ID: 957191694

View in Genome Browser
Species Human (GRCh38)
Location 3:77018420-77018442
Sequence ACACTCAATATGTTTAAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 276}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957191693_957191694 -5 Left 957191693 3:77018402-77018424 CCTATTTCTAACATGTACACACT 0: 1
1: 0
2: 1
3: 15
4: 222
Right 957191694 3:77018420-77018442 ACACTCAATATGTTTAAAAGAGG 0: 1
1: 0
2: 1
3: 22
4: 276
957191691_957191694 21 Left 957191691 3:77018376-77018398 CCCAGTTAACAATATTCTAAATA 0: 1
1: 0
2: 1
3: 33
4: 429
Right 957191694 3:77018420-77018442 ACACTCAATATGTTTAAAAGAGG 0: 1
1: 0
2: 1
3: 22
4: 276
957191692_957191694 20 Left 957191692 3:77018377-77018399 CCAGTTAACAATATTCTAAATAT 0: 1
1: 1
2: 1
3: 38
4: 401
Right 957191694 3:77018420-77018442 ACACTCAATATGTTTAAAAGAGG 0: 1
1: 0
2: 1
3: 22
4: 276
957191690_957191694 29 Left 957191690 3:77018368-77018390 CCACTGTGCCCAGTTAACAATAT 0: 1
1: 0
2: 14
3: 150
4: 1116
Right 957191694 3:77018420-77018442 ACACTCAATATGTTTAAAAGAGG 0: 1
1: 0
2: 1
3: 22
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957191694 Original CRISPR ACACTCAATATGTTTAAAAG AGG Intronic
900233827 1:1576876-1576898 GCAATGAATAAGTTTAAAAGGGG + Intergenic
902847021 1:19119426-19119448 AAACTAGATATATTTAAAAGAGG + Intronic
903743091 1:25569643-25569665 GAACTCAATATGTCTAAAAATGG + Intergenic
908587489 1:65587015-65587037 ACACTGAATATTTGTAAAAAAGG - Intronic
908666310 1:66495213-66495235 AGACTCAATATGCTCAAAAATGG + Intergenic
908958621 1:69668123-69668145 AAACACAAAATGTTAAAAAGTGG - Intronic
909427753 1:75546512-75546534 AAATTCAAAATTTTTAAAAGTGG + Intronic
909882624 1:80899300-80899322 ACATTAAATAATTTTAAAAGAGG - Intergenic
909889934 1:80992444-80992466 ACATTCAAGATGGTTAACAGAGG + Intergenic
909913908 1:81294225-81294247 AGCCTAAATATGTTTAGAAGTGG + Intergenic
910290693 1:85597651-85597673 ATACACTATATGCTTAAAAGTGG - Intergenic
910740540 1:90511033-90511055 ACACTCACTCTGTGTAAAAACGG + Intergenic
910986795 1:93012935-93012957 ATACTTAATATGGTTAGAAGAGG - Intergenic
911408449 1:97471229-97471251 AACTTCAATATGTTTTAAAGGGG + Intronic
911622648 1:100083289-100083311 ACACTCACTATGGTTAAATAAGG + Exonic
912304874 1:108557175-108557197 ATATTCAATGTGTTTAAATGGGG - Intergenic
913401244 1:118436214-118436236 ACTCTCTATATGTAGAAAAGAGG + Intergenic
913404536 1:118475011-118475033 ATGTTCAATATATTTAAAAGGGG + Intergenic
913428930 1:118767327-118767349 GCACCCAATACGTTTAAAGGAGG - Intergenic
914243495 1:145868712-145868734 GCACACATTATGATTAAAAGTGG + Intronic
916623034 1:166522242-166522264 ACACTCAAGCTTTTTAAATGAGG - Intergenic
917721176 1:177787864-177787886 ACACTCAATGTTTTTGAATGAGG + Intergenic
918348548 1:183629532-183629554 ACACTCAATATTTTTATGACTGG + Intronic
