ID: 957192286

View in Genome Browser
Species Human (GRCh38)
Location 3:77024996-77025018
Sequence AGGACAGAAGGTCTGTTCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 208}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957192283_957192286 21 Left 957192283 3:77024952-77024974 CCTCTTAGCTGTTTTTTTTTGTT 0: 1
1: 1
2: 27
3: 429
4: 3850
Right 957192286 3:77024996-77025018 AGGACAGAAGGTCTGTTCTTTGG 0: 1
1: 0
2: 0
3: 17
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957192286 Original CRISPR AGGACAGAAGGTCTGTTCTT TGG Intronic
902068167 1:13706592-13706614 AGAACAGATGGGCAGTTCTTGGG - Intronic
906921686 1:50071115-50071137 ATGAGAGAAGGACTGTTCTGAGG - Intronic
906953138 1:50350429-50350451 AGGACAGATGGTCTGTGATATGG + Intergenic
910113147 1:83703046-83703068 AGGACAGAAGTCCTTTTCTTGGG + Intergenic
910724203 1:90321464-90321486 AGGACAGAATTTCTGCTCCTTGG + Intergenic
911240636 1:95462004-95462026 AGGATAGAAGGTCTTTTCTCAGG + Intergenic
911662354 1:100515935-100515957 GGGACAGAAGGTCAATTCGTTGG + Intronic
912033642 1:105282864-105282886 TAGAGAGAAGGTCTGTTGTTTGG - Intergenic
916011389 1:160709231-160709253 GAGACAGAAGTTCTGATCTTGGG + Intronic
916304127 1:163310224-163310246 AGGACAGAATGACTCTTGTTAGG - Intronic
917055543 1:170977868-170977890 AGGATTGAAGGTCTGTGCTGTGG + Intronic
917872121 1:179251229-179251251 AGGACAGTATTCCTGTTCTTGGG - Intergenic
918026379 1:180752785-180752807 AGGCCAGAAGATCTGTGTTTTGG - Intronic
918325057 1:183402202-183402224 AGGAAAGGAGGTCTGGTCTCTGG - Intronic
918636014 1:186775027-186775049 AGGATTGATGGTCTGTCCTTAGG + Intergenic
919064140 1:192671467-192671489 AGGACAGAAAGCCTGTATTTAGG - Intergenic
919625929 1:199910181-199910203 AGGACAGAAGGAATCTTCTGTGG + Intergenic
920583537 1:207135868-207135890 AGCAAAGAAGGTGTGTTGTTGGG - Intronic
921082363 1:211752496-211752518 AGGGCAGGAGGTCTGGTCTCTGG - Intronic
921182051 1:212638941-212638963 AGCCCAGAGGCTCTGTTCTTGGG - Intergenic
921571778 1:216788269-216788291 AAGAGAGTAGGCCTGTTCTTTGG - Intronic
922559873 1:226561534-226561556 AGGACAGATGGCCTGGTCTGTGG + Intronic
924017097 1:239739050-239739072 AGAACAGCAACTCTGTTCTTAGG - Intronic
924786210 1:247202347-247202369 AGGTCAGAGGGCCTGCTCTTCGG - Intergenic
924853107 1:247850610-247850632 AGCACAGAAGTTTTGTTATTTGG - Intergenic
1063601150 10:7482625-7482647 AGGACAAAAAGCCTGTTCTTTGG + Intergenic
1064137577 10:12764044-12764066 AGGACAGCAGGGCTTTTCCTGGG - Intronic
1064320029 10:14296393-14296415 AGGGCAGGAGGGCTGTTCTCAGG - Intronic
1067042282 10:42961400-42961422 AGGACAGAAGCCCTGTGCTGTGG - Intergenic
1067098608 10:43318650-43318672 AGGTCAGCAGGTCAGCTCTTCGG - Intergenic
1070790718 10:79187720-79187742 AGGACACAAGGTGTGTCCTCAGG - Intronic
