-16762357 CTGAACTAGGAAAAGGGCTGTGG - Intronic
902902666 1:19530357-19530379 CTCACGTAGTAGAAGGGGTGAGG - Intergenic
903287318 1:22285313-22285335 CTGACCAAGGAGGGCTGGTGTGG - Intergenic
903671084 1:25035751-25035773 CTCACCCAGGAGAAGAGGTTAGG + Intergenic
904606534 1:31700959-31700981 CTGACTGAGCAGAAGTGTTGGGG + Intronic
904801016 1:33093036-33093058 CTGCCCCAGGAGAGTTGGTGAGG + Intronic
906520021 1:46461373-46461395 CTGACCCTGGAGAAGAGATGAGG + Intergenic
907486611 1:54782364-54782386 CTGACCTTGAGGAAGTGGTCAGG - Exonic
908574128 1:65441285-65441307 CTGATTTAGCAGAAGGGGTGGGG + Intronic
910023632 1:82623137-82623159 CTGACTTTGGGTAAGTGGTGAGG + Intergenic
910468577 1:87526156-87526178 CTAACCTGTGAGAAGTGATGGGG - Intergenic
911690770 1:100831636-100831658 CCTACCTAGGAGAATTGTTGTGG + Intergenic
912331731 1:108826382-108826404 CTGCCCTGGGAGAAGAGGTGGGG - Intronic
912946859 1:114092666-114092688 GTGACCTAGGAGAACTGGGGAGG - Intronic
913181435 1:116326189-116326211 CTGTCCTGGGAGAGGTGGTGGGG + Intergenic
915448758 1:155990129-155990151 CTGACTTTGGGGAAGTGGTCAGG + Intronic
915571351 1:156746933-156746955 CACACCCAGGAGAAGGGGTGGGG + Intronic
916485660 1:165256222-165256244 CTGCCCTAGGTGAGGTGTTGGGG + Intronic
918487737 1:185046301-185046323 CTTACCCAGGAGGAGTCGTGGGG + Intronic
918682550 1:187373088-187373110 CTGACATAGGAGAGATGGTCAGG + Intergenic
921076921 1:211707331-211707353 CTGACTTGGGGTAAGTGGTGGGG + Intergenic
923532171 1:234820178-234820200 CTGAACTAGGAAAAGGGCTGTGG + Intergenic
923965992 1:239139879-239139901 CTGCCCTTGGAGAGCTGGTGTGG - Intergenic
1068499039 10:57819829-57819851 CTGAAGAAGGAGGAGTGGTGGGG + Intergenic
1072303059 10:94080379-94080401 CTTAGCTAGGAGAAGGGGTGTGG - Intronic
1074709591 10:116166425-116166447 TAGACCCAGGAGCAGTGGTGTGG - Intronic
1077418520 11:2437106-2437128 CTGTCTTAGGAGAAGGGATGGGG + Intergenic
1079717895 11:23771330-23771352 CTAACCTTGGGTAAGTGGTGGGG - Intergenic
1080668060 11:34353341-34353363 CTCACCTATGGGAAGTGATGGGG + Intronic
1080777280 11:35397739-35397761 CTGACCTGGTGGAAGGGGTGAGG - Intronic
1081620466 11:44616287-44616309 CTGACCGAGGAGATCAGGTGTGG + Intronic
1082034388 11:47633023-47633045 ATGCCCTTGGAGAAGGGGTGAGG - Intronic
1085267161 11:75243734-75243756 CTGACCTTGGAGTACTGATGGGG + Intergenic
1085974360 11:81634885-81634907 CTGACTTTGGGTAAGTGGTGGGG + Intergenic
1087012424 11:93526620-93526642 CTGACCTTGGAGATGTGAGGAGG - Intronic
1087267372 11:96075647-96075669 CTGAGCTAGGGGAAGTCGGGTGG + Intronic
1090391468 11:126391532-126391554 GTTAGGTAGGAGAAGTGGTGAGG - Intronic
1091380478 12:54991-55013 GTGTCCTGGGAGAAGGGGTGAGG + Intergenic
1091498812 12:995335-995357 CTGACCAAGGTGAAATGGGGAGG + Intronic
1091599295 12:1908383-1908405 CTGGCCTGCGAGAAGTGGAGGGG - Intronic