918947372 1:191084872-191084894 CCACTCAATATCTTTAAATTGGG - Intergenic
921945108 1:220880676-220880698 AGAATCAATATTTATAAAAGTGG + Intronic
922313318 1:224417097-224417119 AAACTCAATAGGTACAAAAGTGG + Intronic
923713114 1:236402823-236402845 ATACTCAATGTGTGAAAAAGGGG + Intronic
1062807166 10:430510-430532 ACAATCAATCTGATTAAAATAGG - Intronic
1063760444 10:9068655-9068677 ACACATAATATGCATAAAAGTGG - Intergenic
1063763342 10:9107501-9107523 ACAGTTAATATGATTGAAAGTGG + Intergenic
1067268449 10:44768062-44768084 AAACTCAATTTGTGTAAAAATGG - Intergenic
1068621701 10:59191941-59191963 ACTCTTAATCTGTTTAAGAGAGG + Intronic
1069315066 10:67088425-67088447 ACACAAAATATATTCAAAAGTGG + Intronic
1070232380 10:74582515-74582537 AGATTAAATATGCTTAAAAGTGG + Intronic
1070506921 10:77121919-77121941 ACATTCAATGTGTCTCAAAGCGG - Intronic
1071048925 10:81421718-81421740 ACATATAATATGTTTAAAAATGG + Intergenic
1074739249 10:116468798-116468820 ACACTGAATACGTGTAATAGGGG - Intronic
1074776615 10:116772008-116772030 ACACTCAATAAGCTTAACATGGG + Intergenic
1075381235 10:122020204-122020226 ACACTCAATATTTTCTAATGAGG + Intronic
1078042961 11:7885211-7885233 AAACTCAAGATATTTATAAGAGG - Intergenic
1078072260 11:8123093-8123115 ACACTGAATAAGATTAACAGTGG + Intronic
1078962732 11:16297766-16297788 AGACTCAACATTATTAAAAGGGG + Intronic
1079165286 11:18035137-18035159 ACACACAATATGTATAGCAGGGG - Intronic
1079297228 11:19243901-19243923 TCATTGAATATGTTGAAAAGTGG + Intergenic
1085428518 11:76426202-76426224 ACACTCAAGAGGTTGTAAAGGGG - Intergenic
1085984039 11:81763515-81763537 ACACACAATGGCTTTAAAAGAGG + Intergenic
1086507051 11:87516211-87516233 ACACTCTAGTTGTTTAACAGGGG + Intergenic
1088280959 11:108134342-108134364 ATACTTAAAATGTGTAAAAGGGG + Intronic
1090103065 11:123822440-123822462 AAACTCTAAATGTTTCAAAGAGG + Intergenic
1090180414 11:124693751-124693773 ATACCCAATTTTTTTAAAAGAGG + Intronic
1090898159 11:130998796-130998818 ACACTTAATTTTTTTAATAGAGG + Intergenic
1092876121 12:12849417-12849439 ATACTCAATTTATTGAAAAGTGG - Intergenic
1093244481 12:16719406-16719428 ATGCTCTATATGTTTAAATGTGG + Intergenic
1093451102 12:19315387-19315409 ACCCCCAGTATGTTAAAAAGTGG - Intronic
1093728394 12:22541941-22541963 ACACTCAATTTGTTCAAAGAAGG + Intronic
1093746066 12:22742213-22742235 ACAATCAATATTTTCAAAAAGGG + Intergenic
1094596942 12:31874351-31874373 AAAGTAAATATGTTTAAATGGGG - Intergenic
1098162760 12:67661988-67662010 CCACCCATTAAGTTTAAAAGTGG - Exonic
1098734057 12:74074821-74074843 TCACTCAATATTATTAGAAGAGG + Intergenic
1098958449 12:76712349-76712371 TCACTTAAAATGTTAAAAAGTGG - Intergenic
1099954126 12:89336257-89336279 ACACTCAGTATGATTAGAACAGG - Intergenic
1100729453 12:97448131-97448153 ACACACAATTTATTTAGAAGAGG - Intergenic
