ID: 957192623

View in Genome Browser
Species Human (GRCh38)
Location 3:77029351-77029373
Sequence ATGTAGAAGAAAAATGATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 896
Summary {0: 1, 1: 0, 2: 9, 3: 81, 4: 805}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957192623 Original CRISPR ATGTAGAAGAAAAATGATGA GGG Intronic
900052534 1:607156-607178 ATGTAGAAGGAATATGGTAAAGG - Intergenic
901829732 1:11884969-11884991 CTGTAGAGGAAAATTCATGAAGG - Intergenic
902322324 1:15676735-15676757 ATGTAGAAGGGAAGTGATGTGGG - Intergenic
903467375 1:23561093-23561115 ATGTAGGTGAAAGATGCTGAGGG + Intergenic
905596768 1:39214336-39214358 ATGTTGAAGAAACACAATGAAGG - Intronic
905649349 1:39646215-39646237 ATGGAGCAGGAAAGTGATGATGG - Intergenic
905856792 1:41319834-41319856 CTGTAAATGAAAAATGAGGAGGG - Intergenic
906777237 1:48540811-48540833 ATCTAGGAGAAAGATGATGCTGG - Intronic
907065859 1:51482440-51482462 TTGTAGAAGACAACTTATGAAGG + Intronic
907211039 1:52822178-52822200 ATGAGAAAGAAAAATTATGAAGG + Exonic
907233606 1:53024368-53024390 ATGGAGATGAAAGGTGATGATGG + Intronic
907457284 1:54583823-54583845 ATGTGTGAGAAAAATGAGGAGGG - Intronic
907673993 1:56501856-56501878 ATGTAGAGGCAATATGCTGATGG + Intronic
907804616 1:57805895-57805917 ATTTAGAGGAGAAATAATGATGG - Intronic
908436337 1:64110517-64110539 AAGCAGAAGAAAGATGAGGATGG - Intronic
908547748 1:65178581-65178603 AGATAGGAGAAAAATGATCAGGG + Intronic
908594254 1:65669414-65669436 ATGTTGAATAAAAGTGGTGAGGG + Intergenic
908616330 1:65927127-65927149 ATTAAGAAGAAAAATGATATAGG + Intronic
909266600 1:73567182-73567204 ACGTTGAATAAAAGTGATGAGGG - Intergenic
909305381 1:74068903-74068925 ATTTGGAAGAAAAATGTTGGAGG + Intronic
909589769 1:77334077-77334099 AGGTAGAAGAAAAATGATCCAGG - Intronic
909898353 1:81102556-81102578 ATCCAGAAGATAAATAATGAAGG + Intergenic
911127020 1:94350281-94350303 AAGTAAAAGAGGAATGATGAAGG + Intergenic
911525368 1:98978349-98978371 ATGGAGAAGAAGATTGAAGATGG - Intronic
911705677 1:101009584-101009606 ATTTAGAGGAAAGATGATGGTGG - Intronic
911913287 1:103663151-103663173 GGGTAGAAGCAAAAGGATGATGG + Intronic
911915167 1:103688796-103688818 GGGTAGAAGCAAAAGGATGATGG - Intronic
911920700 1:103757289-103757311 GGGTAGAAGCAAAAGGATGATGG + Intronic
912101731 1:106216224-106216246 ATGTACAAAAAAAATGTAGAAGG + Intergenic
912558721 1:110535026-110535048 ATAAAGAATAATAATGATGATGG - Intergenic
913433602 1:118823451-118823473 ATGTAGGAAAAAAATGTAGATGG - Intergenic
913435606 1:118844538-118844560 ATGAAGGAGCTAAATGATGATGG - Intergenic
913690381 1:121274210-121274232 ATGTAGAATTAAAAAGATGTAGG - Intronic
914147160 1:145005749-145005771 ATGTAGAATTAAAAAGATGTAGG + Intronic
915412831 1:155716263-155716285 ACATAGAAGAAAAATGTTGCCGG + Intronic
915807318 1:158867996-158868018 ATGTAATAAAAAAATGATAAAGG + Intergenic
915863545 1:159473545-159473567 CTGTAAAAGAAAATAGATGAAGG - Intergenic
916386499 1:164278425-164278447 ATGTACCAAAAAAATGCTGAAGG + Intergenic
916580965 1:166108100-166108122 ATGTTGAAGAGAAGTGGTGAGGG - Intronic
916870147 1:168904713-168904735 CTGGAACAGAAAAATGATGATGG + Intergenic
916878553 1:168997023-168997045 ATGAAGAAAAAAAATGTTAAGGG - Intergenic
916943990 1:169705821-169705843 ATCTAGAAGAAAGATAATGACGG + Intronic
