ID: 957189638

View in Genome Browser
Species Human (GRCh38)
Location 3:76990784-76990806
Sequence ATGCATATCAAGAGGCAAAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 833
Summary {0: 1, 1: 5, 2: 56, 3: 198, 4: 573}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957189632_957189638 16 Left 957189632 3:76990745-76990767 CCTGATGAGATCTCAGGAGTTGG 0: 7
1: 132
2: 290
3: 302
4: 341
Right 957189638 3:76990784-76990806 ATGCATATCAAGAGGCAAAACGG 0: 1
1: 5
2: 56
3: 198
4: 573

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957189638 Original CRISPR ATGCATATCAAGAGGCAAAA CGG Intronic
900812981 1:4822015-4822037 ATGCACACTAAGAGGCAAAATGG + Intergenic
900813140 1:4823426-4823448 ATGCACACTAAGAGGCAAAATGG - Intergenic
901366686 1:8757791-8757813 ATCCATATAAGGACGCAAAATGG + Intronic
902975058 1:20082442-20082464 ATGTGCATGAAGAGGCAAAATGG - Intronic
903147581 1:21384980-21385002 ATGCCCACTAAGAGGCAAAATGG - Intergenic
905904743 1:41610507-41610529 ATGCCTTTCAAGAGGCTCAATGG - Intronic
907079471 1:51608145-51608167 ATGCACACTAAGAGGCAAAATGG - Intronic
907229008 1:52977629-52977651 ATGCATCTCCAGAGGCAAATTGG + Intronic
907253038 1:53155901-53155923 ATGCTCACTAAGAGGCAAAATGG + Intergenic
909084334 1:71153917-71153939 ACGTACATTAAGAGGCAAAATGG + Intergenic
909200859 1:72688512-72688534 ATGCACATTAAGAGGCAAAATGG - Intergenic
909350084 1:74641894-74641916 AATCATATGAAGAGGCACAAGGG + Intronic
909407019 1:75302793-75302815 ATGGCTAGCAAGTGGCAAAAGGG + Intronic
909436853 1:75652028-75652050 ATGCTTATTAAGAGGCAAAATGG + Intergenic
909713101 1:78674253-78674275 ATGCTCATTAAGAGGCAAAATGG - Intergenic
910024107 1:82628376-82628398 ATGCGCATTAAGAGGCAAAATGG - Intergenic
910126859 1:83852029-83852051 TTCCATATCAAGAGGCAGCATGG + Intergenic
910802583 1:91160691-91160713 GTGCGCATTAAGAGGCAAAATGG - Intergenic
911645824 1:100336401-100336423 ATGCACTTTAAGAGGCAAAATGG + Intergenic
911749571 1:101480991-101481013 AAGCACATTAAGAGACAAAATGG + Intergenic
911829016 1:102526510-102526532 ATGCATGTCCAGAGGAAGAATGG + Intergenic
911947893 1:104135718-104135740 GTGCACATTAAGAGGCAAAATGG + Intergenic
911960455 1:104295845-104295867 ATGCTCATTAAGAGACAAAATGG + Intergenic
912187212 1:107292618-107292640 ATGCTCACTAAGAGGCAAAATGG + Intronic
912993114 1:114509158-114509180 TTTCATATCAAGAGGATAAAAGG - Intronic
915265334 1:154712681-154712703 ATTCCTATCAAGAGGCAATGAGG + Intronic
915641705 1:157232570-157232592 ATGTGCATTAAGAGGCAAAATGG - Intergenic
916013257 1:160725740-160725762 ATGCGTACTAAAAGGCAAAATGG + Intergenic
916650794 1:166832581-166832603 ATGTACATTAAGAGGCAAAATGG + Intergenic
916816863 1:168362621-168362643 ATGTGCATTAAGAGGCAAAATGG + Intergenic
917310312 1:173671351-173671373 ATACACATTAAGAGTCAAAATGG + Intergenic
917543380 1:175937018-175937040 ATGCGTATTAAGAGACAAAATGG + Intergenic
918008438 1:180563767-180563789 ATGAGCACCAAGAGGCAAAATGG - Intergenic
918036987 1:180883285-180883307 ATGCATATCAAGTGAGAACATGG - Intronic
918773535 1:188596750-188596772 ATGCAAAGCAAAAAGCAAAAAGG + Intergenic
918804893 1:189026948-189026970 AAGCATATCAAAATGCAAATAGG + Intergenic
919168891 1:193929004-193929026 ATGCACACTAAGAGGCAAAATGG - Intergenic
920149980 1:203898102-203898124 ACGTATATTAAGAGGCAATAAGG + Intergenic
920597012 1:207282109-207282131 ATCCAGATAAAGAGGAAAAATGG + Intergenic
920832032 1:209474153-209474175 ATGTACAGTAAGAGGCAAAATGG + Intergenic
920879151 1:209864181-209864203 ATGCACATTACAAGGCAAAATGG - Intergenic
921133804 1:212242492-212242514 CAGCATATCATGAGACAAAAAGG + Intergenic
922630045 1:227097668-227097690 ATGCACACTAAGAGGCAAAATGG + Intronic
922687638 1:227657256-227657278 ATGCATAATAAAAGGCAAAGGGG - Exonic
922875349 1:228936064-228936086 ATGCGCACTAAGAGGCAAAATGG + Intergenic
923003465 1:230026614-230026636 ATGCACACCAAGAGGAAAAATGG + Intergenic
923383638 1:233445980-233446002 ATGCACGCTAAGAGGCAAAATGG + Intergenic
923384109 1:233449501-233449523 ATGCCCATTAAGAGGCAAAATGG + Intergenic
923965509 1:239134432-239134454 ATGCACACTAAGAGGCAAAACGG + Intergenic
924144301 1:241058168-241058190 ATGTGCATTAAGAGGCAAAATGG + Intronic
1063624151 10:7673772-7673794 ATGCAAAGCAAGGGGCAAGAAGG - Intergenic
1063908136 10:10801676-10801698 AAGCATATTACAAGGCAAAAAGG + Intergenic
1064404948 10:15053387-15053409 ATGCGCACTAAGAGGCAAAATGG + Intronic
1064605418 10:17033972-17033994 ATGCATTCCAAGAGGAAGAATGG - Intronic
1065075002 10:22069246-22069268 ATCAATAGCAAAAGGCAAAATGG - Intergenic
1065209710 10:23390840-23390862 ATGCCCACTAAGAGGCAAAATGG - Intergenic
1065216599 10:23455198-23455220 ATGCACACTAAGAGGCAAAATGG + Intergenic
1065534899 10:26707247-26707269 ATGCACACTAAGAGGCAAAATGG - Intronic
1065640396 10:27776446-27776468 ATGCACACTAAGAGGCAAAATGG - Intergenic
1066083156 10:31952364-31952386 ATGCACATTAAGAGGCAAAATGG - Intergenic
1066289361 10:33999694-33999716 ATGCGCACTAAGAGGCAAAATGG - Intergenic
1067512240 10:46905745-46905767 ATGCACATTAACGGGCAAAATGG + Intergenic
1067650004 10:48146077-48146099 ATGCACATTAACGGGCAAAATGG - Intergenic
1068182858 10:53545190-53545212 ATGCATATTAAAAGACAAAATGG - Intergenic
1068243963 10:54340936-54340958 ATGCACGTTAAGAGGCAAAATGG - Intronic
1068427093 10:56880682-56880704 ATGCACACTAAGAGGTAAAATGG + Intergenic
1068438403 10:57019773-57019795 ATGCACACTAAGAGGCAAAATGG + Intergenic
1068600818 10:58954583-58954605 ATGCACATTAAGAGGTAAAATGG + Intergenic
1068665881 10:59675611-59675633 ATGCTCACTAAGAGGCAAAATGG + Intronic
1068758222 10:60679484-60679506 ATGCACACTAGGAGGCAAAATGG + Intronic
1069107227 10:64397735-64397757 ACGCACATTAAGAGGCAAAACGG - Intergenic
1069118337 10:64536103-64536125 ATGCACATTAAGAGACAAAATGG - Intergenic
1069174363 10:65271720-65271742 ATGCACACTAAGAGGCAAAATGG - Intergenic
1069235960 10:66073513-66073535 ATGAAAATCAAGAGGATAAATGG - Intronic
1069734906 10:70647697-70647719 ATGTGCATCAAGAGACAAAATGG - Intergenic
1069935527 10:71913140-71913162 ATGCGCACTAAGAGGCAAAATGG - Intergenic
1070468173 10:76746764-76746786 ACACATACCAAGAGGGAAAAAGG + Intergenic
1070847341 10:79534114-79534136 ATGCACACTAAGAGGCAAAATGG - Intergenic
1070926455 10:80226178-80226200 ATGCACACTAAGAGGCAAAATGG + Intergenic
1071781862 10:88855126-88855148 ATGCACATTAAGAGGCAGAATGG - Intergenic
1072356600 10:94617704-94617726 ATGCACATTAACAGGCAAAACGG - Intergenic
1072520027 10:96223078-96223100 ATGCGCATTAAGAGGCAAAATGG + Intronic
1072531243 10:96321505-96321527 ATGCACATTAAGAGACAAAATGG - Intronic
1073360063 10:102891090-102891112 ATGCACATTAAGAGGCAAAATGG - Intronic
1073748693 10:106499401-106499423 ATGCACACTAAGAGGCAAAATGG + Intergenic
1073849563 10:107599070-107599092 ATGTGCATTAAGAGGCAAAATGG + Intergenic
1074563901 10:114559206-114559228 TTGCATAGCAAGAGGAAAATGGG + Intronic
1075197410 10:120372549-120372571 ATACATACCAAGAGGCCAACTGG + Intergenic
1075240212 10:120771597-120771619 ATGTACACTAAGAGGCAAAATGG + Intergenic
1075548567 10:123375142-123375164 ATAAATATCAAGAGGGAAAAGGG - Intergenic
1076002128 10:126920687-126920709 TTGCAGGCCAAGAGGCAAAATGG + Intronic
1076163606 10:128265041-128265063 ATGCAGGTCAACAGGAAAAAGGG - Intergenic
1076429823 10:130393949-130393971 GTGCACATTGAGAGGCAAAATGG + Intergenic
1076537923 10:131194776-131194798 TTGCAAATCAACAGGCGAAATGG - Intronic
1077794118 11:5472841-5472863 ATGCATTTCAAGAAGTCAAAGGG + Intronic
1078216969 11:9319785-9319807 ATGCACACTAAGAAGCAAAATGG - Intergenic