1100927325 12:99563826-99563848 ACAGTAAAAATGTTTTAAAGTGG - Intronic
1101765571 12:107695697-107695719 ACTCTTAATATTTTTAAAAAAGG - Intronic
1106738144 13:32609081-32609103 AAATTAAATATGATTAAAAGAGG - Intronic
1107581159 13:41788299-41788321 AAACCCAAATTGTTTAAAAGTGG - Intronic
1109080852 13:57898759-57898781 ACACTTAATATGTTTTAACTTGG - Intergenic
1109110625 13:58314577-58314599 ACACACAATATTTTAAAAAGTGG - Intergenic
1109445516 13:62434175-62434197 ACACTGAATATTTTAAAATGAGG + Intergenic
1109486469 13:63028109-63028131 ACAATCAATTAGTTTCAAAGAGG + Intergenic
1109522981 13:63536194-63536216 TCACTAAATATCTTTAAAAAAGG - Intergenic
1110154593 13:72300044-72300066 AAACTAAAGATGTTTAAATGTGG - Intergenic
1110683744 13:78347231-78347253 AATCTTAATATGTTTAAAAATGG - Intergenic
1111471474 13:88688867-88688889 ACACTGACTGTGTTTGAAAGAGG - Intergenic
1111659544 13:91192044-91192066 CCACTCAATATTGTTAAGAGTGG - Intergenic
1112634643 13:101201718-101201740 ACACTAAAAATGTTAAAATGTGG + Intronic
1115707861 14:36016514-36016536 AGGCTCAGTAAGTTTAAAAGGGG - Intergenic
1116192452 14:41678650-41678672 AGTCTCAATAAATTTAAAAGAGG + Intronic
1116395351 14:44442164-44442186 AGACTCAATATCATTAAAATGGG - Intergenic
1116603508 14:46959469-46959491 AAGCTCATGATGTTTAAAAGAGG - Intronic
1117034261 14:51711070-51711092 AGACTTTATATGTTTAAAACTGG - Intronic
1117359320 14:54957838-54957860 ATACTGAATATGTTTCATAGTGG - Intronic
1118471495 14:66078999-66079021 ACACCTAAGATGTTTAAAAGTGG - Intergenic
1120317084 14:82908212-82908234 ATATTGAATATGTTTAAAACAGG + Intergenic
1120473387 14:84955859-84955881 ACATTGAATATTTTTAAGAGAGG - Intergenic
1120783202 14:88505157-88505179 ACACTTGAGATGTTTATAAGAGG + Intronic
1123509394 15:20981319-20981341 ACATTCAATATATTTAAATATGG + Intergenic
1123602877 15:21992352-21992374 ACATTCAATATATTTAAATATGG + Intergenic
1123833041 15:24161316-24161338 ACACTCACCATGTTTTAAAATGG - Intergenic
1123839766 15:24236382-24236404 ACACTCACCATGTTTTAAAATGG - Intergenic
1129865520 15:78905014-78905036 GAACTCAATAGGTTTAACAGTGG + Intergenic
1130576061 15:85094161-85094183 AAAATCAAGATTTTTAAAAGAGG - Intronic
1131563078 15:93461166-93461188 ACACTCAATATCCATAAAATGGG - Intergenic
1133615203 16:7469703-7469725 ACACTAAAAATATTTAAAAGGGG - Intronic
1133715542 16:8443943-8443965 ACAGTAAATATAATTAAAAGTGG + Intergenic
1134420960 16:14089027-14089049 ACACACAATCTGTTCAAATGAGG - Intronic
1138576301 16:57909357-57909379 AGACTTAATTTATTTAAAAGTGG - Intronic
1139130439 16:64136290-64136312 AAACTAAATAAGTATAAAAGAGG - Intergenic
1139243956 16:65422604-65422626 TCACTCAATATATGTAAAGGGGG - Intergenic
1141096328 16:81165648-81165670 ACACTCAACATGGTGACAAGGGG + Intergenic
1141541219 16:84723179-84723201 ACACTTAAGATTTTGAAAAGTGG + Intronic
1141696519 16:85622614-85622636 ACTCTCAAGATGGTTCAAAGTGG - Intronic