917338791 1:173953200-173953222 AAGTAGAAGAAAAATAAAAAAGG - Intronic
917476214 1:175371552-175371574 ATGGAAAAGAATAATGACGAAGG + Intronic
917535065 1:175868458-175868480 GTGGAGAAGAAAATGGATGATGG - Intergenic
917585630 1:176424540-176424562 ATATAGAAGAACCATGATTAAGG - Intergenic
918135463 1:181669975-181669997 ATGTAGGAGATAAATTATCATGG - Intronic
918216734 1:182398257-182398279 ATTTAGAAGAAACAGGATTAGGG + Exonic
918288280 1:183080332-183080354 ATGTAGATAATCAATGATGAAGG - Intronic
918375943 1:183909156-183909178 ATGTACAAGAAATAAGATGGGGG - Intronic
918847587 1:189638312-189638334 GTGTGGAAGAGAAATAATGATGG + Intergenic
918966076 1:191350163-191350185 ATGAAGAAGGATAGTGATGATGG + Intergenic
919003462 1:191864811-191864833 ATGTTGAATAACAATGGTGAAGG - Intergenic
919019178 1:192081761-192081783 ATATAAAAGAAAAAAGATGAAGG - Intergenic
919185286 1:194139058-194139080 ATTAAGAAGAATAATGATTATGG + Intergenic
919596072 1:199563720-199563742 AGGCAGAAGAAAAATGATATAGG + Intergenic
919986531 1:202679600-202679622 ATCTAGGTGAGAAATGATGAGGG - Intronic
920144446 1:203846394-203846416 AGATAGAAGAAAAATGCAGAAGG - Intronic
920477700 1:206292698-206292720 ATGTAGAATTAAAAAGATGTAGG - Intronic
920611803 1:207447479-207447501 ATGTATAAGAGAAATTATTAGGG - Intergenic
921435953 1:215122384-215122406 ATTTAAAAGAAAGATAATGAAGG + Intronic
921504307 1:215948656-215948678 ATGTATAATAAAAATCAAGAGGG - Intronic
921630948 1:217433093-217433115 GGGAAGAAGAAAACTGATGATGG - Intronic
922522004 1:226261823-226261845 AAGTAGAAGAACAAAGTTGAAGG + Intronic
923007537 1:230063593-230063615 AGGTAGAAGAAAAAAGGTTATGG - Intronic
924101147 1:240603948-240603970 ATGTACAAGAAACATGGTGCTGG + Intronic
1063035357 10:2281482-2281504 ATGTAAGAGATCAATGATGAGGG - Intergenic
1064103746 10:12484389-12484411 AGGAAGAAGAAACATGATTAAGG + Intronic
1064995427 10:21292698-21292720 AAGCATAAGAAAAACGATGAAGG + Intergenic
1065002296 10:21348050-21348072 CAGGTGAAGAAAAATGATGATGG - Intergenic
1065736594 10:28758684-28758706 CAGTAGAAGAAAAATGGTAAGGG + Intergenic
1065978475 10:30865449-30865471 ATGAAGAAAAAAAATGACAAAGG + Intronic
1066322297 10:34315756-34315778 ATAATGAAGAAACATGATGAGGG + Intronic
1066488296 10:35870572-35870594 ATGTAAATGAAAAAAAATGAAGG - Intergenic
1066661968 10:37745648-37745670 CTGCAGAAGAAAAAAGATTATGG + Intergenic
1068014855 10:51503273-51503295 ATGTAAAACAAAGAAGATGAAGG + Intronic
1068062425 10:52085530-52085552 ATGAGGAAAAAAAATGATGTGGG - Intronic
1068123946 10:52814770-52814792 AAGTAGAAGGAAAAAGAAGAAGG - Intergenic
1068292691 10:55024826-55024848 ATCTAGAATAGAAATAATGAAGG - Intronic
1068328602 10:55530273-55530295 ATGGATAAGAATAATAATGATGG - Intronic
1068515051 10:58015490-58015512 ATGGAGAAGAAAAAGGCTTAAGG - Intergenic
1068532188 10:58202148-58202170 ATCCAGAAGATAACTGATGAAGG + Intronic
1068569469 10:58613349-58613371 CTGTGGAATAAAAAAGATGAAGG + Intronic
1068757499 10:60671246-60671268 ATGTAGTAGAAAAGAGAGGATGG - Intronic
1068815550 10:61306618-61306640 ATGTTGAATAGAAATAATGATGG + Intergenic
1068864288 10:61878715-61878737 ATGAAGAAGAAAGTTGATGGTGG - Intergenic
1069210277 10:65749495-65749517 ATGTAGAGGGAAAAAGATGGGGG + Intergenic
1069316653 10:67112802-67112824 ATGTAGAAGAAAATCCCTGAAGG - Intronic