1092281852 12:7103480-7103502 CTGCACTAAGAGCAGTGGTGAGG + Intronic
1093163162 12:15773027-15773049 CTGATGTAGGAGAAGTGAAGAGG + Intronic
1095570231 12:43675749-43675771 CTGACCTTGGTGAAGTTCTGGGG - Intergenic
1097316095 12:58172930-58172952 CTGCCCTAGGAGAACCAGTGGGG - Intergenic
1097915728 12:65018575-65018597 CTGGCCTGGGAAAAGGGGTGAGG + Intergenic
1100006004 12:89896385-89896407 CTGCCTTAGGAGATGTGGTGTGG - Intergenic
1100289899 12:93203811-93203833 CTGAGGTTGGAGAAGTGGTATGG - Intergenic
1100318176 12:93464989-93465011 CTGCCCTGGGAGGAGTGGTTTGG - Intergenic
1101762727 12:107672100-107672122 CTGAAGTGGGAGAAGTGGGGAGG + Intergenic
1101856598 12:108448745-108448767 CTGACTTTGGGTAAGTGGTGGGG - Intergenic
1103023943 12:117558465-117558487 CTGCCCTAGGGGCAGGGGTGAGG - Intronic
1105433698 13:20359753-20359775 CTGACCAAGGTGGGGTGGTGGGG - Intergenic
1105778236 13:23682379-23682401 CTAACTTTGGATAAGTGGTGGGG + Intergenic
1105931936 13:25060703-25060725 CTGACATGGAAGAAGAGGTGAGG + Intergenic
1106205167 13:27586400-27586422 CTGAGCTGGGAGAAGAGGGGTGG - Intronic
1108106367 13:47014794-47014816 CTGACCTCAGGGAAGTGGTGTGG - Intergenic
1108315479 13:49232880-49232902 CTGATCAGGGAGTAGTGGTGTGG + Intergenic
1111756320 13:92400112-92400134 CTGGAGTAGGAGAATTGGTGTGG + Intronic
1112436570 13:99394870-99394892 CTGACGTCGGAGAAGGGGTTAGG - Intergenic
1117498555 14:56329870-56329892 CTGCCCTAGCAGAAGGGGTATGG + Intergenic
1121240970 14:92429916-92429938 CTGACCTGGGAGAGTTGTTGGGG - Intronic
1121462798 14:94094890-94094912 CTGACTTTGGGTAAGTGGTGGGG + Intronic
1122174357 14:99906122-99906144 CTGACTTTGGGTAAGTGGTGGGG - Intronic
1125516032 15:40321919-40321941 CTGACCTAGGAGCAGGGTGGAGG + Intergenic
1126726462 15:51637084-51637106 CTGACTTTGGGTAAGTGGTGGGG - Intergenic
1129797255 15:78387227-78387249 CAGACCTAGGAGAAGTGGGAAGG + Intergenic
1130515758 15:84624694-84624716 CTGATCCTGGAGAAGTGGAGGGG - Intronic
1133287953 16:4699251-4699273 CTGAGCCTGGGGAAGTGGTGGGG - Intronic
1133440926 16:5820377-5820399 ATGACATTGGAGAAGAGGTGGGG + Intergenic
1133854686 16:9538646-9538668 CTGACCTTAGAGAAGCTGTGTGG + Intergenic
1133906929 16:10031033-10031055 CTGAACTCGGGAAAGTGGTGTGG + Intronic
1137590358 16:49689724-49689746 CTGACCTTGGTAAAGTTGTGTGG - Intronic
1137914292 16:52412045-52412067 CTACCCTAGAAGAAGTGGGGAGG - Intergenic
1140289835 16:73642920-73642942 CTGACCTTCGAGGAATGGTGGGG + Intergenic
1142806477 17:2373592-2373614 CTGACCTCTGGGAACTGGTGGGG + Intronic
1143016806 17:3895198-3895220 GGCACCTAGGAGAAGTGGTTGGG + Intergenic
1144617286 17:16788217-16788239 CTGACCCAGAGGAAGTGGGGGGG + Intronic
1146492188 17:33291403-33291425 CTCACGGAGGAGAAGTTGTGCGG + Exonic
1149421085 17:56511224-56511246 CTGACATGGGAGAGGCGGTGGGG - Intronic
1149602821 17:57904235-57904257 CTCACCTAGGAGACGCGGTGGGG - Intronic