1078890579 11:15553278-15553300 ATGCAAATCAGGAGGAAAAAAGG - Intergenic
1079234594 11:18679096-18679118 ATGCACATTAAGAGGCAAAATGG + Intergenic
1079387082 11:19990033-19990055 ATTCACATTAAGAGGAAAAAGGG + Intronic
1079405943 11:20145837-20145859 ATGTGCATTAAGAGGCAAAATGG - Intergenic
1079575986 11:22003570-22003592 ATGCAGTTTAAGAGGCAAAATGG + Intergenic
1079589728 11:22167535-22167557 ATGCACGTTAAGAGACAAAATGG - Intergenic
1079681722 11:23305133-23305155 ATGCACATCAAGAGGCCAAATGG - Intergenic
1079682809 11:23320120-23320142 ATGCACATTACGAGGCAAAATGG + Intergenic
1079894566 11:26102610-26102632 ATGCACATTAAGAGATAAAATGG - Intergenic
1080147981 11:29011408-29011430 ATATATATCAAAAGGTAAAATGG - Intergenic
1080952342 11:37049515-37049537 ATGCACACTAAGAGGCAAAATGG + Intergenic
1081159065 11:39731640-39731662 ATGCACATTAAGAGACAAAATGG - Intergenic
1081305059 11:41501813-41501835 ATGCACACTGAGAGGCAAAATGG - Intergenic
1081636361 11:44725103-44725125 ATACATTTAAAGAGGAAAAACGG - Intergenic
1082135067 11:48538818-48538840 ATACATATCTAAATGCAAAAAGG - Intergenic
1082739115 11:56890731-56890753 ATGCAAAGCAGGAGGCAAATGGG + Intergenic
1082861782 11:57863854-57863876 ATGCATGCTAAGAGGTAAAATGG + Intergenic
1083100716 11:60302902-60302924 CTATATATCATGAGGCAAAATGG + Intronic
1083482104 11:62955862-62955884 GTGCGCATTAAGAGGCAAAATGG + Intronic
1083738753 11:64696635-64696657 ATGGACATCACGAGGAAAAATGG + Intronic
1085446730 11:76605700-76605722 ATGCACACTGAGAGGCAAAATGG + Intergenic
1085622741 11:78049779-78049801 ATGCATACTAAGAGGCAAAATGG - Intronic
1085686723 11:78630091-78630113 ATGAATATCCAGGGGCAAGAAGG - Intergenic
1086009207 11:82078454-82078476 ATGCACACTGAGAGGCAAAAGGG + Intergenic
1086203726 11:84234000-84234022 ATACACATTAAGAGGCAAAGTGG + Intronic
1086349607 11:85932442-85932464 ATGTACATTGAGAGGCAAAATGG - Intergenic
1086615093 11:88807124-88807146 ATGCAGATATAGAGGTAAAAAGG - Intronic
1087375174 11:97330649-97330671 ATACATATCAAAAAGCAAAAAGG - Intergenic
1087571321 11:99930285-99930307 ATGCACAGTAAGAGACAAAATGG - Intronic
1088242061 11:107783066-107783088 ATGCACACTAAGATGCAAAATGG - Intergenic
1088253576 11:107882365-107882387 ATGCGCACTAAGAGGCAAAATGG + Intronic
1088555559 11:111057204-111057226 GTGCACACTAAGAGGCAAAATGG + Intergenic
1089055694 11:115583051-115583073 ATGCGCACCAAGAGGCAAAATGG - Intergenic
1089686945 11:120157179-120157201 ATGCATCTCCAGAGGCAAATTGG + Intronic
1090244972 11:125209745-125209767 AAACAAATAAAGAGGCAAAAGGG + Intronic
1090430754 11:126644448-126644470 GTGCATTTCAAGATGCAAATGGG + Intronic
1090652506 11:128819780-128819802 CTGCATCTCAAAAGGCACAAGGG - Intergenic
1090731125 11:129574148-129574170 ATGCAGATCAAGAGAGAAACTGG + Intergenic
1091099414 11:132856610-132856632 ATGCACACTATGAGGCAAAATGG + Intronic
1092575165 12:9774821-9774843 ATGCACACTAAGTGGCAAAATGG - Intergenic
1093007589 12:14067466-14067488 ATGCACACTAAGAGGCAAAATGG + Intergenic
1093421985 12:18984161-18984183 ATGCACACTAAGAGGCAAAATGG - Intergenic
1093832671 12:23783621-23783643 TTGCAAATAAAGAAGCAAAAAGG + Intronic
1093872461 12:24308099-24308121 ATGCCTATTAAGAGGCAAAATGG + Intergenic
1094192051 12:27708008-27708030 GTGCACATTAAGAAGCAAAATGG + Intergenic
1094401872 12:30070352-30070374 ATGCACATTATGAGACAAAATGG - Intergenic
1094475185 12:30835319-30835341 ATGCAAATTAAGAGACAAAATGG + Intergenic
1095304996 12:40628245-40628267 ATGCACATTAAGAGACACAATGG - Intergenic
1095584711 12:43836845-43836867 ATGCTTATCAGGAACCAAAAAGG + Intronic
1096131191 12:49160228-49160250 ATGCACATTAAGAGGCAAAATGG - Intergenic
1096456190 12:51789052-51789074 ATGCAAATCATGAGGCCACAGGG - Intronic
1096796925 12:54083588-54083610 ATGCACATGAAGAGGCTAATGGG + Intergenic
1097134191 12:56837705-56837727 ATGCACCCTAAGAGGCAAAATGG - Intergenic
1097493726 12:60301498-60301520 ATGTGCATTAAGAGGCAAAATGG + Intergenic
1097906191 12:64921918-64921940 ATGCGTGTTAAGAGACAAAATGG - Intergenic
1098437769 12:70486194-70486216 ATGTACATTAAGAGGCAAAATGG + Intergenic
1098846151 12:75538254-75538276 ATGCACACTAAGAGGCAAAATGG + Intergenic
1099175113 12:79412360-79412382 ATGCAAACTAAGAGGCAAGATGG - Intronic
1099191203 12:79563750-79563772 ATGCAAATCAAGAAGAAAAAAGG + Intergenic
1099450744 12:82803570-82803592 ATGCGCATTAAGAGACAAAATGG + Intronic
1099718603 12:86331485-86331507 ATGCACACTAAGAGGCAGAATGG - Intronic
1100128284 12:91457249-91457271 ATGCCTGCCAAGAGGAAAAATGG - Intergenic
1100135840 12:91552339-91552361 ATGCGCACTAAGAGGCAAAATGG - Intergenic
1100758365 12:97777289-97777311 ATGTACACTAAGAGGCAAAATGG + Intergenic
1101296779 12:103432203-103432225 ATGCTTACTAAGAGGCAAAATGG - Intronic
1101516839 12:105444143-105444165 ATGCGCACTAAGAGGCAAAATGG + Intergenic
1102905272 12:116669846-116669868 ATGTGCATTAAGAGGCAAAATGG - Intergenic
1103093672 12:118116071-118116093 ATGTGCATGAAGAGGCAAAATGG - Intronic
1103817222 12:123668393-123668415 ATACATAGTAAGAGGCAAGATGG - Intergenic
1104284483 12:127412265-127412287 ATGCACACTAGGAGGCAAAATGG - Intergenic
1105729163 13:23194311-23194333 ACACATAGCAAGAGGCATAAAGG - Intronic
1106385873 13:29285406-29285428 ATTCATCAGAAGAGGCAAAAAGG - Intronic
1106587120 13:31067218-31067240 ATGCATTTCATGAGGAAGAAAGG - Intergenic
1107122871 13:36814396-36814418 ATGCACACTAAGAGACAAAATGG + Intergenic
1107684732 13:42885681-42885703 ATGTACATTAAGGGGCAAAATGG - Intergenic
1107790344 13:43995677-43995699 ATGCGCATTAAGAGGTAAAATGG - Intergenic
1108293789 13:48991018-48991040 AAGCAGATGAAGAGGGAAAAGGG + Intronic
1108483005 13:50894379-50894401 ATGCACACTAAGAGGCAAAATGG + Intergenic
1108718440 13:53105398-53105420 ATGCACATTAAGAGGCAAAATGG - Intergenic
1108789652 13:53952256-53952278 ATGTATTTCTAGAGGAAAAATGG - Intergenic
1108920820 13:55672166-55672188 ATGCACACTAAGAGGCAAAATGG + Intergenic
1109331943 13:60941451-60941473 ATGCACATTAAGAGACAAAATGG + Intergenic
1109515414 13:63437572-63437594 ATGCACACTAGGAGGCAAAATGG - Intergenic
1109661122 13:65461993-65462015 ATGTGTATTAAGAGGCAGAATGG - Intergenic
1109796459 13:67320107-67320129 CTGCAAATCAAGAGGGAAAATGG - Intergenic
1109848154 13:68024489-68024511 ATGCACACTAAGAGGCAACATGG - Intergenic
1110979120 13:81873227-81873249 TTGCACACTAAGAGGCAAAATGG + Intergenic
1111127883 13:83935620-83935642 ATGCAAACTAAGAGGCAAAATGG + Intergenic
1111135446 13:84036526-84036548 ATGCAAACTACGAGGCAAAATGG - Intergenic
1111150803 13:84251758-84251780 ATGCTCATTAAGAGGCAAAATGG + Intergenic
1111151074 13:84254151-84254173 ATGCTCATTAAGAGGCAAAATGG + Intergenic
1111344168 13:86926716-86926738 ATGTGCATTAAGAGGCAAAATGG - Intergenic
1111532026 13:89550013-89550035 ACGAATATGAAGAGGCAAGAGGG + Intergenic
1111729879 13:92060444-92060466 TAGATTATCAAGAGGCAAAAAGG - Intronic
1111867296 13:93785091-93785113 ATTCATTTCAAGAAGAAAAAGGG + Intronic
1111934662 13:94546797-94546819 ATGCGCACTAAGAGGCAAAATGG + Intergenic
1112150329 13:96753211-96753233 ATGTATATAAAAAGGCAACAAGG - Intronic
1112871213 13:103973110-103973132 ATGCACACTAAGAGACAAAATGG - Intergenic
1113198758 13:107840492-107840514 TTGCATTTCAGGTGGCAAAATGG + Intronic
1113980979 13:114275501-114275523 AAGCACATCAAAAGCCAAAATGG - Intergenic
1114426640 14:22629394-22629416 ATGCATATTAAGAGACAAAATGG + Intergenic
1114564680 14:23621659-23621681 ATGCACATCAAGAGGTAAAATGG + Intergenic
1114878230 14:26750505-26750527 ATGTGCACCAAGAGGCAAAATGG + Intergenic
1115239385 14:31239946-31239968 ATGCACACTAAGAGGCAAAATGG - Intergenic