1069600848 10:69706653-69706675 ATGTTGAACAGAAATAATGATGG + Intergenic
1070347030 10:75554353-75554375 CTGCAGAAGAGAAATGATGTTGG + Intronic
1070421722 10:76243989-76244011 ATGGAGAAGAGATATGAAGATGG + Intronic
1070468690 10:76754362-76754384 ATGCAGAAGAAAAAAGTTGGAGG + Intergenic
1071099888 10:82023391-82023413 ATGTTGAATAAAAGTGGTGATGG + Intronic
1071332771 10:84576231-84576253 ATGGAGAAGAAAAACGAGGAGGG - Intergenic
1071930372 10:90463066-90463088 ATCTAGGGGAGAAATGATGATGG + Intergenic
1072271895 10:93784666-93784688 AGGAGGAAGAAAAATTATGAAGG - Intronic
1072363682 10:94686791-94686813 AGGTAGAATCAAAATGATAAAGG + Intronic
1074123965 10:110513642-110513664 AAGTAAAAGAAAAATAAAGATGG - Intergenic
1074176764 10:111014275-111014297 ATGTAGCAGAAAAATGGCAATGG + Intergenic
1074616300 10:115072285-115072307 ATGTAAAATAAAAATAAAGAGGG + Intergenic
1074812257 10:117117013-117117035 ATGTTGAATAAAAGTGGTGAAGG - Intronic
1075149098 10:119910643-119910665 ATGGAGAGGAGAAATGAGGAAGG - Intronic
1077842551 11:5991343-5991365 ATATAGATGGAAAATGATTAGGG - Intergenic
1078092424 11:8273738-8273760 ATGTTGAATAATAATGATAATGG - Intergenic
1078862215 11:15259592-15259614 CTGTTGAAGAAACAGGATGAGGG + Intergenic
1079519290 11:21306451-21306473 AAGTATAATAATAATGATGATGG + Intronic
1079812855 11:25016927-25016949 AAGTAAAAAAAAAATGATGTCGG - Intronic
1079941071 11:26681226-26681248 ATGAAGAAGAAAAAGGTTAATGG + Intronic
1080374417 11:31691175-31691197 ATTAAGGGGAAAAATGATGAAGG + Intronic
1081313341 11:41600604-41600626 ATGAAGAAAAAAAATGTTAAGGG + Intergenic
1081821732 11:46003657-46003679 ATGTAGAAGAGAAGTAAAGATGG + Intronic
1082963827 11:58945297-58945319 ATTTAGAAAAGAAATGTTGATGG + Intronic
1083002101 11:59301941-59301963 ATGAACAACAAAAATAATGAAGG - Intergenic
1083516857 11:63267941-63267963 AAGAAGAAGAAAAAAGAAGAAGG - Intronic
1084936024 11:72587080-72587102 GTGTAGAAAAAAAAGCATGAAGG - Intronic
1085472045 11:76764646-76764668 ATTTAGCAGAGAAATGATGAAGG - Intergenic
1085679172 11:78554802-78554824 ATGTTGAAGAGAAGTGGTGAGGG + Intronic
1085979474 11:81706252-81706274 ATGTAATAGAGAAAGGATGAGGG - Intergenic
1086264622 11:84983029-84983051 ATATTGAATAAAAAGGATGAGGG - Intronic
1086270398 11:85056958-85056980 AGGTAGAAGGAAAATGATACTGG + Intronic
1086304815 11:85468160-85468182 ATGCAAAAAAAAAATGATAAAGG - Intronic
1086316694 11:85602306-85602328 ATGTAGGGGATAGATGATGATGG - Intronic
1086527295 11:87742799-87742821 AGGTAGCAGAATAATGAAGAAGG + Intergenic
1087342494 11:96925273-96925295 ATGCAAAAGAAAATTAATGAAGG + Intergenic
1087386058 11:97470538-97470560 ATTTAGAATACAAATGAAGATGG + Intergenic
1087601673 11:100324773-100324795 ATGCAGAAGAAACATAATAATGG - Intronic
1087719503 11:101646144-101646166 ATGTTGAATAGAAATGGTGAAGG - Intronic
1087942632 11:104117338-104117360 ATGTTGAAGAGAAGTGGTGAGGG - Intronic
1087968211 11:104445953-104445975 ATCTAGAAGAAAATTGAGGAAGG - Intergenic
1088155909 11:106803133-106803155 ATATAGAAGAAAAATAATTCAGG + Intronic
1089281040 11:117374772-117374794 ATAGAGAAGAAAAACGCTGATGG - Intronic
1089511536 11:119000886-119000908 ATGTGGAAAAAAAAGGGTGAGGG - Intronic
1089531664 11:119133909-119133931 ATGTAGAAGAAAAGGCAAGAGGG - Intronic
1091254279 11:134170113-134170135 AGGTAGATGAGAAATCATGATGG + Intronic