1075009796 10:118857828-118857850 AGGACAGACTGTCTGTTATGAGG + Intergenic
1077343244 11:2035321-2035343 AGGACAGAAGGACTGGGCTTGGG - Intergenic
1080205686 11:29726148-29726170 AGGACAGGTGGTCTCTTATTGGG - Intergenic
1083119352 11:60495869-60495891 AAGACAGAAGTTTTGTTGTTGGG + Intronic
1083365243 11:62138304-62138326 AGAGCAGAGGGTTTGTTCTTGGG + Intronic
1083752829 11:64770657-64770679 AGGAAAAAATGTCTATTCTTTGG + Intronic
1085623699 11:78056189-78056211 AAGACAGAAGGAGTGTTCTACGG - Intronic
1086290248 11:85300735-85300757 ATGACAGAAAGCCTGTTCTAGGG + Intronic
1086592038 11:88526077-88526099 AGGAGAGAAGACATGTTCTTTGG + Intronic
1086956072 11:92935769-92935791 AGAGCAGAAGGGCTGTTCCTGGG + Intergenic
1202826230 11_KI270721v1_random:90510-90532 AGGACAGAAGGACTGGGCTTGGG - Intergenic
1093764155 12:22943021-22943043 AGGTCAGTGGGTCTGTTATTGGG + Intergenic
1094154089 12:27319414-27319436 AGCACATAAGGTATGTTCCTAGG + Exonic
1094495292 12:30985503-30985525 AGGACAGAAGGCCTGCCCTGGGG - Intronic
1096134260 12:49186547-49186569 GGGACAGGAGGTCTGTCCTGGGG - Intronic
1096144645 12:49269729-49269751 GGGACAGGAGGTCTGTCCTGGGG + Intronic
1097177377 12:57151269-57151291 AGGACACCAGGTCTATTCTGGGG + Intronic
1098149004 12:67527105-67527127 TGAACAGAAGTTCTATTCTTTGG + Intergenic
1098537677 12:71613056-71613078 AGGACAGATGGTGTGTGTTTAGG + Intronic
1102158674 12:110751036-110751058 AACACAGAAGTTATGTTCTTAGG + Intergenic
1103679823 12:122684504-122684526 AGGACAGATGGACTTTTCATAGG - Intergenic
1105241134 13:18610322-18610344 AGGACAGAGGGGCTGGTCTCAGG - Intergenic
1108586061 13:51870887-51870909 AAGACAGGAGGTTTATTCTTTGG + Intergenic
1108706113 13:52989303-52989325 AGAAAAAAAGGTGTGTTCTTGGG + Intergenic
1109141632 13:58719579-58719601 AGGAAAAAAGGCCTGTGCTTTGG - Intergenic
1109318672 13:60782509-60782531 AGGATAGAGGGTCTGTGCTGTGG + Intergenic
1109946568 13:69441962-69441984 AGGAAAGAAGGTTTGTTCAGTGG - Intergenic
1110282487 13:73711402-73711424 AGGACAGATGGACTCTTGTTAGG + Intronic
1111013903 13:82351228-82351250 AGGAGAGAGGCTCTGTTCTTAGG + Intergenic
1111123246 13:83880659-83880681 AGGAGCAAAGGTCTCTTCTTGGG + Exonic
1111460457 13:88535069-88535091 AGAACATATGGTCTCTTCTTTGG + Intergenic
1114285376 14:21237673-21237695 AGAACTGAGGGACTGTTCTTAGG - Intronic
1115735758 14:36327497-36327519 AGAACAGCAGTTCTGTTTTTAGG + Intergenic
1116967061 14:51025903-51025925 AGGGCAGCAGGGCTGTACTTGGG - Intronic
1118414520 14:65520393-65520415 AGGAGAGAAGACATGTTCTTTGG + Intronic
1118888319 14:69885734-69885756 AGGACAGGTGGTCTCTTCTTCGG + Intronic
1118934644 14:70275852-70275874 GGGACATAAGGTCTCTTTTTAGG - Intergenic
1122265995 14:100547148-100547170 GGGAAAGCAGGTCTGGTCTTGGG - Intronic
1122577736 14:102752441-102752463 AGGACAGAAGTTTTGTCCGTGGG - Intergenic
