ID: 957191826

View in Genome Browser
Species Human (GRCh38)
Location 3:77019634-77019656
Sequence CCACTGGTGAAACCAGTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 141}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957191822_957191826 -6 Left 957191822 3:77019617-77019639 CCATGAAAGGAAATGTCCCACTG 0: 1
1: 0
2: 2
3: 10
4: 242
Right 957191826 3:77019634-77019656 CCACTGGTGAAACCAGTGTCAGG 0: 1
1: 0
2: 2
3: 11
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957191826 Original CRISPR CCACTGGTGAAACCAGTGTC AGG Intronic
900457518 1:2784556-2784578 CAAGTGGTAACACCAGTGTCTGG - Intronic
903087841 1:20879441-20879463 CAACTGATGAAGCAAGTGTCAGG - Exonic
905849471 1:41262733-41262755 CCACTGGTCTAACCAGGCTCTGG - Intergenic
905921268 1:41720519-41720541 CTACAGGTGAGACCAGAGTCAGG + Intronic
911064878 1:93779331-93779353 CCACTGCTGAAAATAGTGCCTGG - Intronic
911820607 1:102415199-102415221 CCTCTGTTGGAACCAGTGCCAGG + Intergenic
915896334 1:159813994-159814016 CCTCTGGTTTAAACAGTGTCAGG + Intronic
916760459 1:167811725-167811747 CCACTGTGGGAACCAGTGCCAGG + Intronic
916837622 1:168564347-168564369 CCACTGTGGAAAACAGTGTGGGG + Intergenic
917489510 1:175486017-175486039 TCTCTGGTGAAACCAGTCCCTGG - Intronic
917793033 1:178512037-178512059 CCACAGCTGTCACCAGTGTCAGG + Intergenic
917876166 1:179289077-179289099 CCAGAGGTAAAGCCAGTGTCAGG - Intergenic
919366575 1:196669306-196669328 CCACTGGAGAAATCTGTGTAAGG + Intronic
1063516709 10:6703612-6703634 CTACTGGTAAAAGCAGTGTTAGG - Intergenic
1064448757 10:15422286-15422308 CCACTGTGGAAACCAGTATGTGG + Intergenic
1067087407 10:43250233-43250255 GCTGTAGTGAAACCAGTGTCCGG - Intronic
1067660194 10:48231422-48231444 TCATTAGTGAAAACAGTGTCAGG - Intronic
1070170784 10:73931303-73931325 CAAGTGGTAACACCAGTGTCTGG - Intergenic
1072562806 10:96591848-96591870 ACCCTGGTGAACACAGTGTCTGG + Intergenic
1072863323 10:99029970-99029992 CTAGCGGTGACACCAGTGTCTGG - Intronic
1073804720 10:107084980-107085002 CAGCTTCTGAAACCAGTGTCTGG + Intronic
1074176655 10:111012398-111012420 CCACTGGTGTAAACAGTGAAAGG + Exonic
1077698083 11:4413375-4413397 TAACTGGTGAAGCCAGGGTCTGG - Intergenic
1077929078 11:6711748-6711770 CTAGTGGTGATGCCAGTGTCTGG + Intergenic
1080485840 11:32705395-32705417 CCACTGCAGGCACCAGTGTCTGG - Intronic
1083808823 11:65090876-65090898 CCACTGTTGAAACAATTGTTTGG + Intronic
1084504770 11:69558543-69558565 ACAGTGGTGAAAGCAGTGTTTGG - Intergenic
1092343630 12:7697346-7697368 CCACTGGTGAAGAAAGTGTCCGG + Intergenic
1099345244 12:81491650-81491672 GCACTGGTGGATCCAGTGTCTGG - Intronic
1102479076 12:113208524-113208546 TCACTGATGTAACCAGTCTCTGG - Intronic
1105019998 12:132809546-132809568 CTAGCGGTGAAGCCAGTGTCTGG - Intronic
1106058024 13:26256205-26256227 ACACTGGAGAAATCAGCGTCTGG + Intronic
1107555013 13:41510069-41510091 CCACTGGAGAATCTGGTGTCAGG - Intergenic