1092307259 12:7314140-7314162 ATGTAGAAGATGAAGGAAGAAGG + Intronic
1092358485 12:7816531-7816553 GTGAAGAAGAAAAAAGAAGATGG - Intronic
1093341202 12:17976138-17976160 TGGTAAAAGAAAAGTGATGATGG - Intergenic
1093415198 12:18912051-18912073 ATGTCTATGAAAAATGATGTTGG - Intergenic
1093544867 12:20335030-20335052 ATGAAGGAGAAAAATGTTAAGGG - Intergenic
1093670746 12:21872032-21872054 ATCTAGAAGAAACATCATGCTGG + Intronic
1093723343 12:22472448-22472470 TTTTAGAAGAAAAAAAATGAAGG - Intronic
1093745151 12:22731740-22731762 ATGTCAAAGACAAATGAGGAGGG + Intergenic
1093922861 12:24879150-24879172 ATGTAAAACACAAATCATGAAGG + Intronic
1094348841 12:29500388-29500410 AGGAAGAAGTAAAAAGATGAAGG + Intergenic
1094749084 12:33384487-33384509 CTGTGGAAGAAAAATGATAAGGG - Intronic
1094799740 12:34019269-34019291 TTTTAAAAGAAAAATGAAGAGGG - Intergenic
1095112529 12:38313588-38313610 TTTTAAAAGAAAAATGAAGAGGG - Intergenic
1095376618 12:41536775-41536797 AAGAAGAAGAAAAATCAAGAAGG - Intronic
1095545625 12:43364685-43364707 AAGAAGAAGAAAAATGAATAGGG + Intronic
1095623914 12:44291530-44291552 ATGTTAAATAGAAATGATGAGGG + Intronic
1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1097345993 12:58493023-58493045 TTGAAGAAGAAAAATGAAGTTGG - Intergenic
1097476594 12:60064662-60064684 ATGGAGAAGAAAAATGGTATCGG - Intergenic
1097489761 12:60251596-60251618 AGGTAGGAGAAAAATTGTGAAGG + Intergenic
1097846366 12:64370734-64370756 AGAAAGAAGAAAAATGCTGAAGG + Intronic
1098017834 12:66125182-66125204 ATGTAGAAGATAAATGAGAAGGG + Intronic
1098059783 12:66549286-66549308 GTGCAGAAGCAAAATGATAAAGG + Intronic
1098139864 12:67440402-67440424 ATGTGTAATAAAAATGCTGATGG - Intergenic
1098352366 12:69576977-69576999 ATGTGGAATAAGAATTATGATGG + Exonic
1098398374 12:70046624-70046646 TGGTAGGAGAAAAATAATGAAGG - Intergenic
1098597161 12:72287188-72287210 ATGAGGAAGAACAAGGATGATGG - Intronic
1098601931 12:72341681-72341703 ATGTAGATGAGAAGTGGTGATGG + Intronic
1099217583 12:79872075-79872097 ATGTAGACAAAAAACTATGAAGG + Intronic
1099239849 12:80125888-80125910 ATGTAATAAAAAAATGATAAAGG - Intergenic
1099359290 12:81679560-81679582 ATGTAGAAGATGAATGAAAAGGG + Intronic
1099406433 12:82269209-82269231 ATGTAGAAAATCAATGGTGAAGG + Intronic
1099547227 12:83999806-83999828 TTTTAGAATAAAAATAATGATGG + Intergenic
1099566089 12:84248074-84248096 AGATATAATAAAAATGATGATGG - Intergenic
1099709100 12:86197041-86197063 ATGTAGAAGCACAGTGTTGAAGG - Intronic
1099985421 12:89657340-89657362 ATGTAGCAGCAAAATGCTTAGGG - Intronic
1100023867 12:90103932-90103954 ATGAAGAAAAAAAATCAAGAAGG - Intergenic
1100028492 12:90158362-90158384 ATGTAAAAAAAAAATGACTATGG + Intergenic
1100085568 12:90905992-90906014 AAGTTGAAGCAAAATGATTAGGG + Intronic
1101302883 12:103499516-103499538 ATGGAGAAGAGAAAGGAAGATGG + Intergenic
1101322432 12:103684397-103684419 TGATAGAAGAAAAATGAGGAGGG + Intronic
1101632271 12:106506534-106506556 ATTTAGCAGAATAATGCTGAAGG - Intronic
1102090832 12:110185989-110186011 CAATAGAAGAACAATGATGAAGG - Intronic
1102605848 12:114066621-114066643 ATATAACAGGAAAATGATGAAGG + Intergenic
1102746988 12:115258064-115258086 ATGGAGAGGAAAAATGGGGAAGG - Intergenic
1102754701 12:115328044-115328066 ATGTGGAAGAAAATTGAGGAAGG - Intergenic