1123490220 15:20774825-20774847 AGGACAGAGGGGCTGGTCTCAGG + Intergenic
1123546721 15:21343912-21343934 AGGACAGAGGGGCTGGTCTCAGG + Intergenic
1124115318 15:26837080-26837102 AGGCCAGAAGGTCCTTTCCTGGG + Intronic
1124690655 15:31818942-31818964 AGGACAAAAGGTCAGTCCTGTGG + Intronic
1125498475 15:40220623-40220645 AGGCCACAGTGTCTGTTCTTGGG + Exonic
1126349580 15:47730535-47730557 AGGACAGGTGGTCTCTTCGTGGG + Intronic
1127107056 15:55627746-55627768 ATGACATAAAATCTGTTCTTGGG - Intronic
1202955052 15_KI270727v1_random:71127-71149 AGGACAGAGGGGCTGGTCTCAGG + Intergenic
1133452191 16:5912982-5913004 AGGATAAAAGTTCTCTTCTTAGG + Intergenic
1134202620 16:12211354-12211376 ATAACAGAAGCTCTGTTCATTGG + Intronic
1134319789 16:13152247-13152269 AGGACAGAAGATTTATTTTTGGG - Intronic
1136532009 16:30876109-30876131 AGGACAGAAAGTAAGTTCTTGGG + Intronic
1138399771 16:56735945-56735967 AGGAATGAAGGTCTGGCCTTAGG + Intronic
1139801190 16:69524320-69524342 AGGAAAGAATTTCTGTTCCTGGG - Intergenic
1140419754 16:74808560-74808582 ACTGCAGAAGGTCTTTTCTTTGG + Intergenic
1140720621 16:77768614-77768636 TGAACAGAAGTTCTGCTCTTGGG - Intergenic
1142339154 16:89509161-89509183 AGGACACAAGGTCTGGTTTTCGG - Intronic
1142586490 17:978173-978195 TGGACAGAAGGGCTATTCTGGGG - Intronic
1144281239 17:13729096-13729118 AGGAGAGAAGGTATCTTCTCTGG + Intergenic
1147005721 17:37402133-37402155 AGGACAAAAGGTGTTTTTTTGGG + Intronic
1147013441 17:37470913-37470935 AGGAAAGAAAATCTGTTCTGAGG - Intronic
1147456873 17:40543321-40543343 AGGACAGAAGGCATTTGCTTTGG - Intergenic
1147598280 17:41730639-41730661 AGGAAGGAAGGTCAGTTCTGGGG + Intronic
1151874272 17:76857547-76857569 GGGACAGAAGGTAAGTTCGTGGG + Intergenic
1154447824 18:14449579-14449601 AGGACAGAGGGGCTGGTCTCAGG + Intergenic
1155835630 18:30580447-30580469 AAGACATAATTTCTGTTCTTCGG + Intergenic
1156240950 18:35253348-35253370 AGGACAGAAGTTCTGCTCTCAGG + Exonic
1156659940 18:39335266-39335288 AGGACAGGTGGTCTTTTCGTGGG + Intergenic
1156800662 18:41109434-41109456 AGGATAGAGGGTCTGTGCTGTGG - Intergenic
1158592339 18:58788446-58788468 AGGACACAGGGTGTGTTCTGGGG - Intergenic
1160449146 18:78950205-78950227 AGGACACAAGTGCTCTTCTTTGG + Intergenic
1163375242 19:16926280-16926302 AGGAAAGAAGGTGTGTTCAGGGG - Intronic
1167223747 19:48222190-48222212 AGGACAGAAGGACTTCTTTTTGG + Intronic
1168632850 19:57971027-57971049 AGGACTCAAGCTCTGTGCTTTGG + Intronic
925368267 2:3325558-3325580 AGGACAGAAGCTCTGTTTTCGGG - Intronic
925432082 2:3803381-3803403 AGGACGCAAGGTCTGTGCTTGGG - Intronic
925797565 2:7563406-7563428 AGGAAAGAAGGTCTCTGCATGGG - Intergenic
928254127 2:29707345-29707367 AGGGTAGAAGGTCTGTGCTCGGG - Intronic
930229483 2:48828239-48828261 AGGATGGAAGGTCTGTGCTGTGG - Intergenic