1109872974 13:68360892-68360914 TCACTGGTAAATCCAGTTTCAGG - Intergenic
1110047134 13:70844718-70844740 CCACTGTGGGCACCAGTGTCTGG + Intergenic
1111304087 13:86383170-86383192 CCACTGTGGGAACCAGGGTCTGG - Intergenic
1111770933 13:92594642-92594664 CCAATGGTGAAACATGTCTCAGG + Intronic
1118571802 14:67201586-67201608 CCACTGCTGAAACCAGTCACTGG + Intronic
1120540805 14:85748031-85748053 GCACTGGTGAATTTAGTGTCTGG - Intergenic
1121123816 14:91393207-91393229 CCCCAGGTCACACCAGTGTCAGG + Intronic
1121688694 14:95858737-95858759 CCACTGGTGGAACCAATGCAGGG + Intergenic
1127113253 15:55697564-55697586 GCAGTGGTGCAACCTGTGTCTGG + Intronic
1128106670 15:65050349-65050371 CCAGTGCTGAGAACAGTGTCTGG - Intronic
1128993633 15:72280730-72280752 CCTCTCGGGAATCCAGTGTCAGG + Intronic
1131500000 15:92952958-92952980 CCGCTGGTGAATCCTGTGGCTGG - Intronic
1132193442 15:99890412-99890434 CCAATGGTGAAACATGTCTCAGG - Intergenic
1134034233 16:11017277-11017299 CCACTGTCTAATCCAGTGTCTGG - Intronic
1135036567 16:19083236-19083258 CCATTGGTGGAAGCAGTGTGAGG - Intergenic
1135355803 16:21768097-21768119 CAATTGGTGTAACCATTGTCTGG - Intergenic
1135454293 16:22584235-22584257 CAATTGGTGTAACCATTGTCTGG - Intergenic
1135925180 16:26687737-26687759 ACACTGCTTAAAACAGTGTCTGG + Intergenic
1137739611 16:50755447-50755469 CCACTGTGGAAAACAGTGTGGGG - Intronic
1137841882 16:51648660-51648682 ACAAGGATGAAACCAGTGTCTGG + Intergenic
1138036313 16:53610126-53610148 GCACTGGAGAAACCAGTTTGCGG + Intronic
1138577052 16:57914739-57914761 CCAGTGATGAAACGGGTGTCTGG + Intronic
1142044978 16:87919526-87919548 CCCCTGGGGAAAGCAGAGTCTGG + Intronic
1144087328 17:11822517-11822539 CCACTCGTGGAACCAGTGGATGG - Exonic
1146017310 17:29244348-29244370 CCACTGATGAAACTTGAGTCGGG + Intergenic
1147267787 17:39245178-39245200 TCACTGGTGAGGCTAGTGTCTGG + Intergenic
1151288998 17:73134995-73135017 CCACTATTGAAATCTGTGTCTGG - Intergenic
1151793606 17:76326759-76326781 CCACTGGTGAAACCTGAGTAAGG + Intronic
1152135714 17:78502022-78502044 ACCCTGGTGAAACCAGTGCCTGG - Intronic
1161984654 19:7646823-7646845 CCTTTGGGGAACCCAGTGTCTGG - Intronic
1163602729 19:18258519-18258541 CCACTCCAGAAAACAGTGTCTGG - Intronic
1168666339 19:58207870-58207892 CCAGTGGTGCCACCAGTTTCTGG - Intronic
926783880 2:16500872-16500894 CCAGTGCTGAAAACAGTGACTGG + Intergenic
932680000 2:73816709-73816731 CCACTGCTGTGACCAGTCTCCGG + Exonic
933245834 2:79973795-79973817 CCAAGGGCGAAACCAGTGTAAGG + Intronic
935764142 2:106347820-106347842 CCATTGTAGAAAGCAGTGTCTGG - Intergenic
936596739 2:113855291-113855313 CCAGTGGTGGAAGCAGTCTCTGG + Intergenic
937726774 2:125176077-125176099 CCACTTGTGAAAACAGTCTCTGG + Intergenic
941913630 2:170791866-170791888 CTACTTCTGAAAACAGTGTCTGG + Intronic
942081735 2:172406110-172406132 CCACTGTTGAAAGCAGTTTGGGG - Intergenic