1104159374 12:126163759-126163781 AGGAAGAAGAAAAAGGAGGAGGG + Intergenic
1104209064 12:126669768-126669790 ATGTTAAAGAAACCTGATGAGGG - Intergenic
1104311581 12:127658005-127658027 ATGTACAAGAAGCATGATGCTGG - Intergenic
1104436324 12:128759781-128759803 ATGTATAAAAATAAGGATGATGG - Intergenic
1104705692 12:130945224-130945246 ATATAAAAGCAAAATCATGAAGG - Intergenic
1105672065 13:22630112-22630134 ATGTATAAGCAAATTCATGAAGG + Intergenic
1106734214 13:32572481-32572503 ATCCAGAACAGAAATGATGAGGG - Intergenic
1106897581 13:34321301-34321323 ATGGAGAAGAATCATGATAAAGG + Intergenic
1107339582 13:39391790-39391812 ATGTCCCAGAAAAAGGATGAAGG - Intronic
1107696242 13:43002918-43002940 ATTCAGATGAAAAATGATGGTGG + Intergenic
1108177460 13:47807871-47807893 AAGGAGATGAAAACTGATGAAGG + Intergenic
1108757844 13:53525593-53525615 AGGTAGAAGAAAAATAAACAGGG + Intergenic
1109153671 13:58876844-58876866 ATTTACAAGACACATGATGAAGG - Intergenic
1109881694 13:68486825-68486847 ATGGTGAAGGAAAATGGTGAAGG - Intergenic
1110002766 13:70226483-70226505 ATGTAGAATAAAAAGAATGATGG - Intergenic
1110025043 13:70526596-70526618 ATGTAAAAAAAATAAGATGAGGG - Intergenic
1110418371 13:75277256-75277278 ATGCAGCAAAAAAATGATAAAGG + Intergenic
1110554291 13:76840858-76840880 ATGTAGAAGCAAAATGAGTGTGG + Intergenic
1110643210 13:77850767-77850789 ATGTTGAATAGAAATGGTGAGGG + Intergenic
1110992780 13:82064970-82064992 ATTCAGAAGAAAAATGCAGAGGG + Intergenic
1111096223 13:83518544-83518566 ATGGAAAAGAAAAATGAGGAGGG + Intergenic
1111208651 13:85047311-85047333 ATGGAGAAGAATGATGATGGAGG + Intergenic
1111775187 13:92652773-92652795 ATCTAGAGGAAAGATGATAAGGG - Intronic
1111987821 13:95082745-95082767 ATATAGAAGGAAAATAATTAGGG - Intronic
1112175547 13:97019985-97020007 GTGAAGATGAAATATGATGATGG - Intergenic
1112809716 13:103203676-103203698 AGGGAAAAAAAAAATGATGACGG - Intergenic
1112888485 13:104203797-104203819 AGGTAGAATAAAAATTATTAAGG - Intergenic
1113776552 13:112949852-112949874 ATGTTGAATAAAAGCGATGAAGG - Intronic
1114128614 14:19761793-19761815 ATGTTGAATAAAAATAATCAGGG - Intronic
1114167895 14:20240471-20240493 ATGTAAAAGAAAAATGTGAAAGG - Intergenic
1114505820 14:23212237-23212259 ATGTTGAAGAGAAGTGGTGAAGG - Intronic
1115033966 14:28834876-28834898 ATGTAGAAAACATATGATCAGGG - Intergenic
1115087727 14:29537596-29537618 ATATAGAACACAAATGATAAAGG - Intergenic
1115350828 14:32393691-32393713 ATTAAGAAGAAAAATTATAATGG + Intronic
1115515092 14:34177012-34177034 ATATAGAAGAAAAATTATTTCGG - Intronic
1115720067 14:36151007-36151029 AGGGAGAAGAAAAATGATATAGG - Intergenic
1115740498 14:36382488-36382510 ATCAAGGTGAAAAATGATGAAGG - Intergenic
1115919918 14:38361069-38361091 AGGCAGAAGGAAAATAATGAGGG + Intergenic
1116765332 14:49063483-49063505 ATGAAGAAAAAAAATGTTAAGGG + Intergenic
1117109993 14:52442560-52442582 AATTAGAAGAAAAATGAGAATGG - Intronic
1117202992 14:53411547-53411569 CTAGAGAAGAAAAATGTTGAAGG - Intergenic
1117243947 14:53864719-53864741 ATTCAGATGAGAAATGATGATGG + Intergenic
1117572553 14:57062299-57062321 ATCCAGATGAAAATTGATGAGGG + Intergenic
1118538413 14:66794391-66794413 CTGTACAGGAAACATGATGATGG - Intronic
1119114730 14:72008817-72008839 ATGTAGAAAAAAACTGCTGTAGG + Intronic