931543430 2:63354225-63354247 AGGATGGAAGGTCTGTGCTGTGG - Intronic
933751517 2:85604982-85605004 ATGACAGAAGGGCTCTTCATAGG + Intronic
936032189 2:109081418-109081440 AGGCCAGAAGCACTGTTGTTGGG - Intergenic
938041778 2:128082146-128082168 AGGAAAGAAGGCCTTTTATTTGG - Intergenic
938624420 2:133092675-133092697 AGGACAGTAGATAAGTTCTTGGG - Intronic
938707921 2:133949694-133949716 AGGGCAGCAGGGCTGTTATTTGG - Intergenic
939092533 2:137795982-137796004 TGAAAAGAAGATCTGTTCTTTGG - Intergenic
939155365 2:138518370-138518392 AGGAGATAAGGTCTATACTTAGG - Intronic
939863632 2:147447748-147447770 AAGACAGAATTTCTTTTCTTGGG - Intergenic
948529734 2:238596816-238596838 AGGGCAGGAGGACTGTTCATTGG + Intergenic
1168997980 20:2146797-2146819 AGGACAGAAAAACTGTGCTTTGG + Exonic
1172114473 20:32565350-32565372 GGGACAGGAGGTCTGTTGTAAGG - Intronic
1172430910 20:34890832-34890854 AGGACAGAAGCTCTGCTCTCAGG + Intronic
1174109806 20:48190946-48190968 GGAGGAGAAGGTCTGTTCTTTGG + Intergenic
1175284041 20:57825650-57825672 AGGTCTGCAGGTCTGTTCGTAGG + Intergenic
1175967969 20:62669097-62669119 GGGACAGAGGGTCTGCTCTGAGG + Intronic
1176448383 21:6841086-6841108 AGGACAGAGGGGCTGGTCTCAGG - Intergenic
1176826553 21:13706108-13706130 AGGACAGAGGGGCTGGTCTCAGG - Intergenic
1178629299 21:34245321-34245343 AGGATAAAAGGTCTTTACTTGGG - Intergenic
1179708506 21:43195934-43195956 AGGAGAGAAGATCTGATCTGAGG + Intergenic
1180240080 21:46497050-46497072 AGGACAGAACGTCTCTTCGAAGG - Exonic
1181813081 22:25416478-25416500 AGCTCAGAAGGACTGGTCTTGGG + Intergenic
1181831060 22:25560670-25560692 AGCTCAGAAGGACTGGTCTTGGG + Intergenic
1183036188 22:35142595-35142617 ATGACAGAAGGCTGGTTCTTGGG - Intergenic
1183950420 22:41349486-41349508 AGGAGAGAAGCTCTGCTCTCAGG + Intronic
950492893 3:13316890-13316912 AGGACACCAGGACTGTCCTTAGG - Exonic
952078759 3:29731496-29731518 AGGACAGAGGGCATGTTTTTAGG + Intronic
956154259 3:66277815-66277837 AGGACACAATGTCACTTCTTTGG + Intronic
956408542 3:68954178-68954200 AGGACAGAAGGACGGTTTCTAGG - Intergenic
957192286 3:77024996-77025018 AGGACAGAAGGTCTGTTCTTTGG + Intronic
960054055 3:113264170-113264192 AGGTCAGAAGTCCTGGTCTTTGG - Intronic
960841603 3:121964087-121964109 AGGATGGAAGGTCTGTGCTGTGG - Intergenic
962368733 3:134803500-134803522 AGGACTGGAGGTCGGTTTTTAGG + Intronic
962997667 3:140647589-140647611 AGGATGGAGGGTCTGTTCTATGG + Intergenic
963598792 3:147359543-147359565 AGGACAGAAAGCCTGTTCCCAGG - Intergenic
965928413 3:174011834-174011856 AGGAGAGAAGGTTTTTTCTTAGG - Intronic
968550716 4:1222323-1222345 AGGAGAGCAGTTCTGTCCTTAGG - Intronic
971123822 4:23730574-23730596 AGATCAAAAGTTCTGTTCTTTGG - Intergenic
973574580 4:52273876-52273898 AGGAGGGAGGGTCTGTTCTGTGG - Intergenic