1115284597 14:31703419-31703441 ACACACATTAAGAGGCAAAATGG - Intronic
1115335497 14:32240990-32241012 ATGCACACAAAGAGGTAAAATGG - Intergenic
1115926588 14:38442411-38442433 ATACGGAACAAGAGGCAAAAGGG + Intergenic
1116145129 14:41056954-41056976 ATGTTTGTCAAGAGGAAAAATGG - Intergenic
1116229779 14:42201823-42201845 ATGCGCATTAAGAAGCAAAATGG + Intergenic
1116836566 14:49774121-49774143 ATGCATATGAACAGCTAAAAGGG + Intronic
1117178470 14:53169078-53169100 ATGTACACTAAGAGGCAAAATGG - Intergenic
1117727743 14:58691188-58691210 ATGCAGACTAAGAGGCAAAATGG - Intergenic
1117838671 14:59834140-59834162 ATGAATATCCAAATGCAAAAAGG + Intronic
1118422940 14:65627713-65627735 ACGCGTACTAAGAGGCAAAATGG - Intronic
1119064808 14:71514412-71514434 ATGTGCATTAAGAGGCAAAATGG - Intronic
1120208609 14:81612476-81612498 ATGCAGATTAAGAGGGAAAATGG + Intergenic
1120376073 14:83708859-83708881 ATACACACTAAGAGGCAAAATGG + Intergenic
1120652800 14:87154969-87154991 ATGTGCATTAAGAGGCAAAATGG + Intergenic
1122144544 14:99681789-99681811 ATGCACACTAAGAGGCAAAATGG + Intergenic
1123497099 15:20838250-20838272 ATGCATATTAAGAAGAAAACTGG + Intronic
1123590578 15:21849205-21849227 ATGCATATTAAGAAGAAAACTGG + Intergenic
1123825131 15:24073601-24073623 ATGTGCATTAAGAGGCAAAATGG - Intergenic
1124841783 15:33248943-33248965 ATGTACATTAAGAAGCAAAATGG + Intergenic
1125041099 15:35188248-35188270 ATGCACACTAAGAGGCAAAATGG + Intergenic
1125105008 15:35960639-35960661 TAGCATATAAAAAGGCAAAATGG - Intergenic
1126260453 15:46683345-46683367 ATGCACACTAAGAGGCAAAATGG + Intergenic
1126301552 15:47202362-47202384 AGACACATTAAGAGGCAAAATGG + Intronic
1126553447 15:49959653-49959675 TTTCATATTAAGAGGCATAATGG + Intronic
1127355956 15:58200148-58200170 ATGCATATGAAGAAACAAACAGG + Intronic
1127575164 15:60284836-60284858 ATGCACATTCAGAGGCAAAATGG - Intergenic
1127946942 15:63764881-63764903 ATGCACATTAAGAGGCAAAATGG + Intronic
1128324808 15:66717399-66717421 ATGCATATAAAGCGGCCAAGTGG - Intronic
1128822331 15:70670174-70670196 ATGCGCACTAAGAGGCAAAATGG + Intronic
1128939042 15:71771983-71772005 ATGCATCTCCAGAGGCATATTGG + Intronic
1130747545 15:86672152-86672174 ATTAATATCAAAGGGCAAAATGG + Intronic
1130763504 15:86846109-86846131 ATCCACATGAAGAGACAAAAAGG - Intronic
1131010016 15:89009463-89009485 ATGCACATTAAGAGACAAAATGG + Intergenic
1132020646 15:98359040-98359062 ATGCACAGGAAGAAGCAAAATGG + Intergenic
1132166911 15:99602449-99602471 ATGCGCATTAAGAGGCAAAATGG - Intronic
1202962680 15_KI270727v1_random:139082-139104 ATGCATATTAAGAAGAAAACTGG + Intergenic
1132716244 16:1291515-1291537 AGGCACACTAAGAGGCAAAATGG - Intergenic
1133560333 16:6944716-6944738 ATGTATGTCAAGGGGCAGAAAGG - Intronic
1134077682 16:11303523-11303545 ATGCATACTAAGAGGCAGAATGG + Intronic
1134606814 16:15577863-15577885 ATGCACATTAAGAGGCAAAATGG - Intronic
1134851633 16:17483589-17483611 ATGCACACTAAGAGGCAAAATGG + Intergenic
1134886113 16:17793214-17793236 ATGCAAAAGAAGAGGCAAACAGG + Intergenic
1134897196 16:17898813-17898835 AACCATATCAAGAGATAAAAAGG + Intergenic
1134976540 16:18575044-18575066 ATTCACACCAAGAGGAAAAAGGG + Intergenic
1135236559 16:20761795-20761817 ATGCGTACTAAGAGGCAAAATGG + Intronic
1135477951 16:22794339-22794361 ATGCATATCCTGAGGCTCAAAGG - Intergenic
1135528614 16:23233275-23233297 ATGCTCATTAACAGGCAAAATGG - Intergenic
1135789025 16:25376462-25376484 ATGCACACTAAGAGGCAAAATGG - Intergenic
1136184007 16:28574441-28574463 ATGCACATTAAGAGACCAAATGG - Intronic
1138261756 16:55628671-55628693 ATGCACACTAAGAGGCAAAATGG + Intergenic
1138261818 16:55629208-55629230 ATGCACAGTAAGAGACAAAATGG + Intergenic
1138465696 16:57187985-57188007 ATGCATATATATATGCAAAAGGG - Intronic
1138988631 16:62362814-62362836 ATGCGTACTAAGAGGCAAAATGG - Intergenic
1139151202 16:64383574-64383596 AGGGATATTAAGAGGTAAAATGG + Intergenic
1139894653 16:70278825-70278847 TTGCTGATCAAGAGGCAATATGG + Intronic
1141217234 16:82035942-82035964 ATAAATATTAATAGGCAAAATGG + Intronic
1141724568 16:85778809-85778831 ATTCATATAAAAAGGAAAAAAGG + Exonic
1142594788 17:1024242-1024264 GTGCATAGCAACAGGCAAGACGG - Intronic
1144408000 17:14971603-14971625 ATGCTCACTAAGAGGCAAAATGG - Intergenic
1146823754 17:36006007-36006029 ATGCGCGTCAAGAGGCAAAATGG + Intergenic
1147633237 17:41946186-41946208 ATGCACATTAAGAGACAAAATGG - Intronic
1149023525 17:51998008-51998030 ATGGCTATCAAGTGGCAAACTGG + Intronic
1149100931 17:52905805-52905827 ATGCTTATTTAGAAGCAAAAAGG - Intergenic
1150334348 17:64319757-64319779 ATGCGCACCAAGAGGCAAAATGG - Exonic
1151125989 17:71845406-71845428 GAGCAAATCAGGAGGCAAAATGG - Intergenic
1153015236 18:577115-577137 ATGCGCATTAAGAGACAAAATGG - Intergenic
1153101539 18:1476060-1476082 ATGCGCACTAAGAGGCAAAATGG - Intergenic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1153745760 18:8178026-8178048 ATGCACACTAAGAGGCAAAGTGG - Intronic
1154044721 18:10894149-10894171 ATGTGCATTAAGAGGCAAAATGG + Intronic
1154112921 18:11585792-11585814 ATGCGCACTAAGAGGCAAAATGG + Intergenic
1154150571 18:11903276-11903298 ATACACATCAGGAGACAAAATGG + Intronic
1154455121 18:14514671-14514693 ATGCATATTAAGAAGAAAACTGG + Intronic
1155850364 18:30767024-30767046 ATACTCATTAAGAGGCAAAATGG - Intergenic
1155902810 18:31411771-31411793 ATGCTCATCAAGGGGAAAAAAGG + Intronic
1155999543 18:32369804-32369826 ATCCATATCCAGAGGGAAAATGG - Intronic
1156634230 18:39008557-39008579 ATGCACAGCACGAGGCAAAATGG - Intergenic
1156684088 18:39623245-39623267 ATGCACAGTAAAAGGCAAAATGG + Intergenic
1156792559 18:40993615-40993637 ATGCATATAAAATGGCAACATGG - Intergenic
1156832547 18:41511739-41511761 ATAAATACCAAGAGGCAGAATGG - Intergenic
1157707255 18:49817930-49817952 ATGCTCACTAAGAGGCAAAATGG - Intronic
1157973017 18:52292812-52292834 ATGCACACTAAGAGGCAAAATGG - Intergenic
1158451327 18:57568289-57568311 ATGCATACTAAGAGGTAGAAAGG + Intronic
1158595027 18:58808435-58808457 ATGCGCATTAAGAAGCAAAACGG - Intergenic
1159054871 18:63453532-63453554 ATGCACACGAAGAGGCAAAATGG - Intergenic
1159144984 18:64442568-64442590 ATGCACGTTAAGAGGCAAAATGG - Intergenic
1159745751 18:72232668-72232690 AAGTGTATTAAGAGGCAAAATGG - Intergenic
1164612263 19:29640558-29640580 ACGCACATTAAGAGGCAAAATGG - Intergenic
1164863835 19:31587315-31587337 ATGCCCACTAAGAGGCAAAATGG - Intergenic
1166498120 19:43320008-43320030 ATGTGCATTAAGAGGCAAAATGG + Intergenic
1167192114 19:47998477-47998499 ATGCGCATTAAGAGACAAAATGG + Intronic
1168517787 19:57022906-57022928 ATGCCCATGAAGAGACAAAATGG + Intergenic
925553023 2:5096541-5096563 ATGCGCACTAAGAGGCAAAATGG - Intergenic
925582353 2:5424280-5424302 ATGCATATATAGAAGCCAAAGGG + Intergenic
925751958 2:7096932-7096954 ATGCGCACTAAGAGGCAAAATGG - Intergenic
925806341 2:7653565-7653587 ATGCACACTAAGAGGCAAAATGG + Intergenic
925965935 2:9066070-9066092 ATGCACATCAAGTGAAAAAATGG - Intergenic
926273068 2:11381972-11381994 ATGCTTACCAAGAGGCCAAGAGG - Intergenic
926439670 2:12874797-12874819 ATGCGCACTAAGAGGCAAAATGG - Intergenic
926565127 2:14460337-14460359 ATGCATATCAAGAGAGTTAAAGG + Intergenic
926637302 2:15195764-15195786 ATGTACACTAAGAGGCAAAATGG + Intronic
926828256 2:16931465-16931487 ATGCACACTAAGAGGCAAAACGG - Intergenic
927412457 2:22842959-22842981 ATGCAAATAAAGACGCATAAGGG + Intergenic
929009242 2:37424721-37424743 ATGCGCATTAAGAGGCAAAATGG - Intergenic
929077100 2:38086883-38086905 ATGCATATTTAGAGGTAAAGGGG + Intronic