946205099 2:218100167-218100189 GAACTGGAGAAACCAGTGTCTGG + Intergenic
1173554868 20:43958822-43958844 CCACTGGGGAAACCAAGGCCAGG - Intronic
1173586080 20:44184429-44184451 ACACTTGTGAAAGCAGTGTTTGG + Intronic
1173797383 20:45871364-45871386 CCAATGGTGTTTCCAGTGTCTGG + Intronic
1174008422 20:47428849-47428871 CCACTGATGTACCCAGTGCCTGG + Intergenic
1175167896 20:57058661-57058683 CCACTGTTGAAACCAATTGCAGG - Intergenic
1181130580 22:20729269-20729291 CCTCTGGTGAGGCCTGTGTCAGG + Intronic
1182552852 22:31110049-31110071 CCACTGGGGAAATCAATGTGGGG + Intronic
1182919165 22:34063894-34063916 CCACTGTTGAAGCCATTGGCTGG + Intergenic
1183781208 22:40000123-40000145 CCTCTGGGGAAGCAAGTGTCTGG + Intronic
1184131862 22:42521271-42521293 CCACTAGTCAAAGCAGTCTCTGG + Intergenic
950860318 3:16142055-16142077 GCACTGGCAAAGCCAGTGTCTGG + Intergenic
952750096 3:36817894-36817916 ACGGTGGTGAACCCAGTGTCAGG - Intergenic
954138362 3:48592667-48592689 CAGCTGGTGAGACCAGTGTGCGG - Exonic
955150539 3:56362455-56362477 CCACTGGTGAAAGAAGGGGCTGG - Intronic
957191826 3:77019634-77019656 CCACTGGTGAAACCAGTGTCAGG + Intronic
957419041 3:79944808-79944830 CCACTGTGGAAAACAGTGTGGGG + Intergenic
963333723 3:143947237-143947259 CCAGTGGTGATACCCGAGTCTGG + Intergenic
964111357 3:153091011-153091033 CCACTGGAGAAACCCCTGTAGGG - Intergenic
968245614 3:197143933-197143955 CCACTGGTGAAACAAGTCCCTGG + Intronic
968521838 4:1037694-1037716 TCACTGCTGAAACCAGGGGCGGG - Intergenic
970196161 4:13552175-13552197 CCACTGTGGAAAGCAGTGTGGGG + Intergenic
970645889 4:18119936-18119958 CCACTGTTGAAGGCAGTGTGGGG + Intergenic
972731820 4:41802227-41802249 CCAGTGTTCAAAACAGTGTCTGG + Intergenic
973553062 4:52054407-52054429 CCCCTGCTGAAACCAGAGGCAGG + Intronic
974374932 4:61063770-61063792 CCACTGCTAAGCCCAGTGTCTGG - Intergenic
974443879 4:61954088-61954110 CCACTGGTGCAATCTGAGTCTGG - Intronic
976729252 4:88245325-88245347 CCACTGCAGGCACCAGTGTCTGG - Intergenic
978657927 4:111088625-111088647 CCTCTGAGGAAACCAGTGTCAGG + Intergenic
981605798 4:146538799-146538821 GCACTGGTGGATTCAGTGTCTGG + Intergenic
984636781 4:182119454-182119476 CCTCTGCTGGAACCAGTGCCAGG - Intergenic
986210220 5:5664958-5664980 CCACTGGTGGACCCAGCCTCGGG - Intergenic
989118185 5:37977140-37977162 GCACGGGTGGATCCAGTGTCTGG - Intergenic
990602324 5:57371662-57371684 CCACTATTGAAAACAGTGTGGGG - Intergenic
991354699 5:65756002-65756024 ACTCTGGCAAAACCAGTGTCAGG - Intronic
995491270 5:112693946-112693968 GAACTGGTGAGAACAGTGTCTGG + Intergenic
996413811 5:123187662-123187684 CCGCTGGGGCAGCCAGTGTCAGG - Exonic
997046175 5:130320915-130320937 CCACTGTAGAAAGCAGTGTGTGG + Intergenic
999559820 5:152788410-152788432 CCGCTGGTGTACCCAGGGTCTGG + Intergenic
1000171870 5:158710028-158710050 CCACTGGTGAACACACTTTCTGG - Intronic
1000533930 5:162457155-162457177 CCAATGGTAAACCCAGTTTCTGG - Intergenic