1143208492 17:5164540-5164562 ACACTGGATTTGTTAAAAAGAGG - Intronic
1145356429 17:22159348-22159370 ACAATCAATTTGTTTCAAAGAGG - Intergenic
1149871786 17:60189019-60189041 ACACTGGATTTGTTAAAAAGGGG + Intronic
1154246825 18:12706604-12706626 ACACTGAATATGTCTAAGATTGG + Exonic
1155614150 18:27701917-27701939 ACATTGTCTATGTTTAAAAGAGG - Intergenic
1157000932 18:43523745-43523767 ACAATAAGTATTTTTAAAAGGGG + Intergenic
1158896049 18:61914389-61914411 ACAATAAATATGTTTAATATGGG + Intergenic
1159347681 18:67227957-67227979 ACACTCAATTTGTACAATAGCGG - Intergenic
1162631734 19:11933115-11933137 CCAGTCAAGATGTTTAAAATAGG - Intronic
1162636543 19:11972789-11972811 CCAGTCAAGATGTTTAAAACAGG - Intronic
1168163580 19:54530113-54530135 ACACCCAATGTTTTTAAAATTGG + Intergenic
924976636 2:182643-182665 TCACTGATTATTTTTAAAAGAGG + Intergenic
926390674 2:12388900-12388922 AAACTCAATATGTTGAAAAGAGG - Intergenic
926448235 2:12970684-12970706 TCACTCAATTTGTTTAAGAGTGG + Intergenic
929035212 2:37684186-37684208 ACTTTTAATATTTTTAAAAGCGG + Intronic
931015174 2:57969328-57969350 AAAATAAATATGTTTAAAAATGG + Intronic
931146027 2:59519529-59519551 ACATTTAATATGTTTTAAAATGG - Intergenic
931519032 2:63074784-63074806 ACACTTAAAATGGCTAAAAGGGG - Intergenic
931643120 2:64398822-64398844 ACACTTAAAATGGTTAAAATGGG + Intergenic
932282751 2:70508719-70508741 ATAATCAACATTTTTAAAAGTGG - Intronic
932860147 2:75283003-75283025 CAACTCATTATTTTTAAAAGCGG + Intergenic
933134784 2:78719687-78719709 ACAATCATTCTGTTTATAAGTGG - Intergenic
933933142 2:87176046-87176068 ATACTCAATAGTTTTAGAAGTGG + Intergenic
934872731 2:97881927-97881949 ACATACAATAACTTTAAAAGAGG + Intronic
935446328 2:103160401-103160423 AAGCTCCATATGTTAAAAAGTGG - Intergenic
935903302 2:107815605-107815627 AAAATGAATATGTTGAAAAGTGG - Intergenic
936359971 2:111789401-111789423 ATACTCAATAGTTTTAGAAGTGG - Intronic
938737412 2:134198893-134198915 ACACTCAGCAAGTATAAAAGAGG + Intronic
938887926 2:135672383-135672405 ACAGTTAATATGTTTTAATGGGG - Intronic
939425419 2:142030335-142030357 ACCATCAATATGTTTAGCAGTGG - Intronic
939677377 2:145089355-145089377 ACACTTAAGATATTTAAAAGAGG + Intergenic
939845588 2:147242429-147242451 ACAATGAATATGTAGAAAAGTGG + Intergenic
941216727 2:162719611-162719633 TCACTCCATCTGTTTAAAACTGG - Intronic
941373678 2:164701230-164701252 AGCCTCAATATTTTTAAAGGGGG - Intronic
941721273 2:168815821-168815843 AAAGTCAATATGTCTAAAACAGG + Intronic
942754784 2:179327759-179327781 ACACTCAATATTTAGAGAAGAGG - Intergenic
943113254 2:183633906-183633928 CCTATCTATATGTTTAAAAGTGG - Intergenic
943232276 2:185269773-185269795 ACAAGAAATGTGTTTAAAAGTGG + Intergenic
943929205 2:193827940-193827962 AGACACAATATGTTAAAAATAGG - Intergenic