929747467 2:44673585-44673607 TTGCTTATCAAAAGGCAAAGAGG + Intronic
930591018 2:53326415-53326437 ATGCACATTAACAGGCTAAATGG + Intergenic
930898664 2:56476753-56476775 ATGCACACCGAGAAGCAAAATGG + Intergenic
931114387 2:59148691-59148713 ATGTGCATTAAGAGGCAAAATGG + Intergenic
931272781 2:60717417-60717439 ATGCTCATTAAGAGACAAAATGG - Intergenic
931278342 2:60764365-60764387 ATGCAGATTAAGGGGCAGAAAGG - Intronic
931884989 2:66607519-66607541 ATGCGCATTAAGAGGCAAAATGG + Intergenic
932005541 2:67923624-67923646 ATGCACACTAAGAGGCAAAATGG + Intergenic
932827604 2:74956229-74956251 ATGCACACTAAGAGGCAAAATGG - Intergenic
932920173 2:75904537-75904559 GAGCAAATCAATAGGCAAAAAGG + Intergenic
933064853 2:77780318-77780340 ATGTGCATTAAGAGGCAAAATGG - Intergenic
933069152 2:77835986-77836008 ATGGATACTAAGAGGAAAAATGG + Intergenic
933241543 2:79926886-79926908 ATGCATATCAAGATAGAAATAGG + Intronic
933369464 2:81396786-81396808 ATGCACATTAAAAGGAAAAATGG + Intergenic
933515186 2:83291379-83291401 ATGTACATTAAAAGGCAAAATGG - Intergenic
933936422 2:87207518-87207540 ATGCAGACTAAGAGGCAAGATGG - Intergenic
934887466 2:98037602-98037624 ATGCTTATAAAGAAGGAAAAAGG + Intergenic
934887702 2:98039328-98039350 ATGCATACTAAGAGGCAAAATGG + Intergenic
935021582 2:99237545-99237567 ATGCACATCAGTAGGTAAAATGG + Intronic
935300076 2:101686321-101686343 ATGCACATTAAGAGACAAAATGG - Intergenic
935489542 2:103699363-103699385 AGGCAGAAGAAGAGGCAAAAAGG + Intergenic
935827867 2:106969405-106969427 ATGCGCATTAAGAGGCAAAATGG - Intergenic
935957399 2:108391081-108391103 ATGCACATTAAGAGACAAAATGG + Intergenic
936035152 2:109105214-109105236 ATGTGCATTAAGAGGCAAAACGG + Intergenic
936356727 2:111758311-111758333 ATGCAGACTAAGAGGCAAGATGG + Intergenic
936837749 2:116728176-116728198 ATGTACACTAAGAGGCAAAATGG + Intergenic
937135340 2:119546807-119546829 ATGTACATGAAAAGGCAAAAAGG - Intronic
937340970 2:121090308-121090330 ATGCACATTAAGAGACAAAATGG - Intergenic
938729700 2:134137136-134137158 AAGCATACCAAGAGGAAAACAGG - Intronic
938749250 2:134313120-134313142 ATTCATATTAAGAAGCGAAAGGG - Intronic
938835336 2:135097177-135097199 ATGCTTACTAAGAGACAAAAGGG - Intronic
939131214 2:138237693-138237715 ATGCACACTAAGAGGCAAAAAGG + Intergenic
939160477 2:138582901-138582923 ATGCACATTAAGAAGCAAAATGG - Intergenic
939207705 2:139128873-139128895 ATGCACACTAAGAGGCAAAATGG - Intergenic
939454100 2:142410725-142410747 ATGCACATTAAGAGACAAAATGG + Intergenic
939497642 2:142942990-142943012 ATGTACATTAAGAGGCAAAATGG - Intronic
939577111 2:143909127-143909149 ATGCACACTAAGAGGCAAAATGG + Intergenic
940117576 2:150225844-150225866 ATGCATATTAAGAGACAAAATGG - Intergenic
940398403 2:153220388-153220410 ATGTGCATTAAGAGGCAAAATGG + Intergenic
940566153 2:155363563-155363585 ATGCGCATTTAGAGGCAAAATGG + Intergenic
940782931 2:157952538-157952560 ATGCACACTAAGAGGCAAAATGG + Intronic
940857641 2:158741982-158742004 ATGCGCATTAAGAGGCAAAATGG + Intergenic
941112520 2:161430777-161430799 ATGCATATCACAACTCAAAAAGG - Intronic
941421477 2:165287427-165287449 ATGCACATTAAGAGGCAAAATGG - Intronic
941685079 2:168439973-168439995 ATGCCGATTAAGAGGCAAAATGG - Intergenic
942113118 2:172701801-172701823 AAGCATTTCTAGAGGTAAAAAGG - Intergenic
942375396 2:175331367-175331389 TTGCAGATCAAGAGGTTAAAGGG - Intergenic
942575628 2:177360725-177360747 ATGGAGAGCAAGAGGCAAAGGGG - Intronic
943068959 2:183119046-183119068 ATGCATATTAAGAGGCAAAATGG - Intronic
943403734 2:187452771-187452793 ATGCATATCCAGAATTAAAAAGG - Intergenic
943496899 2:188631412-188631434 ATGTACACTAAGAGGCAAAATGG + Intergenic
943499898 2:188674660-188674682 ATGCACACTAAGAGGCAAAACGG + Intergenic
943750281 2:191503314-191503336 ATGCACGTTAAGAGGCAAAATGG + Intergenic
944914472 2:204344040-204344062 GTGCACATTAAGAGGCAGAATGG + Intergenic
945300903 2:208215568-208215590 TTGCACACTAAGAGGCAAAATGG - Intergenic
945342556 2:208674330-208674352 ATGTGCATTAAGAGGCAAAATGG - Intronic
945555603 2:211271540-211271562 ATGTGCATTAAGAGGCAAAATGG - Intergenic
945838235 2:214857709-214857731 ATGTGCACCAAGAGGCAAAATGG + Intergenic
946099864 2:217310852-217310874 AAGCATTTCTGGAGGCAAAAGGG + Intronic
946132309 2:217616217-217616239 ATGGATTTCCAAAGGCAAAAAGG - Intronic
946660646 2:221995528-221995550 ATGCAAATCAAAAACCAAAATGG - Intergenic
947156938 2:227172105-227172127 ATGCACATTAAGAGGCAAAATGG - Intronic
948230673 2:236346864-236346886 ATGTGCATTAAGAGGCAAAACGG + Intronic
948306915 2:236955152-236955174 ATGCGCCTTAAGAGGCAAAATGG + Intergenic
1169429315 20:5522352-5522374 ATGCCTACTAAGAGGCAAAATGG + Intergenic
1169519934 20:6360074-6360096 ATGCACATTAAGAGACAAAATGG + Intergenic
1169708741 20:8537362-8537384 ATGTACATTAAGAGGCAAAATGG - Intronic
1170497423 20:16939794-16939816 ATGCACATTAAGAGGCAAAATGG + Intergenic
1170734067 20:18998539-18998561 ATGCACACTAAGAGGCAAAATGG + Intergenic
1171450337 20:25231377-25231399 ATGAATATCTAAAGGCAGAATGG + Intergenic
1171450851 20:25235268-25235290 ATGAATATCTAAAGGCAGAATGG + Intergenic
1173490831 20:43479848-43479870 ATGTGCATTAAGAGGCAAAATGG - Intergenic
1174013141 20:47466997-47467019 ATGGGAATTAAGAGGCAAAATGG - Intergenic
1174108012 20:48176755-48176777 AGGCAAATGAAGAGGCACAAAGG - Intergenic
1174108121 20:48177483-48177505 AGGCAAATGAAGAGGCACAAAGG + Intergenic
1175634649 20:60570208-60570230 ATGAATGTTTAGAGGCAAAAAGG - Intergenic
1175734125 20:61373377-61373399 ATGCAGAACAAGTGGCTAAAGGG - Intronic
1176819047 21:13638607-13638629 ATGCATATTAAGAAGAAAACTGG - Intronic
1176985618 21:15432188-15432210 TTGCATGAGAAGAGGCAAAAGGG - Intergenic
1177149685 21:17443025-17443047 AGGCAGATTAATAGGCAAAATGG + Intronic
1177547557 21:22578748-22578770 ATGCACACGAAGAGGCAAAATGG + Intergenic
1177712151 21:24791341-24791363 ATTCATATGAAGTGGTAAAATGG - Intergenic
1177730546 21:25023230-25023252 ATGCACATTAAGAGGAAAAATGG - Intergenic
1177939056 21:27386218-27386240 ATGCACATTAAGAGGCAAAATGG - Intergenic
1178117107 21:29428688-29428710 ATGCACATTAAGCGACAAAATGG - Intronic
1178524751 21:33318186-33318208 ATGCACATTAAGAGACAAAACGG + Intergenic
1179254864 21:39706887-39706909 ATGCACAATAAGAGGAAAAATGG - Intergenic
1181448901 22:23002876-23002898 ATGCATGTTAAGAGTAAAAATGG + Intergenic
1181495090 22:23283212-23283234 ATGCAGACCAAGATGCAGAAAGG + Intronic
1183137128 22:35899682-35899704 ATTCACATTAAGAGACAAAAAGG + Intronic
949396242 3:3617255-3617277 ATGCACACTAAGAGGCAAAATGG + Intergenic
949642219 3:6049467-6049489 ATGCACATTAAGAGGCAAAATGG - Intergenic
949988137 3:9555344-9555366 ATGCGTCTCAAGAAGCCAAATGG - Intergenic
950628114 3:14263354-14263376 ATGTGCATTAAGAGGCAAAACGG - Intergenic
950907858 3:16555303-16555325 ATGCACACTAAGAGGCAAAATGG + Intergenic
951138379 3:19130991-19131013 ATGCACATTAAGAGACAAAATGG + Intergenic
951155010 3:19341246-19341268 ATGCACACTAAGAGGCAAAATGG - Intronic
951250766 3:20391806-20391828 ATGCGCATTAAGAGACAAAATGG - Intergenic
951766680 3:26207171-26207193 TTTCATATCAAGACACAAAATGG - Intergenic
953194498 3:40719848-40719870 ATGCGCACTAAGAGGCAAAATGG + Intergenic
953506512 3:43490993-43491015 ATGCATATTAAGAGGCAGAATGG + Intronic
953790036 3:45940379-45940401 ACGCACACTAAGAGGCAAAATGG + Intronic
954190270 3:48954743-48954765 CTCCATATCAAGGGCCAAAAAGG - Intronic
954476992 3:50756271-50756293 ATGCACATTATGAGGCAAAATGG - Intronic
954504072 3:51051809-51051831 ACTCATGTCAGGAGGCAAAATGG + Intronic
954605194 3:51904154-51904176 ATGAATATAAAGAAGAAAAAAGG + Intergenic