1150633214 17:66894972-66894994 CCTACCTAAGAGAAGTGCTGGGG - Intergenic
1150800520 17:68278531-68278553 CTGACGTAGGAGAATTGCAGAGG - Intronic
1150835188 17:68557469-68557491 CTGACATGGCAGAAGGGGTGAGG - Intronic
1152510144 17:80781188-80781210 CTGAGCTAGGAGGAAGGGTGAGG + Intronic
1153987695 18:10368059-10368081 CTGACCTTGGACAAGTCATGTGG - Intergenic
1158570992 18:58596917-58596939 CTGAGGTAGGAGAACTGGTTGGG - Intronic
1160831897 19:1108154-1108176 CTCCCCTAGGAGCAGCGGTGGGG - Exonic
1162535938 19:11262704-11262726 CTACCCTAGGAGAAGGGCTGGGG + Intergenic
1164279800 19:23759366-23759388 CAGGCCTGGGAGAGGTGGTGGGG + Intergenic
1167436187 19:49480253-49480275 GTGACCAAGGAGAAGGGCTGGGG - Intronic
1167732255 19:51266975-51266997 CTGACCTGGGGCAAGTGATGAGG + Intronic
1202702926 1_KI270713v1_random:1905-1927 CTGAACTAGGAAAAGGGCTGTGG + Intergenic
925787764 2:7449446-7449468 CTGACACAGGAGAAGTCCTGGGG - Intergenic
931053077 2:58436174-58436196 TAGACCTAAGAGATGTGGTGAGG + Intergenic
934144407 2:89077490-89077512 CTGCCTTCGGAAAAGTGGTGGGG + Intergenic
934224844 2:90123059-90123081 CTGCCTTCGGAAAAGTGGTGGGG - Intergenic
937717898 2:125055809-125055831 CTGACCCTGGTGAAATGGTGAGG - Intergenic
937888796 2:126919316-126919338 CTGACCTCTGGGTAGTGGTGTGG - Intergenic
944005761 2:194903302-194903324 CTCACTTAGCAGAAGGGGTGAGG - Intergenic
944890130 2:204108919-204108941 CTGACCTAGTGGAAGTGGGAGGG + Intergenic
946515022 2:220402457-220402479 CTGACCTAGTAGAAGCTCTGTGG - Intergenic
946748885 2:222872757-222872779 CTGATCTAGGAGAAGGGGGATGG + Intronic
948806527 2:240455615-240455637 TTGAGCTGAGAGAAGTGGTGGGG + Intronic
948873144 2:240813622-240813644 CTGGCTTAGGTGAAGGGGTGGGG - Intronic
948898871 2:240946042-240946064 GTGACCTAGGGGAGGTGGGGAGG - Intronic
948961699 2:241344021-241344043 CTCACATCGCAGAAGTGGTGTGG + Intronic
1171242305 20:23581752-23581774 CTGCTCTGGTAGAAGTGGTGGGG + Intergenic
1174972502 20:55292170-55292192 TTGACTCAGGTGAAGTGGTGTGG - Intergenic
1177571065 21:22887893-22887915 CTGACTCAGTAGAAGTGTTGGGG - Intergenic
1178817279 21:35943195-35943217 CAGACCCAGGAGAGGTGGGGAGG - Intronic
1181358416 22:22316463-22316485 CTGACCTAGTAGAGGTTCTGTGG + Intergenic
1181988968 22:26822242-26822264 CTAACCTAGAACAAGTTGTGGGG - Intergenic
1182892516 22:33830853-33830875 CTCACGTAGAAGAAGAGGTGAGG + Intronic
1183113334 22:35669404-35669426 CCGACCTTGGGCAAGTGGTGGGG + Intergenic
950173785 3:10857261-10857283 CTCACATTGGAGGAGTGGTGTGG + Intronic
950401947 3:12775685-12775707 CTGAACTGAGAGAAGTGGTGAGG - Intergenic
952226063 3:31377427-31377449 GTGACCCCAGAGAAGTGGTGGGG - Intergenic
952773452 3:37022517-37022539 GTGATTTGGGAGAAGTGGTGAGG + Intronic
953718358 3:45334652-45334674 CTTACAAAGAAGAAGTGGTGAGG - Intergenic
954913433 3:54128617-54128639 CTGACAGAGGAGATGTGCTGGGG - Intronic