944039885 2:195341067-195341089 ACAGTTAATATGTTTAAAAATGG - Intergenic
945516631 2:210770545-210770567 CCACTCAACATGTTTTAAAATGG - Intergenic
947088501 2:226483194-226483216 ACAATCATTATGATTAAATGAGG + Intergenic
1172419224 20:34800066-34800088 ACAAACAAAAAGTTTAAAAGTGG + Intronic
1174685434 20:52450368-52450390 ACACTCAAAAAGTATTAAAGTGG - Intergenic
1181446376 22:22978340-22978362 ACACTCAGTTTAATTAAAAGTGG + Intergenic
1184323706 22:43765013-43765035 ACATGCAATATATTTAAAATTGG - Intronic
949832872 3:8235097-8235119 ACAATAAATAAGTTTAAAAACGG + Intergenic
950244443 3:11402921-11402943 ATATTCAATATTTTTAAAACAGG - Intronic
950278837 3:11687901-11687923 ACAATGAATATGTTTAATGGTGG - Intronic
952048093 3:29348598-29348620 ACACTCTTTATGTTTAAAAATGG + Intronic
952394846 3:32912421-32912443 ATTCTCAATATGTTTTAAAATGG + Intergenic
952558723 3:34563864-34563886 AAACTCAATATTTTTTAAAGTGG - Intergenic
952603415 3:35112829-35112851 AAAATCAATATGTTAAAAAAAGG - Intergenic
952985431 3:38776008-38776030 ATATTCAATTGGTTTAAAAGTGG + Intronic
953720932 3:45354605-45354627 ACACACATTATGTTTAAGAGAGG - Intergenic
956141158 3:66148238-66148260 ACACTCAAGATTTTTAAAAAAGG + Intronic
956483317 3:69694922-69694944 ACAGTCACTATATTTAAAATTGG + Intergenic
957106602 3:75897186-75897208 AGACTGAAGATTTTTAAAAGAGG + Intergenic
957191694 3:77018420-77018442 ACACTCAATATGTTTAAAAGAGG + Intronic
957363888 3:79196573-79196595 ACAATCAATATGACTAAAATTGG - Intronic
959749126 3:109812406-109812428 ACACTCATTATGTTTACAAACGG - Intergenic
960790701 3:121427241-121427263 ACACTGAAAATTTTTAATAGAGG - Intergenic
963099707 3:141588452-141588474 ACATTCAGTATGTTTTACAGAGG + Intronic
963388516 3:144627699-144627721 TCAATAAATCTGTTTAAAAGAGG + Intergenic
963574355 3:147041209-147041231 ACACTCAAAATTTTAAAAATTGG + Intergenic
964579898 3:158221828-158221850 ATACTTAATTTTTTTAAAAGAGG + Intronic
964884513 3:161465999-161466021 AAACTAAATATCTTTAAATGAGG - Intergenic
965455895 3:168900091-168900113 ACACTTTATATGCTTAAAACAGG - Intergenic
967934155 3:194713327-194713349 ACATTAAATATTTTAAAAAGGGG + Intergenic
968342284 3:197966456-197966478 ACAATTAATATTTTTAACAGTGG - Intronic
971277645 4:25213273-25213295 AGAATCAATAGGGTTAAAAGTGG + Intronic
972025940 4:34377801-34377823 ACACTCTATGTGTTCAAAATTGG - Intergenic
972703920 4:41521932-41521954 AATCTCAATATATATAAAAGAGG + Intronic
972951934 4:44337004-44337026 AGAGTAAATATGTCTAAAAGGGG + Intronic
973078815 4:45963815-45963837 AGAATCAATATATTTAAAAATGG - Intergenic
973539051 4:51917175-51917197 ACACTCAAGAAGTTTAATGGTGG + Intergenic
973657531 4:53064579-53064601 TCACTGAAGGTGTTTAAAAGAGG + Intronic
974602440 4:64102313-64102335 AAACTTAATATGGATAAAAGTGG - Intergenic
974882004 4:67770902-67770924 ACACTAAATATTTCTAAAAATGG - Intergenic