955548678 3:60059251-60059273 ATGCGCATTAAGAGACAAAATGG + Intronic
955773100 3:62405760-62405782 ACACATTTAAAGAGGCAAAAGGG + Intronic
956948467 3:74252412-74252434 AGGCAGATTAAGAGGAAAAAAGG + Intergenic
957189638 3:76990784-76990806 ATGCATATCAAGAGGCAAAACGG + Intronic
957279921 3:78137267-78137289 GTGCACATTAAGAGGCAAAATGG - Intergenic
957315411 3:78570027-78570049 ATGCGCACTAAGAGGCAAAAGGG - Intergenic
957387500 3:79516094-79516116 ATGCATATGAAGAAAAAAAAAGG + Intronic
957424893 3:80024890-80024912 ATGCATATAAACAACCAAAAAGG - Intergenic
957655247 3:83065759-83065781 ATGCATATTAAGTAACAAAAAGG + Intergenic
957687190 3:83516631-83516653 ATGCACATTAAGAGGCAAAATGG + Intergenic
957847267 3:85754167-85754189 GTGCACATTAAGAGACAAAATGG - Intronic
958151230 3:89697092-89697114 ATGCATATTAAGAGGCAAAATGG + Intergenic
958492710 3:94797762-94797784 ATGTGCATTAAGAGGCAAAAAGG - Intergenic
958603716 3:96331713-96331735 ATACACATTAAGAGACAAAATGG + Intergenic
959053881 3:101550407-101550429 ATGCACATTAAGAGACAAAATGG + Intergenic
959194830 3:103166828-103166850 ATGCACTTTAAGAGGCAAAATGG + Intergenic
959260741 3:104076779-104076801 ATGCACAAGAAGAGGTAAAATGG + Intergenic
959294762 3:104521528-104521550 ATGCACATTAAGAAGCAAAATGG - Intergenic
959403963 3:105938085-105938107 ATGGATATACAGAGACAAAATGG - Intergenic
959800662 3:110491252-110491274 ATGCTTTTCAAGATGAAAAAAGG - Intergenic
959969745 3:112396291-112396313 ATGCATGTCAAGAAGTAGAAGGG - Intergenic
960319757 3:116220325-116220347 ATGCAAATGACAAGGCAAAATGG - Intronic
961353324 3:126317478-126317500 ATACACACTAAGAGGCAAAATGG + Intergenic
962059753 3:131913318-131913340 ATGCATATTAAGAGCCAAAATGG + Intronic
962209309 3:133463633-133463655 ATGCACACTAAAAGGCAAAATGG - Intronic
962294068 3:134164641-134164663 ATGCTTATCAACAGGTAAATGGG - Intronic
962658523 3:137575196-137575218 TTGGATATCAATATGCAAAAAGG - Intergenic
963432424 3:145225813-145225835 ATGCCTATCAACAGGTAAATGGG - Intergenic
963584217 3:147163902-147163924 ATGCACATTAAGAGACAAAATGG - Intergenic
963684875 3:148420609-148420631 ATGCGCACTAAGAGGCAAAATGG - Intergenic
964249754 3:154699354-154699376 ATGTGTATTAAGAGGCAAAATGG + Intergenic
964444509 3:156744712-156744734 ATTCATAGCAGAAGGCAAAAGGG + Intergenic
964915668 3:161838502-161838524 ATGCAAACTGAGAGGCAAAATGG - Intergenic
965376105 3:167926305-167926327 ATGTGTATTAAGAGGCAAAATGG + Intergenic
965422246 3:168475622-168475644 ATGATTAACAAGAGGCAACACGG - Intergenic
965579105 3:170248002-170248024 CTGCATATCCAGAGGCAGGATGG + Intronic
965684632 3:171289080-171289102 AAGCAGTTCAAGAGGCATAAGGG + Intronic
965933804 3:174080671-174080693 ATGCACACTAAGAGGCAAAATGG - Intronic
965978705 3:174659536-174659558 ATGAATCTAAAGAGGAAAAAAGG - Intronic
966162572 3:176983777-176983799 ATTCATGTTAAGAGACAAAATGG + Intergenic
966218532 3:177527524-177527546 ATGCACGCTAAGAGGCAAAACGG + Intergenic
966228495 3:177624662-177624684 ATTCATCTCAAGAGCCATAAAGG - Intergenic
966566074 3:181382954-181382976 ATGCTCACTAAGAGGCAAAATGG - Intergenic
967011553 3:185439593-185439615 ATTCACTTCAAGAGGCCAAAAGG - Intronic
967120828 3:186381348-186381370 ATGTACACTAAGAGGCAAAATGG + Intergenic
967430802 3:189383124-189383146 ATGCACCCTAAGAGGCAAAATGG - Intergenic
967751381 3:193119911-193119933 ATGCACATTAAGAGGGAAAATGG + Intergenic
969199646 4:5592661-5592683 ATGTGCATTAAGAGGCAAAATGG + Intronic
969456565 4:7303443-7303465 ATGCATCTCAAGAACTAAAAAGG - Intronic
970370295 4:15399102-15399124 ATGTGCATTAAGAGGCAAAATGG - Intronic
970398537 4:15695823-15695845 ATGTACATTAAGAGACAAAATGG - Intronic
970471121 4:16380270-16380292 ATGCAAACTAAGAGGCAAAATGG - Intergenic
970798641 4:19945886-19945908 ATGCATATTAAGAGGCAAAATGG + Intergenic
970954051 4:21789963-21789985 ATGTATATGAAGATGGAAAATGG - Intronic
971671031 4:29558332-29558354 ATGCGCATTAAGAGGCAAAATGG + Intergenic
971851314 4:31989283-31989305 AAGCACATTGAGAGGCAAAATGG + Intergenic
972003402 4:34067744-34067766 ATGCACATTAAGAGAAAAAATGG + Intergenic
972016356 4:34250883-34250905 ATGAATACTAAGAGGCAAAATGG - Intergenic
972024928 4:34364115-34364137 ATGCACAGAAAGAGGTAAAATGG - Intergenic
972240972 4:37191510-37191532 ATGCATTTCTAGAGACAAAAAGG + Intergenic
972329863 4:38055022-38055044 ATGCGCATTAAGAGGCAACATGG - Intronic
972411782 4:38802360-38802382 ATGCATACCAAGAGGCAAAATGG + Intronic
972865072 4:43221908-43221930 ATGCACATTAAGAGGCAAACTGG - Intergenic
973003899 4:44986733-44986755 ATGCACATTGAGAGGCAAAATGG + Intergenic
973573670 4:52264988-52265010 ATGCACACTAAGAGGCAAAATGG - Intergenic
973702564 4:53551456-53551478 ATGCGCACTAAGAGGCAAAATGG + Intronic
973812658 4:54586890-54586912 ATGTACACTAAGAGGCAAAATGG - Intergenic
974098606 4:57392591-57392613 CTGCATATTAAGAGGCAAAATGG + Intergenic
974332564 4:60499155-60499177 ATGCACATTCAGAGGCAAAATGG - Intergenic
974462313 4:62204195-62204217 ATGCACACTAAGAGGCAAAATGG + Intergenic
974608686 4:64186249-64186271 ATGCACATTCAGAGGCAAAATGG + Intergenic
974631103 4:64490117-64490139 ATGAATATGAAGAGGGACAATGG - Intergenic
974674421 4:65072052-65072074 ATGCATACTAAGAGGCAAAATGG + Intergenic
974691275 4:65300427-65300449 ATGCACATTAAGAGACAAAATGG - Intergenic
974840053 4:67288998-67289020 ATGCACAATAAGATGCAAAATGG + Intergenic
974955165 4:68630531-68630553 ATGCACATTAAGAGGCCAAATGG + Intronic
975100981 4:70512724-70512746 ATGCACATTAACAGACAAAATGG - Intergenic
975222881 4:71833523-71833545 ATGTACATTAAGGGGCAAAATGG - Intergenic
975703553 4:77089705-77089727 ATGCACATTAAGAGGCAAAATGG - Intergenic
975767271 4:77682007-77682029 ATGCGCACTAAGAGGCAAAATGG - Intergenic
975856749 4:78632758-78632780 ATGCACATTGAGAGACAAAATGG + Intergenic
975939581 4:79626462-79626484 CTGCTTATGAAGAGGCAAACTGG + Intergenic
976143237 4:82015124-82015146 ATACATATAAAGAAGCAAGAAGG + Intronic
976299017 4:83500590-83500612 ATGCGCATTAAGAGACAAAATGG - Intronic
976818217 4:89174855-89174877 ATGCCCATTAAGAGACAAAATGG + Intergenic
977281333 4:95043334-95043356 ATGCATATATAGAGGCAATCTGG + Intronic
977523060 4:98110358-98110380 ATGCACACTAAAAGGCAAAATGG + Intronic
977780432 4:100975282-100975304 ATGCAAATCAAGAGGTAGATTGG - Intergenic
977817710 4:101434350-101434372 ATGCATATGAAGAGCCTACATGG + Intronic
977869249 4:102070432-102070454 ATGCACATTAAGAGATAAAATGG - Intronic
978764648 4:112391663-112391685 CTGCAGATCAAGAAGCACAAGGG + Intronic
978938611 4:114410574-114410596 ATGCTCACTAAGAGGCAAAATGG - Intergenic
978979295 4:114922241-114922263 ATGCACAGTAAGAGGCAAGATGG + Intronic
979057851 4:116017718-116017740 AGGCAGACAAAGAGGCAAAACGG + Intergenic
979093965 4:116520526-116520548 ATGCACACTAAGAGGCAAAGTGG - Intergenic
979125754 4:116969739-116969761 ATGAGTATTAAGAGACAAAATGG - Intergenic
979154101 4:117360608-117360630 ATGCGCACTAAGAGGCAAAATGG - Intergenic
979154182 4:117361297-117361319 ATGCGCACTAAGAGGCAAAATGG + Intergenic
979358321 4:119731901-119731923 CTGCGTATTAAAAGGCAAAATGG + Intergenic
979397282 4:120203631-120203653 ATGCACACTAAGATGCAAAATGG - Intergenic
979762468 4:124423650-124423672 ATACATATCCAGAGAAAAAAAGG + Intergenic
979919179 4:126477433-126477455 ATGCGCACCAAGAGGCAAAATGG - Intergenic
980032350 4:127845446-127845468 ATGCATATTAAGAGATAAAATGG - Intergenic
980116640 4:128685830-128685852 ATGTACACTAAGAGGCAAAATGG - Intergenic
980252497 4:130335777-130335799 ATGAGCATTAAGAGGCAAAATGG + Intergenic
980270999 4:130583449-130583471 ATGCACACCAAGAGACAGAATGG - Intergenic