974184573 4:58430056-58430078 AGGAGAGAGGGTCTGTCCTGTGG + Intergenic
974211819 4:58787191-58787213 AGTACAGATGCTCTGTTCTCAGG + Intergenic
976300578 4:83511912-83511934 AGGACAAAATCTCTGATCTTCGG - Intronic
981412372 4:144447908-144447930 AGGAGAGACTGCCTGTTCTTCGG + Intergenic
983674333 4:170274701-170274723 GGGAAATAAGTTCTGTTCTTTGG + Intergenic
987505682 5:18768171-18768193 AACAAAGAAGGACTGTTCTTTGG + Intergenic
991282324 5:64929331-64929353 AGAACAGGTGGTCTGGTCTTGGG - Intronic
991562042 5:67964204-67964226 AGGACAGAAGGGTTGTCCCTTGG - Intergenic
993007999 5:82448850-82448872 AGGACAGAAGGTTACTTATTGGG + Intergenic
993546073 5:89215161-89215183 AAGAAAGAAAGGCTGTTCTTTGG - Intergenic
994308935 5:98243336-98243358 AGGACAGAATATCTTTTCTGTGG + Intergenic
994386700 5:99141817-99141839 GGGACAGGCTGTCTGTTCTTGGG - Intergenic
995428711 5:112050775-112050797 AGGATGGAAGGTCTGTGCTGTGG - Intergenic
995985788 5:118171548-118171570 AAGACTGAAGATCTCTTCTTAGG - Intergenic
997200025 5:132004302-132004324 AGGGCACAAGGTCTGTGCTGTGG - Intronic
997602256 5:135148708-135148730 ATGAAAGAAGGGCTGTTTTTAGG + Intronic
997864035 5:137444945-137444967 AGGAAAGAGGCTCTGATCTTGGG + Intronic
998197865 5:140091485-140091507 GAGACAGAAGGTATCTTCTTTGG - Intergenic
998216345 5:140240890-140240912 AGGACAGAATCTCTGCTCCTGGG - Intronic
1001102910 5:168828921-168828943 AGGACTGAAGGCCTCTTCTGGGG + Intronic
1001637958 5:173226234-173226256 AGGACAGATGGTCTCTTAGTGGG + Intergenic
1006892301 6:37439362-37439384 AGGAGAGAAGGAATTTTCTTAGG - Intronic
1007169381 6:39852017-39852039 AGGCCAGTTGGTCTGTGCTTGGG + Intronic
1009719983 6:67456252-67456274 AGGACAGAAAATCGGTTCCTTGG + Intergenic
1010258533 6:73788985-73789007 AAGCCAGAAGCTCTGCTCTTAGG - Intronic
1010537788 6:77052407-77052429 GGTACAGAAGGCATGTTCTTTGG - Intergenic
1010579350 6:77574994-77575016 AGGACAGAGGTTTTCTTCTTCGG - Intergenic
1013309799 6:108882453-108882475 AGGAAAAAAGCACTGTTCTTTGG + Intronic
1013713642 6:112931593-112931615 CTGACAGAAGGAGTGTTCTTGGG - Intergenic
1017049538 6:150377430-150377452 AGGGCAGAAGGTCTATACTATGG - Intronic
1020458168 7:8397806-8397828 AGGACACAATGTCATTTCTTTGG + Intergenic
1021615908 7:22503084-22503106 TAGAGAGGAGGTCTGTTCTTGGG + Intronic
1022196419 7:28071639-28071661 TGGATAGAAGGTCCGTCCTTGGG - Intronic
1022872113 7:34490487-34490509 AGGAAAGAAGGGCTGTGTTTGGG - Intergenic
1023109457 7:36794786-36794808 AGAACAGAAGGTCTATTATTAGG + Intergenic
1023629934 7:42154008-42154030 AGGACAAGAGCTCTGTTCCTGGG + Intronic
1024282789 7:47733305-47733327 AGGGCAGGAAGTCTGTTCTGTGG - Intronic
1024629876 7:51238270-51238292 ACAACAGAAGTGCTGTTCTTTGG + Intronic
1025797998 7:64757799-64757821 AGGTCAGAAGGTCTGTCCAGGGG + Intergenic