975066573 4:70073511-70073533 TCATTCAATCTTTTTAAAAGTGG - Intergenic
976436367 4:85023142-85023164 AGACAGAATATCTTTAAAAGGGG - Intergenic
978132269 4:105213377-105213399 AAACTCAATTTGATTAAAATTGG - Intronic
978148413 4:105405478-105405500 CCATTCCAAATGTTTAAAAGAGG - Intronic
978682426 4:111397583-111397605 ACACTTAAAATGTCTCAAAGTGG + Intergenic
979516162 4:121612647-121612669 AGACTCCATATGTTAAAAATTGG + Intergenic
979521734 4:121675196-121675218 ACATTAAAAATGTTAAAAAGTGG + Intronic
982471308 4:155793703-155793725 ATACTCCATATGTCTAAAATAGG - Intronic
983002563 4:162435692-162435714 AAAATCAATATGTTAAAAAATGG - Intergenic
983429235 4:167626739-167626761 AAATTCAATATCTTTAAAAGGGG - Intergenic
983778700 4:171641765-171641787 ACACTCACTATCTTGAAAAACGG - Intergenic
983833504 4:172361128-172361150 CCACTCAATATATCTAAAATTGG + Intronic
984540172 4:181028406-181028428 ACCATTAATATGTTAAAAAGTGG + Intergenic
987481021 5:18458091-18458113 ACAATCAATTTTTTTAAATGAGG - Intergenic
988406486 5:30829857-30829879 AAACTCAGTATGTTTAATATTGG + Intergenic
989706527 5:44339084-44339106 ACAATGAATATGATTTAAAGAGG + Intronic
990571579 5:57084464-57084486 AGACTTAATATGTTTAAATGTGG + Intergenic
991944770 5:71889440-71889462 CCAGCCAATATTTTTAAAAGGGG - Intergenic
992284453 5:75219555-75219577 AGACTCAATATCGTTAAAATGGG + Intronic
992934729 5:81689932-81689954 AAACAAAAAATGTTTAAAAGTGG + Intronic
993066652 5:83107770-83107792 ACACTCAAGATAATTATAAGTGG - Intronic
993395743 5:87385636-87385658 TCATTGATTATGTTTAAAAGTGG - Intronic
993813836 5:92516235-92516257 ACAGTCAATCTATTTAAAAGGGG - Intergenic
995956337 5:117781147-117781169 ACAATCAATATGGATAAAATAGG - Intergenic
996148296 5:120002502-120002524 AAACTCAAAATGTTAAAAATGGG + Intergenic
996410092 5:123149351-123149373 ACACTCAATATGTTCAAGGTAGG - Intronic
1000180453 5:158805151-158805173 ACACCCAATATTGTGAAAAGGGG + Intronic
1001107675 5:168869024-168869046 GCACACAGTATGTTTAAGAGGGG + Intronic
1003397392 6:5765016-5765038 AAACTATAAATGTTTAAAAGGGG - Intronic
1003838940 6:10100398-10100420 ACAAAAAATATGTTTGAAAGAGG - Intronic
1005291275 6:24381645-24381667 ACAGAAAATATATTTAAAAGCGG + Intergenic
1005633077 6:27727155-27727177 TCACTGAATATATTGAAAAGTGG + Intergenic
1008542843 6:52560492-52560514 ATACTCTAGCTGTTTAAAAGAGG - Intronic
1008995927 6:57659002-57659024 AATCTCAATATATTTAACAGTGG - Intergenic
1009184453 6:60557781-60557803 AATCTCAATATATTTAACAGTGG - Intergenic
1009542844 6:64985807-64985829 AGAGTAAGTATGTTTAAAAGAGG + Intronic
1010576855 6:77542165-77542187 AGACTTAATATGGTTAAAATGGG + Intergenic
1011515774 6:88151024-88151046 TCTCTCTATATGCTTAAAAGAGG - Intronic
1011891560 6:92168351-92168373 ACTCAAAATATTTTTAAAAGAGG - Intergenic
1012025918 6:93991046-93991068 ACACACAATCTGATTAAAATGGG + Intergenic