1119886873 14:78150915-78150937 AGGGAGGAGAAAAATGATGAGGG - Intergenic
1120114692 14:80601013-80601035 ATGAAGAAGAAAAATCATTAAGG + Intronic
1120610370 14:86634335-86634357 AAGAAGAAGAAAAATGGAGAAGG + Intergenic
1120690892 14:87591059-87591081 ATGAGGAAGGAAAATGAGGATGG + Intergenic
1120737677 14:88072027-88072049 ATGGAGATTAAAAGTGATGAGGG + Intergenic
1120815675 14:88855274-88855296 AAGGAGATGAAAAATGAAGAAGG - Intronic
1121070490 14:91015988-91016010 ATGTAGAAGAAAAAAGTCCAGGG + Intronic
1121880853 14:97499256-97499278 ATTTAGAAGAAGAAGGAAGAAGG + Intergenic
1123571554 15:21616035-21616057 ATGTTGAACAAAAATAATCAGGG - Intergenic
1123893542 15:24805156-24805178 AGGTAGAAGAAAAATGGAGTTGG + Intergenic
1124395410 15:29296236-29296258 ATGTAGAAAAGAGATGATGGTGG + Intronic
1124694643 15:31853814-31853836 TTGTTGAAGAAGAAGGATGAGGG - Intronic
1124968944 15:34465496-34465518 ATCTAGAGGAAAGATGGTGAGGG - Intergenic
1125093253 15:35820137-35820159 ATCCAAAAGAAAAATGATGGAGG - Intergenic
1125167644 15:36727379-36727401 ATTTAGATGATAAATGCTGAGGG - Intronic
1125227049 15:37407675-37407697 ATGTAGAAGAAAATAGATTATGG + Intergenic
1125710996 15:41786336-41786358 AAGTAGAAAAAAAATAAAGATGG + Intronic
1125792703 15:42381254-42381276 AGGGAGAAGAAAAATGATACAGG - Intronic
1125864831 15:43036293-43036315 ATACAGAAGAAATATGATGCTGG - Intronic
1126504036 15:49382022-49382044 GTATAGAATAAAAATTATGAAGG + Intronic
1126656437 15:50982689-50982711 ATGTAAAAAAATAATAATGATGG - Intronic
1126981408 15:54248279-54248301 GTCTAGAAGAAAAATTAGGAAGG - Intronic
1127360692 15:58242476-58242498 AATGAGAAAAAAAATGATGATGG + Intronic
1127434795 15:58946522-58946544 CAGTAGAATAAAAATGATCAAGG + Intronic
1127502845 15:59570753-59570775 AGAAAGAAGAAAAAAGATGAGGG - Intergenic
1127762634 15:62153962-62153984 AGGTAGAAGAAAAATGGGGAAGG + Intergenic
1128160521 15:65420746-65420768 CTGTAGAAGGAGAATGATGATGG - Intronic
1128845378 15:70890184-70890206 ATGAAGAAGAAAAATGGTGTAGG + Intronic
1129422081 15:75436612-75436634 TAGTAGTAGAAAAATGATAATGG + Intronic
1129430612 15:75498777-75498799 GTGTAAAATAAAAATAATGAAGG + Intronic
1129449735 15:75644431-75644453 ATGCAGACAAAAGATGATGAGGG - Intronic
1129623295 15:77169574-77169596 AGGTAGGAGTAAAATGAAGAGGG + Intronic
1129711397 15:77821998-77822020 AGGTAGAAGGAAAATGGTCAGGG - Intergenic
1130356261 15:83133539-83133561 AAGTGGAAGAAAAATTATTAGGG + Exonic
1130573894 15:85073569-85073591 TTTTAGAAGAAAAATCAAGATGG - Intronic
1130661307 15:85833475-85833497 ATAGAAAAGAAAAAGGATGACGG - Intergenic
1130696122 15:86133290-86133312 ATGGAAAAGAAAAATGCTCAGGG - Intergenic
1131418712 15:92284996-92285018 AAGTAGAAGAAAACTGAAGGAGG - Intergenic
1131747535 15:95465319-95465341 AAGTAGTTGAAAAAAGATGATGG - Intergenic
1131910460 15:97194222-97194244 ATGAATAAGAATAATGATGAGGG + Intergenic
1132169319 15:99631773-99631795 ATGAAGAAATAAAATAATGAGGG + Intronic
1132190340 15:99849931-99849953 ATCTAGAGAAAAGATGATGAGGG + Intergenic
1202980408 15_KI270727v1_random:350424-350446 ATGTTGAACAAAAATAATCAGGG - Intergenic
1132752516 16:1465343-1465365 AAGCAGAAGAGAAATCATGAGGG + Intronic
1132952225 16:2569776-2569798 ATCTAGAATAAAAGTGTTGATGG + Intronic
1132962126 16:2630394-2630416 ATCTAGAATAAAAGTGTTGATGG - Intergenic