1026507442 7:70997386-70997408 AGGCCAAAATGTCTGGTCTTTGG + Intergenic
1028376564 7:90151258-90151280 TAGAGAGGAGGTCTGTTCTTGGG - Intergenic
1028617933 7:92791063-92791085 AGTAAAGAAGGCCTGTTCTAAGG + Intronic
1028884319 7:95913965-95913987 AGGTGAGAAGCTCTGATCTTGGG + Intronic
1028894068 7:96021283-96021305 AGAGCAGAAAGTCAGTTCTTGGG + Intronic
1029373911 7:100166744-100166766 AGGACGGAAGGGCTGGTCGTAGG + Exonic
1029941913 7:104489593-104489615 AGGGCTGCAGGTCAGTTCTTTGG - Intronic
1029943073 7:104500855-104500877 AGGCCAGTGGGGCTGTTCTTGGG - Intronic
1030268274 7:107643158-107643180 AGGAGAGAGGGTCTGGTCTCTGG - Intergenic
1032718268 7:134529334-134529356 AGGATTGAAGGTCTGATTTTGGG - Intronic
1034489252 7:151384534-151384556 AAGATAGAAGGTCTGTGCTAAGG + Intronic
1035292186 7:157846327-157846349 AGGAGAAACGGACTGTTCTTAGG - Intronic
1040771037 8:50976157-50976179 TGGACTGAAGGTCTATTCTTTGG + Intergenic
1041799166 8:61779958-61779980 GTGACAGAAGTTCTGTGCTTGGG - Intergenic
1044681361 8:94781546-94781568 AGGACAGGAGATGTGGTCTTAGG + Intronic
1048392686 8:133983086-133983108 AGGTCAGAGAGTCTTTTCTTAGG - Intergenic
1048489428 8:134879020-134879042 AGAACAAATGGTTTGTTCTTAGG - Intergenic
1051111191 9:13638663-13638685 AGGACTGATGGTCTGTTTTAGGG + Intergenic
1055126147 9:72719768-72719790 AGAACTGAAGGCCTGTGCTTTGG - Intronic
1055954162 9:81758463-81758485 TGGAGAGAAGGTGTGTTCTGTGG - Intergenic
1057413917 9:94844774-94844796 GGGGCAGATGGTCTGTTCCTAGG + Intronic
1058171497 9:101686782-101686804 AGGACAGAGGGTCTGCCCTTAGG - Exonic
1059071209 9:111138234-111138256 AGGACATAAGGGCTCTTATTTGG + Intergenic
1060506122 9:124199557-124199579 AGGCCAGCAGGGCTGTTCCTGGG + Intergenic
1061310085 9:129756378-129756400 AGGACAAAATCTCTGATCTTTGG + Intergenic
1061839560 9:133350022-133350044 AGGACAGGTGGTCTCTTCGTTGG - Exonic
1203520808 Un_GL000213v1:43432-43454 AGGACAGAGGGGCTGGTCTCAGG + Intergenic
1188593540 X:31868671-31868693 AGTAAGGAAGGTCTATTCTTAGG + Intronic
1191033809 X:56004553-56004575 TGGACAGAAGCTGTGATCTTTGG + Intergenic
1192055652 X:67770249-67770271 AGGATGGAAGGTCTGTGCTCTGG - Intergenic
1192429135 X:71100864-71100886 AGCACAGATGGTTTCTTCTTGGG - Exonic
1192804005 X:74493982-74494004 AGACCAGAAGCTCTTTTCTTGGG - Intronic
1193005991 X:76618476-76618498 AGGACAGAGGGTCTGTGTTATGG - Intergenic
1193629400 X:83863731-83863753 AGGACTGAAGGTGTGGTGTTGGG - Intronic
1193858975 X:86640449-86640471 AAGAGAGAAGGTTTGTGCTTTGG - Intronic
1194948099 X:100092121-100092143 AGGACAGAGTGTCTGTGCTGTGG - Intergenic
1195279040 X:103311191-103311213 AGGACGGAAGGTATCTTCTCAGG + Intergenic
1195868919 X:109465199-109465221 TTGATAGAAGGTCTTTTCTTGGG + Exonic
1196634839 X:117990505-117990527 AGGACAAAAAGTATATTCTTTGG + Intronic