957187347 3:76958935-76958957 CTGACCTAGGAGAAGTGGTGGGG - Intronic
957659517 3:83129485-83129507 CTTACCTATGAGCAATGGTGGGG - Intergenic
957863941 3:85998043-85998065 CTGACTTAGAAGGAGAGGTGAGG + Intronic
958555718 3:95673555-95673577 CTGAGCTATGGGTAGTGGTGGGG + Intergenic
960351776 3:116602621-116602643 CTGATCTAAGAGAAGAGCTGTGG - Intronic
964330334 3:155595014-155595036 CAGAGCTTGGAGAAGTGGAGAGG + Intronic
964883151 3:161446535-161446557 CTGACCTAGCAGAAACGTTGAGG + Intergenic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
966927281 3:184652982-184653004 ATAACCTAGGAGGAGAGGTGAGG + Intronic
969611461 4:8229693-8229715 CTGCCCAAGGAGGAGTGGGGGGG + Intronic
969896417 4:10309242-10309264 CTGACCTAGGAGAAGACTGGAGG + Intergenic
970192594 4:13530002-13530024 CTTACCCTGGTGAAGTGGTGGGG + Intergenic
973293606 4:48491912-48491934 GTGACCTAGCAGAAGTGGAAAGG + Intronic
974075371 4:57164010-57164032 TTGACCAAGGAGAAGTGCAGAGG + Intergenic
974804787 4:66864591-66864613 CTGAATTAGGAGAAGAGATGTGG + Intergenic
975246510 4:72126974-72126996 CATACCTAGGAGTAGTTGTGGGG + Intronic
976124242 4:81816444-81816466 AAGACCTCGGAGAAGGGGTGAGG + Intronic
976439469 4:85056586-85056608 ATGACAGAGGAGAAGTGGTTAGG - Intergenic
978493137 4:109330533-109330555 CTCACATAGTAGAAGAGGTGGGG + Intergenic
978908648 4:114039748-114039770 ATGCCCCAGCAGAAGTGGTGTGG + Intergenic
983320024 4:166184733-166184755 CTGACATAGTAGAAGAGGTGAGG - Intergenic
983784510 4:171715257-171715279 CTGACCTTGGAGCAGGGTTGGGG + Intergenic
984464664 4:180083088-180083110 CTGAGATAGGAGAATGGGTGTGG + Intergenic
984993207 4:185401992-185402014 CAGAGCTAGGCGAAGAGGTGAGG - Intronic
985875395 5:2590708-2590730 CTGACCCAGGAGGGGTGGTCTGG + Intergenic
986741742 5:10710892-10710914 CTGAGCCAGGGGAAGTGGTGAGG + Intronic
987719574 5:21616625-21616647 CTGACATAGGGGAAGTCTTGTGG + Intergenic
991368424 5:65893108-65893130 CTTACCTTGGGGAAATGGTGAGG + Intergenic
992496273 5:77297326-77297348 CTACACTAGGAGTAGTGGTGAGG - Intronic
995895459 5:117005749-117005771 CTGACTTTGGATAAGTGGTGGGG - Intergenic
996423763 5:123290786-123290808 CTGCCCCAGGAGGAGGGGTGGGG - Intergenic
996481434 5:123979980-123980002 CTGGCCTAGGAGAAAAGTTGAGG + Intergenic
998983029 5:147725571-147725593 CTGACTTTGGGTAAGTGGTGGGG + Intronic
999060328 5:148626965-148626987 GTGACCTTGGAGAAGAAGTGTGG - Intronic
999653414 5:153789663-153789685 CTTACCTAGGATCAGAGGTGTGG - Intronic
1001783404 5:174390689-174390711 TTATCCTAGGAGAAGTGGGGTGG - Intergenic
1002198543 5:177514059-177514081 CTGACCCAGGAGAAGGGGGAAGG - Intronic
1007247247 6:40471471-40471493 CTGCCCTGGGAGAGGTGGTGTGG + Intronic
1009434060 6:63598180-63598202 CTGACCTAGGAGACTTAGAGGGG + Intergenic
1011839834 6:91483535-91483557 GTGGCCTAGGAGAGGGGGTGAGG + Intergenic