980416605 4:132496585-132496607 ATGCACACTAAGAGGCAAAAGGG - Intergenic
980810758 4:137876063-137876085 ATGCACATTAAGAGGCAAAATGG - Intergenic
981452069 4:144910198-144910220 ATGCATATAAAAAGGTAAAAAGG - Intergenic
981526411 4:145710585-145710607 GTGCACATTAAGAGGCAAAATGG - Intronic
981756376 4:148145172-148145194 ACGCGCATGAAGAGGCAAAATGG + Intronic
982439893 4:155423036-155423058 ATGCACATTAAGAGGCAAAATGG - Intergenic
982513742 4:156318134-156318156 ATGCATCTCAAGATGCCATATGG + Intergenic
982609733 4:157558362-157558384 CTGCATATCAACATGCTAAAGGG + Intergenic
982922641 4:161294508-161294530 ATGCACACTAAGAGGCACAATGG + Intergenic
982988819 4:162244663-162244685 ATGCATACTCTGAGGCAAAATGG + Intergenic
983038729 4:162899007-162899029 ATGCACATTAAGAAGCAAAATGG - Intergenic
983067375 4:163227102-163227124 ATGCACACTAAGATGCAAAATGG + Intergenic
983262304 4:165470472-165470494 AAGCATACTAAGAGGCAAAATGG - Intronic
983262974 4:165476487-165476509 ATGCGCACCGAGAGGCAAAATGG - Intronic
983406344 4:167335804-167335826 GTGCACATTAAGAGGCAAAATGG - Intergenic
983830585 4:172321971-172321993 ATGCACACAAAGAGGCAAAATGG + Intronic
984113031 4:175643805-175643827 CTGCACACTAAGAGGCAAAATGG + Intronic
984422790 4:179546523-179546545 ATGCCCATGAAGAGGCAAAATGG + Intergenic
984436520 4:179717319-179717341 ATGCACACTAAAAGGCAAAATGG + Intergenic
985230841 4:187814819-187814841 ATGCGCATTAAGAGGCAAAATGG + Intergenic
986178632 5:5373247-5373269 TTGCACATCAAGAGGCAAAATGG - Intergenic
986275437 5:6271098-6271120 ATGCACCCTAAGAGGCAAAATGG - Intergenic
986326149 5:6676192-6676214 ATGCACAGTAAGGGGCAAAATGG + Intergenic
986476879 5:8143334-8143356 ATGCTCATTAAGAGACAAAATGG - Intergenic
986685033 5:10269058-10269080 ATGCGCATTAAGAGGCAAAATGG - Intergenic
987488019 5:18544406-18544428 ATGCTCATTAAGAGACAAAATGG + Intergenic
987605669 5:20132783-20132805 TTGCATATCAAGAAGTGAAATGG - Intronic
987878442 5:23710993-23711015 ATGCGCGTTAAGAGGCAAAATGG - Intergenic
987990742 5:25208254-25208276 AAGCATATCAAAATGCTAAAAGG - Intergenic
988131207 5:27108607-27108629 ATGCACATTAAAATGCAAAATGG - Intronic
988208408 5:28170997-28171019 ATGAATATCATGAGGCTAACTGG - Intergenic
988242567 5:28632801-28632823 ATGCGCATTAAGAGACAAAATGG + Intergenic
988245223 5:28671365-28671387 ATGCATCTCACCATGCAAAATGG - Intergenic
988629630 5:32914931-32914953 ATGAACATTAAAAGGCAAAATGG + Intergenic
988663876 5:33303375-33303397 AGGCATATCAGAAGGCAAAAGGG + Intergenic
988737675 5:34039041-34039063 ATGTGCATTAAGAGGCAAAATGG + Intronic
988882160 5:35515533-35515555 ATGTGCATTAAGAGGCAAAATGG + Intergenic
988915608 5:35891088-35891110 ATGCACAGTAAGAGACAAAATGG + Intergenic
989187446 5:38638784-38638806 ATGCGCATTAAGAGACAAAATGG - Intergenic
989306977 5:39969391-39969413 ATGCATGTTAAGAGACAAAATGG + Intergenic
989558319 5:42822537-42822559 ATGCATATTAATAGGAGAAAAGG - Intronic
989654311 5:43729281-43729303 ATGCTTAACAAGAGGCAACTGGG - Intergenic
990018624 5:51098324-51098346 ATGCACATTAAGAGGCAAAATGG - Intergenic
990421021 5:55633306-55633328 AGGCAGATTAATAGGCAAAAAGG - Intronic
990444515 5:55881665-55881687 ATGGCCATTAAGAGGCAAAATGG - Intronic
990491601 5:56308395-56308417 AAGCATATCAAAAGGCAAGATGG - Intergenic
990597924 5:57329868-57329890 ATGAAGATGAAGAGGCAAAAAGG - Intergenic
990777217 5:59315694-59315716 ATGCACAGTAAGGGGCAAAATGG + Intronic
991030498 5:62077468-62077490 ATGCACACTAAGAGGCAAAATGG + Intergenic
991311604 5:65249266-65249288 ATGCACATTAAGAGACAAAATGG + Intronic
991491767 5:67190767-67190789 ATGAATACCTAGAGGGAAAAGGG - Intronic
991648047 5:68821121-68821143 TTGGATATGAGGAGGCAAAAGGG - Intergenic
991657662 5:68920280-68920302 ATGCGCATTAAGAGGCAAAATGG - Intergenic
991929937 5:71744325-71744347 ATGCGCACTAAGAGGCAAAATGG + Intergenic
992259841 5:74958678-74958700 ATTCCTATCAAGAGGCAAGGAGG + Intergenic
992282273 5:75192351-75192373 AAGCATATCAGGAGGAATAAAGG - Intronic
993404835 5:87499046-87499068 ATTTAGCTCAAGAGGCAAAAAGG + Intergenic
995586470 5:113653853-113653875 ATACATATCAAGAACCAAACAGG + Intergenic
995594663 5:113734920-113734942 ATGCACATTAAGAGACAAAGTGG + Intergenic
995807106 5:116065265-116065287 TTGGATATCCATAGGCAAAAAGG - Intergenic
995966316 5:117911615-117911637 ATGCACACTAAGAGGCAAAATGG + Intergenic
996906807 5:128610267-128610289 ATGAGCATTAAGAGGCAAAATGG - Intronic
997049387 5:130361730-130361752 CTGCATATCAATAAACAAAAAGG - Intergenic
997436359 5:133878503-133878525 ATGCACACTAAGAGGCAAAATGG + Intergenic
997801751 5:136869954-136869976 ATAATTATCAAGAGTCAAAATGG + Intergenic
998074712 5:139226144-139226166 ATGCAGTTTAAGAGGCAAAATGG - Intronic
998533585 5:142908431-142908453 ATGCAGAGAAAGAGGGAAAAGGG - Intronic
998769160 5:145522246-145522268 ATGCATGTAAAAATGCAAAAGGG - Intronic
999518465 5:152324659-152324681 ATGCACACTAAGAGGCAAAATGG - Intergenic
999629300 5:153553695-153553717 ATGCACACTAAGAGGCAAAATGG - Intronic
999786636 5:154896489-154896511 ATGCATGAAAAGAGACAAAAGGG + Intronic
1000657121 5:163892987-163893009 ATGAATTTCAAAAGGGAAAAGGG - Intergenic
1000766619 5:165299521-165299543 ATGCACACTAAGAGGCAAAATGG - Intergenic
1001914269 5:175546711-175546733 ATGCACACTAAGAGGCAACATGG - Intergenic
1003188958 6:3856110-3856132 AGGCATATCATTGGGCAAAAGGG + Intergenic
1003196442 6:3919270-3919292 ATGCACATTAAGAAACAAAATGG - Intergenic
1003201993 6:3969842-3969864 ATGCACACTAAAAGGCAAAATGG - Intergenic
1004291835 6:14374522-14374544 ATGCACCCTAAGAGGCAAAATGG - Intergenic
1004333093 6:14739309-14739331 TGGCATCTCAGGAGGCAAAATGG + Intergenic
1004467703 6:15901355-15901377 ATGCACACTAAGAGGCAAAGTGG - Intergenic
1004474278 6:15956712-15956734 ATGCACACTAAGAGGCAAAATGG - Intergenic
1004832515 6:19492539-19492561 ATGCATTGCAAGAGGCAAAAGGG + Intergenic
1005106463 6:22229369-22229391 ATGCGTGTTAAGAGACAAAATGG - Intergenic
1005210965 6:23462355-23462377 ATGCAAAACTAGAAGCAAAAGGG + Intergenic
1005250163 6:23936419-23936441 ATGCATAGCTAGAGGCAAAATGG - Intergenic
1005669242 6:28088195-28088217 ATACATTTCTAGAGGGAAAATGG - Intronic
1006679238 6:35785501-35785523 ATGCACATTAAGAGAAAAAATGG - Intronic
1007062567 6:38955272-38955294 ATGCAAATAAAGAGGAAAATGGG - Intronic
1008969407 6:57349046-57349068 ATGAATATAAAAAGTCAAAAAGG - Intronic
1009266639 6:61563657-61563679 ATGCCTTTCAGGAGGTAAAAAGG - Intergenic
1009657954 6:66569906-66569928 ATGCTCATTAAGAGGCAAAATGG + Intergenic
1009726189 6:67538207-67538229 ATGGATGGCAGGAGGCAAAAAGG - Intergenic
1010913765 6:81590326-81590348 ATGCACACTAAGAGGCAAAATGG + Intronic
1010977252 6:82329697-82329719 ATGCACATTAAGAGGCAAAATGG + Intergenic
1011064635 6:83311875-83311897 TTGCATCCCTAGAGGCAAAACGG + Intronic
1012716139 6:102673004-102673026 ATCCATACTAAGAGCCAAAATGG - Intergenic
1012779370 6:103537048-103537070 ATGCACACTAAAAGGCAAAATGG - Intergenic
1013528604 6:110998353-110998375 ATGCACACTAGGAGGCAAAATGG - Intronic
1013684672 6:112565586-112565608 ATGCACATTAAGAGGCAAAATGG - Intergenic
1013866795 6:114708244-114708266 ATGCACACTAAGAGGCAAAGTGG + Intergenic
1014524951 6:122491339-122491361 ATGCACATTAAGAGGCAAAATGG - Intronic
1014901882 6:126975805-126975827 ATGAATAACAAAATGCAAAAGGG - Intergenic
1015484873 6:133757958-133757980 CTCCATATAAAAAGGCAAAATGG - Intergenic
1015675668 6:135745237-135745259 ATGAAGATCAATTGGCAAAAAGG - Intergenic
1015788676 6:136944575-136944597 TGGAATCTCAAGAGGCAAAAAGG - Intergenic
1015824909 6:137301174-137301196 ATGCACGTTAAGAGGAAAAATGG - Intergenic