1001563510 5:172685213-172685235 CCACTGATTAAACCAGTGTCAGG - Intronic
1001948884 5:175802199-175802221 ACAATGGTGAAACCAGTCTCAGG + Intronic
1002376883 5:178795308-178795330 CCAAAGGGGAAACCAGTGCCTGG + Intergenic
1002695016 5:181081489-181081511 CTACTGGAGAAACCTGAGTCAGG - Intergenic
1003309221 6:4954069-4954091 CCACTGGTGACACCGGGATCGGG + Exonic
1007497294 6:42268947-42268969 CCACCAGTGAAACCAGGGTGAGG + Exonic
1012454938 6:99393454-99393476 CCAGTGCTCATACCAGTGTCTGG + Intronic
1014018806 6:116565216-116565238 CCACTGTAGACACGAGTGTCTGG + Intergenic
1017151400 6:151283740-151283762 CCACTGTTAAAAGCAATGTCAGG + Intronic
1018621314 6:165732019-165732041 CCAGTGGTGCATCCAGTGACAGG - Intronic
1018721818 6:166578675-166578697 CCTCAGGTGACAGCAGTGTCTGG + Intronic
1019398258 7:835158-835180 TCACTGGCGAAGCCAGTGGCCGG - Intronic
1019524502 7:1474656-1474678 CCCCTGGTTAAACCAGTGTCTGG + Intronic
1020067636 7:5201141-5201163 CCACTGCAGAAACCACTGTGGGG - Intronic
1023343373 7:39246365-39246387 CCAAAGGGGAAAACAGTGTCAGG + Intronic
1023986612 7:45100820-45100842 CCAGGTGTGAAACCAGAGTCAGG + Intronic
1024344983 7:48304393-48304415 CCACTGCAGAAAGCAGTGTGGGG - Intronic
1028140511 7:87269154-87269176 TCCCTGGTGACACCAATGTCAGG + Intergenic
1028755452 7:94428359-94428381 CTACTGGCGAAACCTGTATCCGG + Exonic
1029655166 7:101919346-101919368 CCAGAGGAGCAACCAGTGTCAGG - Intronic
1033468452 7:141620585-141620607 CCACTTTGGAAACCAGTGCCAGG + Intronic
1033601268 7:142890042-142890064 CGGCTGGTGAACCCAGTGACTGG - Intergenic
1034285466 7:149880755-149880777 CCACTGGAGAAACAAGAATCAGG - Intergenic
1037715616 8:21394907-21394929 CCACTGCTTGGACCAGTGTCTGG + Intergenic
1040397878 8:47016671-47016693 CCACTGGAGAAATCAGAGTGAGG + Intergenic
1045601802 8:103725140-103725162 CCACTGGTGTAACAAATGTGGGG - Intronic
1046217595 8:111169928-111169950 CCACTGATCAAAGCAGTGACAGG - Intergenic
1047297830 8:123587102-123587124 CAACTGGTGCAACAAGGGTCTGG - Intergenic
1048218658 8:132520425-132520447 CCACTGGAGAAGTCAGTGTTGGG + Intergenic
1051048215 9:12900494-12900516 CCACTGCAGGAACCAGTGCCAGG - Intergenic
1052437268 9:28444659-28444681 CCACTGTGGGCACCAGTGTCTGG - Intronic
1052708592 9:32023694-32023716 CCACTGTGGAAAACAGTGTGGGG - Intergenic
1059662293 9:116414027-116414049 CCACTGACCAAACCAGTGCCAGG + Intergenic
1061482915 9:130906023-130906045 CCACTGCTGACCCCAGTGCCTGG + Intronic
1062574857 9:137201256-137201278 CCCCTGGTGAAAGCAGGGTCCGG - Intronic
1185798365 X:2986271-2986293 CCACTGGTGAGATCACTGTGGGG + Intergenic
1186262456 X:7793883-7793905 CCACTGGTGAAAGACGTGTGTGG + Intergenic
1188512317 X:30949680-30949702 GGAGGGGTGAAACCAGTGTCTGG - Intronic
1190512236 X:51185222-51185244 CCACTGTCGAGACCAGTGTTTGG - Intergenic
1196228360 X:113191922-113191944 CCACTGCTAAATCCAATGTCAGG - Intergenic
1197724878 X:129769575-129769597 CCACAGGTGACAGCAGTCTCCGG - Intergenic