1012997219 6:105985872-105985894 TGGACCTAGGTGAAGTGCTGGGG - Intergenic
1013796557 6:113895421-113895443 CAGATCTTGGAGAAGTTGTGGGG + Intergenic
1017133256 6:151126243-151126265 GTGACGTAGGGCAAGTGGTGGGG + Intergenic
1018129695 6:160717251-160717273 CAGACCTAGTAGAAATGATGTGG + Intronic
1019423625 7:963104-963126 CTGAGCTGGCAGGAGTGGTGGGG + Intronic
1021098923 7:16565818-16565840 CTGAACTATGAGCAATGGTGTGG + Intronic
1023790489 7:43749836-43749858 CTGATCTAGGAGAGGGGTTGGGG - Intergenic
1023862601 7:44225265-44225287 CTGCCCTTGCAGAAGTGGAGGGG - Intronic
1026404671 7:70052643-70052665 CTGAACTGGGAGTAGAGGTGAGG + Intronic
1026429132 7:70326296-70326318 CTGCCTTGGGAGAAGTGGAGAGG - Intronic
1026777142 7:73237602-73237624 CTGAACAAGCAGAAGGGGTGAGG - Intergenic
1027017988 7:74790974-74790996 CTGAACAAGCAGAAGGGGTGAGG - Intergenic
1027070036 7:75154953-75154975 CTGAACAAGCAGAAGGGGTGAGG + Intergenic
1029313980 7:99694608-99694630 CTGACCTAGAAAAGGTGGCGGGG + Intronic
1039252375 8:35680960-35680982 CTGACCTAGGAGGAGAGTGGAGG + Intronic
1039986030 8:42448686-42448708 ATCACCCAGGGGAAGTGGTGGGG + Intronic
1040098903 8:43479418-43479440 CTGACCTAGGTGAATCAGTGTGG + Intergenic
1041893803 8:62901313-62901335 CTGAACTGGGAGCAGTGGTGTGG + Intronic
1042964162 8:74333255-74333277 TCCACCTAGGAGAAGTAGTGGGG + Intronic
1045568985 8:103350496-103350518 CTCACCTTGGAGAAATGTTGGGG - Intergenic
1046232000 8:111370224-111370246 CTGACTTAGGAGCTGGGGTGAGG - Intergenic
1048779354 8:137984694-137984716 CTGATCTGGGAATAGTGGTGTGG - Intergenic
1050229770 9:3509917-3509939 CTTACCTATAAGAAGTGGGGAGG + Intronic
1056731494 9:89169971-89169993 CTGACCTGGCAGGAGGGGTGAGG - Intronic
1059334218 9:113558550-113558572 CTGAGCTGGGAGCAGTGGAGGGG + Intronic
1060396759 9:123321700-123321722 GTGACCGAGGAGATGTTGTGGGG - Intergenic
1061899124 9:133664010-133664032 GAGACCTAGGAGCAGAGGTGGGG + Exonic
1186343968 X:8672220-8672242 CTGACCTCAGAGGAGTGGTGTGG - Intronic
1187801009 X:23062742-23062764 CTGACATAGGGGAAGTGCAGTGG - Intergenic
1189695058 X:43655000-43655022 CTGACCGTGGAGAAGGGCTGCGG + Intronic
1189843349 X:45106010-45106032 CAGACCTAGGGGAAGGGGCGGGG - Intronic
1190886137 X:54532045-54532067 CTACCCTGGGAGAGGTGGTGGGG - Intronic
1191823360 X:65337171-65337193 CTGACTTTGGGTAAGTGGTGGGG - Intergenic
1192714560 X:73625928-73625950 CTGACTTTGGGTAAGTGGTGGGG - Intronic
1194987648 X:100508019-100508041 CAGACCTAGGAGTACGGGTGGGG + Intergenic
1194996958 X:100601686-100601708 GTGACTTGGGAGAAATGGTGGGG - Intergenic
1197089905 X:122523831-122523853 CAGCCCTGGGAGAAGTGGTCAGG - Intergenic
1198632250 X:138653676-138653698 CTGACCTAAGAGCAGTGCAGAGG + Intronic
1201626270 Y:16018132-16018154 CTCACATAGTAGAAGGGGTGAGG + Intergenic
1202101166 Y:21309513-21309535 CTTATCTGGGAGTAGTGGTGTGG - Intergenic