1016126663 6:140412072-140412094 ATGCACATTAAGAGCCAAAATGG + Intergenic
1016289940 6:142518148-142518170 ATCCACATCAAGAGGAAAAAGGG - Intergenic
1016363268 6:143290542-143290564 ATGCACACTAAGAGGAAAAATGG - Intronic
1016836975 6:148487350-148487372 AGTCAAATCAACAGGCAAAATGG - Intronic
1017408243 6:154142369-154142391 ATGCACATTAAGAGGCAAAATGG + Intronic
1018845886 6:167555160-167555182 ATGCACACTAAGAGGCAAAATGG - Intergenic
1019111628 6:169721926-169721948 AAGAATATAAAGAGGCAATATGG + Intronic
1019369530 7:653753-653775 AAGCACAACAAGAGGCCAAATGG + Intronic
1020576710 7:9941439-9941461 ATACATATTAAGAGTTAAAAAGG + Intergenic
1020604985 7:10326029-10326051 TTGCAAATCAAGAAGTAAAATGG + Intergenic
1020680887 7:11235069-11235091 ATGCACATTAAGAGACAAAATGG - Intergenic
1020727090 7:11829640-11829662 ATGAAAATAAAGAGGCAAGAAGG - Intronic
1020764424 7:12302663-12302685 ATCCACACTAAGAGGCAAAATGG + Intergenic
1021162509 7:17293416-17293438 ATGCATAAGAACAAGCAAAAAGG + Intergenic
1021259124 7:18431948-18431970 ATGCGTTTGAAGAGGTAAAAAGG - Intronic
1021508542 7:21410926-21410948 ATGCCCACAAAGAGGCAAAATGG - Intergenic
1021688987 7:23214111-23214133 ATGCCCACTAAGAGGCAAAATGG - Intergenic
1021864718 7:24943847-24943869 ATAAATATCAAGATTCAAAATGG - Intronic
1022321389 7:29291178-29291200 ATGCGCACTAAGAGGCAAAATGG - Intronic
1023125246 7:36948759-36948781 ATATACATCAAGACGCAAAAGGG + Intronic
1023297990 7:38736594-38736616 ATGCATCTCCAGAGACCAAATGG + Intronic
1023342720 7:39238789-39238811 ATGTCTATCAAGAGGAAAATGGG + Intronic
1023392084 7:39720446-39720468 ATGCACACTAAGGGGCAAAATGG - Intergenic
1023542669 7:41283037-41283059 GAGCATCTCAAGAGGCAACAGGG + Intergenic
1024319030 7:48046867-48046889 ATGCTTATCTAGAGGAAAACTGG + Intronic
1024430433 7:49282322-49282344 ATGCAGACTAAGAGGCAAACTGG + Intergenic
1026130495 7:67616711-67616733 ATGCGCATTAAGAGGCAAAATGG + Intergenic
1026258259 7:68731717-68731739 ATGCATATTAAGAGGCAAAATGG + Intergenic
1026274479 7:68864622-68864644 ATGCGCACTAAGAGGCAAAATGG + Intergenic
1026322502 7:69279902-69279924 ATGCACCCTAAGAGGCAAAATGG - Intergenic
1026509345 7:71015586-71015608 ATGGATATTAAGAAGCAGAAGGG + Intergenic
1026816619 7:73517540-73517562 ATGAAAATGAAAAGGCAAAAAGG + Intronic
1027465421 7:78508828-78508850 ATGCATCTTAAAAGTCAAAAAGG - Intronic
1027585962 7:80058819-80058841 ATGGTTATCAAGAAACAAAATGG + Intergenic
1027596836 7:80184544-80184566 ATGCACATTAAGAGGCAAAATGG - Intronic
1027616514 7:80430935-80430957 ACACACATTAAGAGGCAAAATGG + Intronic
1027993332 7:85392784-85392806 ATGCATGCTAGGAGGCAAAATGG - Intergenic
1028360813 7:89964375-89964397 ATGCACGTTAAGAGACAAAATGG + Intergenic
1028364925 7:90017475-90017497 ATGCATATCATTAAGGAAAAAGG - Intergenic
1028392530 7:90333801-90333823 ATGCACATTAAGACACAAAATGG + Intergenic
1028794205 7:94885790-94885812 ATGCACATTAAGAGGCAAAATGG - Intergenic
1028833827 7:95352246-95352268 ATGCATACTAAGAGGCAAAATGG + Intergenic
1029106846 7:98184252-98184274 AGGCACACTAAGAGGCAAAATGG - Intronic
1029330487 7:99849676-99849698 ATACATATTAAGAGTAAAAAGGG - Exonic
1030515510 7:110533443-110533465 ATGTGCATTAAGAGGCAAAATGG + Intergenic
1030646980 7:112072803-112072825 ATGCACACTAAGAGGTAAAATGG + Intronic
1030825794 7:114156089-114156111 ATGTGCATTAAGAGGCAAAATGG - Intronic
1030864714 7:114685946-114685968 AGGAATATCAAGAGGAAAACCGG + Intronic
1031090852 7:117351759-117351781 ATGCATATTAAAAGACAAAATGG - Intergenic
1031347482 7:120686815-120686837 ATGTGTACTAAGAGGCAAAATGG - Intronic
1031637256 7:124116916-124116938 ATGCACACTAAAAGGCAAAATGG - Intergenic
1031639558 7:124145058-124145080 ATGCACAATAAAAGGCAAAATGG - Intergenic
1031644338 7:124204826-124204848 ATGCATATTTAGAGTCAAGAAGG + Intergenic
1031670435 7:124536473-124536495 ATGAATTTTAAGAGACAAAAAGG + Intergenic
1031865481 7:127034535-127034557 CTGGATATGAAGAGGGAAAAGGG - Intronic
1031928328 7:127659621-127659643 ATGTATATCAAGAGGAATAAAGG + Intronic
1033446601 7:141428479-141428501 ATTCATACTAAGAGGCAAAATGG + Intronic
1033550022 7:142438603-142438625 CTCCGCATCAAGAGGCAAAAGGG - Intergenic
1034075619 7:148228436-148228458 ATGCAAATCAACAGGAAAGATGG - Intronic
1036164632 8:6421158-6421180 ATGCACATTAAGAGACAAAATGG - Intronic
1037073957 8:14689163-14689185 ATGAATATCAAAAGAAAAAAGGG + Intronic
1037135383 8:15453954-15453976 ATGTACACTAAGAGGCAAAATGG + Intronic
1037152521 8:15655279-15655301 ATGCGCACCAAGAGACAAAATGG + Intronic
1037185413 8:16057059-16057081 AGGAATATCCAGAGGCAAGAGGG + Intergenic
1037331989 8:17751910-17751932 ATGCTTATCAACTGGCATAAGGG - Intronic
1037376866 8:18239917-18239939 ATGCATATCAAGAGAGACATGGG + Intergenic
1037586236 8:20278230-20278252 ATGCGCACTAAGAGGCAAAATGG + Intronic
1039005058 8:33026954-33026976 ATGCACATTAAGAGGCAAAATGG - Intergenic
1039106083 8:33991323-33991345 ATGTATATTAAGTGGCAAAAAGG - Intergenic
1039365291 8:36922467-36922489 CTGCAAGGCAAGAGGCAAAAAGG - Intronic
1039377853 8:37054652-37054674 GTGCATATCAAAAAGTAAAAAGG - Intergenic
1039668001 8:39557633-39557655 AACTATATCAAGAGGTAAAATGG + Intergenic
1039959286 8:42233404-42233426 ATGCACATTAAGAGGCAAAATGG - Intergenic
1040921449 8:52624403-52624425 CTGCATAACTAGAGACAAAAAGG - Intronic
1041207756 8:55515526-55515548 ATGAATATCCAGAGCCAGAATGG - Intronic
1041386104 8:57304980-57305002 ATGCACATTAAGAGGCAAAATGG - Intergenic
1041386204 8:57306211-57306233 ATGCACACTAAGGGGCAAAATGG - Intergenic
1041393831 8:57372367-57372389 ATGCACACTAAGAGGAAAAATGG + Intergenic
1041409780 8:57540839-57540861 ATGCACACTAAAAGGCAAAATGG - Intergenic
1041547967 8:59067790-59067812 ATGCAAATTAATAGGTAAAATGG - Intronic
1041670161 8:60483577-60483599 ATGCATGCCAAGAAGCAAAATGG + Intergenic
1042311159 8:67380570-67380592 ATGCACATTAAGAGGCAAAATGG + Intergenic
1042322051 8:67486366-67486388 TTGCAGATCAATAGGGAAAATGG + Intronic
1042343975 8:67709050-67709072 ATGCACGCTAAGAGGCAAAATGG + Intronic
1042397108 8:68305719-68305741 ATGCACATTAAGAGGCATAATGG + Intronic
1042521850 8:69721146-69721168 CTGCATTTCAAGTAGCAAAATGG - Intronic
1042747726 8:72125660-72125682 ATCCACACTAAGAGGCAAAATGG + Intergenic
1042917343 8:73888669-73888691 ATGCACACTAAGAGGCAAAATGG + Intergenic
1042974864 8:74457131-74457153 AGGCAATTCAAGAGCCAAAAAGG - Intronic
1043183201 8:77110946-77110968 ATATATATCAACAGGAAAAATGG - Intergenic
1043707685 8:83373214-83373236 ATGTACATCAAAAGGAAAAAGGG + Intergenic
1043884925 8:85588092-85588114 ATGCACCTTAAGAGACAAAATGG + Intergenic
1044358228 8:91250904-91250926 ATGCATTTCTATTGGCAAAATGG - Intronic
1044362952 8:91309967-91309989 ATGCATATTCAGAGGCAAAATGG - Intronic
1044363056 8:91310612-91310634 ACGCGTATTAAGGGGCAAAATGG + Intronic
1044690656 8:94874245-94874267 ATGCATATCAAAAAAAAAAACGG - Intronic
1044794206 8:95880001-95880023 AGGCATATCAACAGTTAAAAGGG + Intergenic
1045340147 8:101246476-101246498 ACTCATGTCAAAAGGCAAAAGGG + Intergenic
1045646554 8:104305257-104305279 ATGCAGATTAAGAGGAAAAATGG - Intergenic
1046028213 8:108750631-108750653 ATACACATTAAGAGACAAAATGG + Intronic
1046217197 8:111163967-111163989 ATGCACACTAAGAGGCAAAATGG - Intergenic
1046386890 8:113517747-113517769 ATGCACACTAAGAGGCAAAATGG + Intergenic
1046512996 8:115222265-115222287 ATGCACACCAAGAGGCAAAATGG + Intergenic
1046728661 8:117701476-117701498 ATGCAAATCAAAAGGCAATGGGG + Intergenic
1047871791 8:129091264-129091286 ATGCACACTAAGAGGCAAAATGG - Intergenic