1133424244 16:5673885-5673907 ATGCAGAAGAGAAAAGCTGAAGG - Intergenic
1135030932 16:19038112-19038134 ATGTAAAACAGAAATGACGATGG - Intronic
1135180680 16:20271540-20271562 ATGCAGAAGAAAAGTGCTCATGG + Intergenic
1135489336 16:22894908-22894930 ATGTCAAAGAGAAATGGTGAAGG - Intronic
1135833767 16:25804287-25804309 ATGCAGAAGAAAAATGAAAAAGG - Intronic
1137837612 16:51608110-51608132 ATCTAGAAAAGAAAGGATGAAGG - Intergenic
1137887820 16:52125847-52125869 ATTTGGAAGAAACATTATGAAGG + Intergenic
1138624441 16:58237849-58237871 ATGTAGACAAAAGATGATGGTGG + Intronic
1138847429 16:60583579-60583601 ATGAAGAATCAAGATGATGAAGG + Intergenic
1138870001 16:60871115-60871137 ATTTAGGTGATAAATGATGATGG + Intergenic
1139171991 16:64641982-64642004 ATATAGAAGAACAAAGCTGAAGG - Intergenic
1140183295 16:72742257-72742279 ATGTAGTAGAAAACTGGTGATGG - Intergenic
1140553020 16:75887780-75887802 ATAAAGAAGAAAAATGATGAAGG + Intergenic
1141167694 16:81671464-81671486 CTTTGGAAGAAAAATGATGAGGG - Intronic
1141711412 16:85701386-85701408 AAGAAGAAGGAAAAAGATGAAGG - Intronic
1141772674 16:86100746-86100768 ATAAAGAAGAAAAATTATAAGGG + Intergenic
1142923299 17:3210141-3210163 ATGGAAAAGAAAAAAGAAGACGG - Intergenic
1142930719 17:3282022-3282044 ATGGAGAAAAACAATGAAGAGGG - Intergenic
1144290285 17:13819698-13819720 AAGTAGAACAAACATGCTGAGGG - Intergenic
1145726223 17:27128291-27128313 GTATATAAGAAAAATAATGAGGG - Intergenic
1146608027 17:34278753-34278775 ATGAAGAAAAAAAATGCTAAGGG + Intergenic
1147291055 17:39443321-39443343 ATTTAAAAGATAAATGATGAAGG - Intronic
1147512213 17:41080769-41080791 ATTTCCAAGAAAAATGTTGAAGG + Intergenic
1147543900 17:41383507-41383529 ATCTAGAAGAAAAAATATGCTGG + Intronic
1148100140 17:45084955-45084977 ATGTATAAGAAAATTTATGCTGG + Intronic
1149911937 17:60574674-60574696 GGGGAGAAGAAAAAAGATGATGG - Intronic
1150879675 17:69009705-69009727 ATCCAGAAGAGAGATGATGATGG + Intronic
1151029297 17:70717582-70717604 ATGAAGAAGAAAAAAAATGATGG - Intergenic
1151084337 17:71363656-71363678 ATGAAGAAGGAAAGTAATGAAGG + Intergenic
1151142934 17:72012302-72012324 ATAAAGAAGCAAAATGATTAGGG + Intergenic
1151401702 17:73859909-73859931 ATGCAGAAGAAAAATGCAGGAGG - Intergenic
1151947537 17:77327730-77327752 ATTTAGAAAAAAAAAGAGGAGGG - Intronic
1152440742 17:80307923-80307945 ATGTATAGGAAAAAAGATCAGGG - Intronic
1153853731 18:9123789-9123811 TTGTAAAAGAAAAATGAGGCAGG - Intronic
1153962876 18:10154298-10154320 AAGGAGAAGAAAAATGATGAAGG + Intergenic
1154051693 18:10966300-10966322 ATGTAGCAGAGAACTGAAGATGG - Intronic
1154372049 18:13773036-13773058 TTGGAGAAAAAAAATGATGCTGG - Intergenic
1155000722 18:21683575-21683597 GGGTAGAAAAAAAATGATGTAGG + Intronic
1155160812 18:23194007-23194029 TTGCAGAAGAAAAATGATTCAGG + Intronic
1155381878 18:25231612-25231634 TTGTGGAAGAGAAATGCTGAGGG + Intronic
1155588946 18:27402399-27402421 AGGTAAAAAAAAAATGATAAAGG - Intergenic
1156100542 18:33588970-33588992 GAGTAGAAGAAAAAAGATGAAGG - Intronic
1156232366 18:35165958-35165980 ATGGAAAAGAAAAAGGAGGATGG + Intergenic
1156640079 18:39084146-39084168 AGGAAGAAGAAAAATGTTAATGG - Intergenic
1157457723 18:47851232-47851254 ATACAGTATAAAAATGATGAGGG + Intronic
1157632602 18:49113607-49113629 CTGTAGAAGAAAAAAGTTGGTGG - Intronic