1012946324 6:105469674-105469696 ACACACACAATGTTTAAAAAAGG + Intergenic
1012946390 6:105470421-105470443 AACCACAAAATGTTTAAAAGTGG - Intergenic
1013480227 6:110546646-110546668 AAACTCAGTATGTTCAAAAGTGG + Intergenic
1014595052 6:123325640-123325662 ACACTAAATAACTTTAAAACTGG + Intronic
1015164776 6:130191461-130191483 ACACTCAATAGCTCCAAAAGGGG - Intronic
1016132285 6:140489415-140489437 AAAATCAATATTTTTATAAGTGG - Intergenic
1016626879 6:146180881-146180903 ACAGCAAATATTTTTAAAAGCGG + Intronic
1018905422 6:168072913-168072935 ACTCTCACTGTGATTAAAAGTGG + Intronic
1020585586 7:10061763-10061785 AAAAGGAATATGTTTAAAAGTGG - Intergenic
1020808653 7:12823823-12823845 AGAATCAATATCATTAAAAGAGG + Intergenic
1021468953 7:20979576-20979598 AGGGTCAAGATGTTTAAAAGAGG - Intergenic
1022790861 7:33687744-33687766 CCACCCAGTATGTTTAACAGAGG + Intergenic
1024495013 7:50035818-50035840 ACCCTCAAAATGTTAAAGAGAGG + Intronic
1027671176 7:81101689-81101711 ACGCTAATTATGTTTTAAAGAGG + Intergenic
1027736555 7:81939677-81939699 TCACTGAATATTTTTTAAAGGGG + Intergenic
1028203557 7:87990970-87990992 ACATTCAATTATTTTAAAAGAGG - Intronic
1029181189 7:98703127-98703149 ACACTTAAAATGGTTAAAATGGG - Intergenic
1030207277 7:106963228-106963250 AAACACAGTATGTTTAAAAGAGG + Intergenic
1030430986 7:109448418-109448440 AAAATCAATCTGTTTAAAATGGG - Intergenic
1031314908 7:120244409-120244431 ACTCTCAAAGTGTTTAGAAGAGG + Intergenic
1031719518 7:125153789-125153811 ACACTTAATTTATTGAAAAGGGG - Intergenic
1032504826 7:132427070-132427092 ACACTCACAAACTTTAAAAGTGG + Intronic
1035085398 7:156253563-156253585 ACATTCCATACGTTTAAAACTGG - Intergenic
1037371228 8:18181597-18181619 ACTATTAATATGTATAAAAGTGG + Intronic
1040623775 8:49120508-49120530 AGACCAAAAATGTTTAAAAGAGG - Intergenic
1040801273 8:51343870-51343892 ACACTCAAATTATTTAAAAATGG + Intronic
1041136692 8:54766687-54766709 ACACCCTATATGTTTTAAGGCGG + Intergenic
1041277527 8:56178149-56178171 AAATTCAAAATCTTTAAAAGAGG + Intronic
1041884445 8:62792248-62792270 ACAGACAATAGCTTTAAAAGGGG - Intronic
1043251609 8:78080991-78081013 ACACTTAACATGTTTATAAAAGG + Intergenic
1043308381 8:78825845-78825867 AAATTGAATATGTCTAAAAGGGG - Intergenic
1043774631 8:84250291-84250313 AAACAAAATATGTATAAAAGAGG - Intronic
1043816152 8:84804142-84804164 ACACAGAATATGTTTTAAAGTGG + Intronic
1043916146 8:85924715-85924737 ACATCAAATATGTTTAAAATTGG + Intergenic
1044278194 8:90326415-90326437 AAACTCAACATGTCTAAAAATGG + Intergenic
1044887634 8:96796418-96796440 ACACTCAATTTGAATAAAATAGG - Intronic
1046132079 8:109977798-109977820 AGACTCTATATTTTAAAAAGGGG - Intergenic
1048954600 8:139525549-139525571 ACATTCAACATGTATATAAGGGG - Intergenic
1049811301 8:144574226-144574248 AAACTGAAAATATTTAAAAGTGG + Intronic