1048118011 8:131546760-131546782 ATGAAAGTCAAGAGACAAAATGG - Intergenic
1048128369 8:131663145-131663167 ATGCACATCAAGAGACAAAATGG + Intergenic
1048415368 8:134222418-134222440 ATGCATATGAAGCGGTATAATGG + Intergenic
1048431897 8:134378322-134378344 ATGCGTATTAAGAGGCAAAATGG + Intergenic
1048461937 8:134628224-134628246 AAGCATATTCAGAGGTAAAAGGG + Intronic
1050042927 9:1514604-1514626 ATGCACACTAAGAGGCAACATGG - Intergenic
1050297395 9:4219468-4219490 ATGCACATCAGGATACAAAAAGG + Intronic
1050345435 9:4681165-4681187 AGGCATATGAAGAGAAAAAAGGG + Intronic
1050636612 9:7619354-7619376 ATGCAAATTAAGAGGCAAAATGG + Intergenic
1050815514 9:9806775-9806797 ATGCACACTAAGAGGCAAAATGG + Intronic
1051305506 9:15704459-15704481 AGGTATGTCAAGAGACAAAAAGG - Intronic
1051480344 9:17553513-17553535 AACCATATTAAGAGACAAAAAGG - Intergenic
1051598828 9:18851842-18851864 ATGTACACTAAGAGGCAAAATGG - Intronic
1051744664 9:20283952-20283974 ACGCATGTTAAGAGACAAAATGG - Intergenic
1051983570 9:23054848-23054870 CTGGATATCCAGATGCAAAAAGG + Intergenic
1051991213 9:23154467-23154489 ATGCGCATTAAGAGGCAAAATGG + Intergenic
1052040906 9:23737998-23738020 AAGGATATCAGGAGGCAACAGGG - Intronic
1052362682 9:27577003-27577025 ATGCACATTAAGAGGCAAAATGG - Intergenic
1053825802 9:42023031-42023053 ATGCGCACTAAGAGGCAAAATGG + Intronic
1054158571 9:61658025-61658047 ATGCACATGAAGAGGCTAATGGG - Intergenic
1054175213 9:61870164-61870186 ATGCACATGAAGAGGCTAATGGG + Intergenic
1054450178 9:65399386-65399408 ATGCACATGAAGAGGCTAATGGG + Intergenic
1054478345 9:65589030-65589052 ATGCACATGAAGAGGCTAATGGG - Intergenic
1054604761 9:67164362-67164384 ATGCGCACTAAGAGGCAAAATGG - Intergenic
1054662324 9:67710632-67710654 ATGCACATGAAGAGGCTAATGGG - Intergenic
1055005659 9:71503196-71503218 ATGTATATTAATAGGCAAAAAGG + Intergenic
1055058698 9:72047061-72047083 ATGCGCACTAAGAGGCAAAATGG + Intergenic
1055741793 9:79397523-79397545 ACACATAGCAAGAGGTAAAATGG - Intergenic
1055995802 9:82158210-82158232 AAGCATATCAAAAGAAAAAAAGG - Intergenic
1056094544 9:83239217-83239239 ATGCACAATAAGAGACAAAATGG + Intergenic
1056435222 9:86569419-86569441 ATGCACATTAAGAAGCAAAATGG - Intergenic
1056739708 9:89243857-89243879 ATGTACAATAAGAGGCAAAATGG - Intergenic
1057979897 9:99650275-99650297 ATGCAGGTCAAGAGGCAAGAAGG - Intergenic
1058143384 9:101382283-101382305 ATGCACATTAAGAGTCAAAATGG + Intronic
1059479824 9:114580473-114580495 ATTCACACTAAGAGGCAAAATGG + Intergenic
1060670740 9:125467268-125467290 AGTCCTATCAAGGGGCAAAAAGG - Intronic
1061554920 9:131361563-131361585 ATGTGCATTAAGAGGCAAAATGG - Intergenic
1203528310 Un_GL000213v1:110893-110915 ATGCATATTAAGAAGAAAACTGG + Intergenic
1185886698 X:3789622-3789644 ACGCACACTAAGAGGCAAAATGG + Intergenic
1186057441 X:5665006-5665028 ATCCACATTAAGAGGCAGAATGG - Intergenic
1186517883 X:10180346-10180368 ATGAACAGCAAGTGGCAAAAGGG + Intronic
1186569187 X:10696160-10696182 ATGCACACTAAGAGGAAAAATGG + Intronic
1186570713 X:10712344-10712366 ATGTACAATAAGAGGCAAAATGG + Intronic
1187956997 X:24529152-24529174 ATACACATCAAAAGGAAAAAAGG + Intronic
1188012330 X:25070475-25070497 ATACATAAAAATAGGCAAAAAGG + Intergenic
1188284527 X:28311876-28311898 ATGCACATTAAGAGGCAAAATGG - Intergenic
1188713784 X:33434924-33434946 AAGAATATAAAGAGGGAAAACGG + Intergenic
1188752836 X:33924602-33924624 ATGTGCATTAAGAGGCAAAATGG - Intergenic
1188905551 X:35787065-35787087 ATGCGCATTAAGAGACAAAATGG + Intergenic
1188953648 X:36407817-36407839 ATGCACACTAAGAGGCAAAATGG + Intergenic
1190138505 X:47819173-47819195 ATGCACAGTAAGGGGCAAAATGG + Intergenic
1190704301 X:53013675-53013697 ATGCACACTAAGAGGCAAAATGG - Intergenic
1191607382 X:63077618-63077640 ACGCATATTAGGAGGCAAAATGG + Intergenic
1191978482 X:66899955-66899977 ATGCATATCAAAAGGCTTCAGGG + Intergenic
1193731956 X:85112675-85112697 ATGCGCATTAAAAGGCAAAATGG - Intergenic
1193828223 X:86253468-86253490 TTGCACATCAACATGCAAAAAGG - Intronic
1193907996 X:87265668-87265690 ATGCGTAGTAAGGGGCAAAATGG - Intergenic
1193934635 X:87601506-87601528 ATGCACACTAAGAGACAAAATGG - Intronic
1193974698 X:88102863-88102885 ATGCGCATTAAGAGGCAAAATGG - Intergenic
1194010927 X:88559926-88559948 ATGCGCATTAAGAGACAAAATGG - Intergenic
1194041030 X:88942175-88942197 ATGAATCTTCAGAGGCAAAAAGG - Intergenic
1194089540 X:89567729-89567751 ATGTACATTAAGAGACAAAATGG - Intergenic
1194161969 X:90465015-90465037 ATGCACATTAAGAGGCAAAATGG - Intergenic
1194302187 X:92202323-92202345 ATGTACAGTAAGAGGCAAAATGG - Intronic
1194460664 X:94163557-94163579 ATGATTTTCAAGAGGCAAATAGG + Intergenic
1194553097 X:95325188-95325210 ATGCACATTAAGAGGCAGAATGG - Intergenic
1194627643 X:96244040-96244062 ATGCACACTAAGAGGCAAAATGG - Intergenic
1194648115 X:96482951-96482973 ATGTACATTAAGAGACAAAATGG - Intergenic
1194810570 X:98382628-98382650 ATGCACATTATGAGGCAAAATGG + Intergenic
1194850710 X:98865196-98865218 ATGCGCACTAAGAGGCAAAATGG + Intergenic
1194980759 X:100438040-100438062 ATGCACATTAAGAGGCAAAATGG + Intergenic
1195256840 X:103099228-103099250 ATGCACATTAAGAGACAAAAAGG - Intergenic
1195295977 X:103477902-103477924 ATGGATTTAAAGAGGTAAAAAGG - Intergenic
1195597335 X:106707069-106707091 ATACATAAAAATAGGCAAAAAGG - Intronic
1196223091 X:113135179-113135201 ATGCTTACTAAGAGGAAAAATGG - Intergenic
1196366075 X:114925842-114925864 ATGCCCATTAAGAGGCAAAATGG + Intergenic
1196934602 X:120716998-120717020 ATGGAAATCAAGAGGCATGAGGG + Intergenic
1197470431 X:126861604-126861626 ATGCACACTAAGAGACAAAATGG + Intergenic
1197660745 X:129168695-129168717 ATGCACATTAAGAGGCCAACTGG + Intergenic
1197932209 X:131707580-131707602 CTTCACATTAAGAGGCAAAATGG + Intergenic
1197938063 X:131761073-131761095 ATGCGTATTAAGACACAAAATGG + Intergenic
1197939683 X:131776849-131776871 ATGCGTATTAAGACACAAAATGG + Intergenic
1199009301 X:142740144-142740166 ATGCAAATTAAGAGACAAAATGG + Intergenic
1199082446 X:143591894-143591916 TTGCGCATTAAGAGGCAAAATGG - Intergenic
1199276171 X:145944958-145944980 ATGCACATTAAGAGGCAAAATGG - Intergenic
1199322917 X:146462533-146462555 ATGCACACTAAGAGACAAAATGG - Intergenic
1199347358 X:146757292-146757314 ATACACATTAAGAGGCAACATGG - Intergenic
1199381462 X:147177435-147177457 ATGCATATTAAGAGACAAAAAGG + Intergenic
1199617381 X:149668227-149668249 ATGCAGCTCCAGAGGCAAAGAGG - Intergenic
1199625262 X:149735022-149735044 ATGCAGCTCCAGAGGCAAAGAGG + Intergenic
1200205219 X:154310753-154310775 ATGCATTTCAGGAGGAGAAACGG - Intronic
1200508250 Y:4042760-4042782 ATGCACATTAAGAGGCAAAATGG - Intergenic
1200775571 Y:7167305-7167327 ATGCACACTGAGAGGCAAAATGG - Intergenic
1201404977 Y:13640877-13640899 ATGGGTATCTAGAGCCAAAAAGG - Intergenic
1201554324 Y:15253200-15253222 AGGCATATAGAGAGGAAAAAGGG + Intergenic
1201853658 Y:18516976-18516998 ATGCACATTAAGAGACGAAATGG + Intergenic
1201879663 Y:18803408-18803430 ATGCACATTAAGAGACGAAATGG - Intronic
1202173873 Y:22079716-22079738 GTGCACATTAAGAGACAAAATGG - Intronic
1202217487 Y:22506666-22506688 GTGCACATTAAGAGACAAAATGG + Intronic
1202274171 Y:23098558-23098580 ATGCACACTAAGAGGCAAAATGG + Intergenic
1202291855 Y:23322119-23322141 ATGCACACTAAGAGGCAAAATGG - Intergenic
1202325699 Y:23689393-23689415 GTGCACATTAAGAGACAAAATGG - Intergenic
1202427167 Y:24732303-24732325 ATGCACACTAAGAGGCAAAATGG + Intergenic
1202443624 Y:24937791-24937813 ATGCACACTAAGAGGCAAAATGG - Intergenic
1202545072 Y:25980661-25980683 GTGCACATTAAGAGACAAAATGG + Intergenic