1050084618 9:1951598-1951620 AGAATCAATATGCCTAAAAGAGG - Intergenic
1050211199 9:3258619-3258641 ATACTTAAAATATTTAAAAGTGG - Intronic
1050696433 9:8284419-8284441 TCACTCAGTATTTTTAAAAAAGG + Intergenic
1050911729 9:11080189-11080211 ACACTCAATCTGTTCAAAGATGG + Intergenic
1051157526 9:14167098-14167120 TTACTGAATATGTTAAAAAGGGG - Intronic
1051222392 9:14863368-14863390 ATATTTAATATGTTTAAAAATGG + Intronic
1051646587 9:19274838-19274860 GCACTCAATTTATTTAAATGTGG + Intronic
1052112543 9:24605290-24605312 AGACTCCATATCTTTAAAATGGG + Intergenic
1052120641 9:24711939-24711961 ACACTAATTATCTTTAAAACTGG - Intergenic
1052455610 9:28693217-28693239 TGTCTCAATATGTTTAAAAATGG - Intergenic
1055702399 9:78959836-78959858 ACACTGATCATGCTTAAAAGAGG + Intergenic
1055976941 9:81964901-81964923 ACACTCAGTATATTTGAAAATGG + Intergenic
1055983190 9:82026813-82026835 ACACTAAATAGATTGAAAAGGGG - Intergenic
1056019007 9:82422437-82422459 ACACTCTTTATGTTTAAAAAAGG - Intergenic
1056981545 9:91316974-91316996 AGACTTAATATGTTTAGAAGTGG - Intronic
1057065935 9:92051438-92051460 ACACTCAATAAATTAAAAATGGG + Intronic
1057923017 9:99114527-99114549 ACCCTCAATACGTGTTAAAGGGG - Intronic
1059131678 9:111758083-111758105 AGATACAATATGTTTAAATGAGG - Exonic
1059826909 9:118040743-118040765 ACAGTCCTTATGGTTAAAAGAGG + Intergenic
1060164314 9:121397067-121397089 ACAAACAATATGATTAAAAATGG - Intergenic
1060561082 9:124544092-124544114 ACATTCAATATGTTCGAAAAAGG + Intronic
1061467726 9:130795716-130795738 ATAATCAACATGTTTTAAAGTGG + Intronic
1203650322 Un_KI270751v1:112734-112756 ACACTGCATAAGTATAAAAGAGG - Intergenic
1185999822 X:4996534-4996556 ACTGTCAGTATATTTAAAAGTGG + Intergenic
1186683211 X:11897560-11897582 ACACAAAATATTTTAAAAAGTGG + Intergenic
1187637148 X:21242273-21242295 ACAGACAAAATTTTTAAAAGAGG + Intergenic
1188024821 X:25197199-25197221 TCAGGCAATGTGTTTAAAAGAGG - Intergenic
1188882333 X:35504754-35504776 ACACTCATTATTTTTATAAATGG + Intergenic
1190556851 X:51644565-51644587 ACACTTAACATGGTTAAAATGGG - Intergenic
1193047064 X:77064687-77064709 ACTTTCAATATTTTTAAAAGTGG - Intergenic
1193672663 X:84408660-84408682 AGACCCAATATCATTAAAAGGGG - Intronic
1194142034 X:90219656-90219678 ACACTCAAGATTTTTAAGCGGGG + Intergenic
1195460796 X:105121819-105121841 ACACAAAAGATGTGTAAAAGAGG + Intronic
1195860000 X:109373483-109373505 AGACTCAAAAGGTTTAAAAGAGG + Intronic
1197190854 X:123646648-123646670 ACACTCAATTTGTTTTTAATTGG + Intronic
1197304753 X:124827873-124827895 AAACTCAATATATTTAACACAGG + Intronic
1199444203 X:147901962-147901984 ATACTGAATATATTTCAAAGTGG - Intergenic
1199686011 X:150266315-150266337 AGACTCCATATGCCTAAAAGTGG + Intergenic
1200487791 Y:3788769-3788791 ACACTCAAGATTTTTAAGCGGGG + Intergenic
1201538357 Y:15077431-15077453 ACTCTCAACAAGTCTAAAAGTGG - Intergenic