1157904010 18:51550171-51550193 ATGTTGAAGAAAAGTGAGGGTGG + Intergenic
1157963715 18:52184525-52184547 AAGTGGAAGAAAAATGATGCAGG - Intergenic
1158820094 18:61149527-61149549 ATCTAGCAGCAAAATGATAATGG + Intergenic
1158841471 18:61392616-61392638 ATGTAGCAGAGATATAATGATGG - Intronic
1158875946 18:61734778-61734800 CTGTAGAAGAGATATGCTGAAGG - Intergenic
1158925444 18:62253086-62253108 ATGAAGAAGAAAAATAAAGCAGG + Intronic
1158948333 18:62467518-62467540 ATGTTGAAGAGAAGTGATGATGG + Intergenic
1159061687 18:63520617-63520639 ATATAGAATAAAAGTAATGAAGG + Intergenic
1159266798 18:66090748-66090770 ATATGTAAGAAAAATGAGGAAGG + Intergenic
1159338860 18:67108199-67108221 AGGTAGAATAATAATGAAGAAGG + Intergenic
1159483314 18:69019758-69019780 ATGTTGAATAGAAATGACGAGGG + Intronic
1159591007 18:70335046-70335068 AAGAAGAAGAAAGATGAAGAAGG - Intergenic
1159621212 18:70640891-70640913 AATTTGAAGAAAAAAGATGAAGG - Intronic
1159650903 18:70976347-70976369 AAGTATAAGAAAAATAAGGAAGG + Intergenic
1159979083 18:74754196-74754218 ATGTAATAAAAAAATGATAAAGG - Intronic
1160338215 18:78061764-78061786 TTGATGAAGAAAAATGTTGAGGG + Intergenic
1162285969 19:9739171-9739193 GTGTATAATAAACATGATGATGG + Intergenic
1162611124 19:11754146-11754168 AGGTAGTAGCAAAATAATGAAGG + Intergenic
1163214938 19:15869583-15869605 ATGAAGAAGACAAACGATAAAGG + Intergenic
1164143759 19:22497072-22497094 AAATAGAATAAAAATGATGATGG - Intronic
1164410520 19:28001027-28001049 ATGTGGATGAAAACTGAGGATGG + Intergenic
1164485408 19:28651656-28651678 CTGAAGAATAAAAATGGTGAGGG - Intergenic
1165636927 19:37348084-37348106 ACGGAGAAGACAAATGAGGAAGG - Intronic
1165834256 19:38744593-38744615 ATGGAGAAGAAACATGAAGGCGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166433494 19:42746794-42746816 ATGTAATAAAAAAATGATAAAGG - Intronic
1167073696 19:47235999-47236021 AGGAAGAAGAAAAAAGAAGAAGG - Intergenic
1167615783 19:50532304-50532326 GTGTAGAGGAAAGATGCTGAGGG - Intronic
1167984792 19:53305477-53305499 AAATAGAAAAAAAATGATCAAGG + Intergenic
1168128526 19:54301170-54301192 AAATAAAAGAAAAATGATGTTGG + Intergenic
925541304 2:4970611-4970633 AAGTGGGAGAAAAATGAAGAGGG - Intergenic
926097411 2:10091208-10091230 AAGCAGAAGAAAAATGAGAAGGG + Intergenic
926451638 2:13011345-13011367 AGGTAGAAGAAAAATGAAATAGG - Intergenic
926494721 2:13571921-13571943 ATTCAGATGAGAAATGATGATGG - Intergenic
927533274 2:23830856-23830878 ATGTAAAAAAAAAATTATGCTGG + Intronic
927863656 2:26575664-26575686 ATTAAGAAAAAAAAAGATGAAGG - Intronic
928150396 2:28823065-28823087 ATGTAAAAGGGCAATGATGATGG - Intronic
928563879 2:32522073-32522095 ATAGAGAAAAAAAATGATGGGGG - Intronic
928594618 2:32848079-32848101 ATTTACAAACAAAATGATGAGGG - Intergenic
928769531 2:34690075-34690097 ATTTTGAAGAAAAATTCTGATGG + Intergenic
928790986 2:34952831-34952853 TTGTAAAAGAACAATGTTGAAGG + Intergenic
928830724 2:35479323-35479345 ATGAAGGAAAAAAATGTTGAGGG + Intergenic
929336748 2:40756931-40756953 ATGCAAAAGAAAAATAATGCTGG - Intergenic
929910954 2:46089185-46089207 ATGTAGAATAAGAATGAGGAGGG - Intronic
930225890 2:48792658-48792680 TAGGAGAAGAAAGATGATGATGG - Intergenic
930309555 2:49722151-49722173 ATGTAGAATACAAATGAAAACGG + Intergenic
930350064 2:50240382-50240404 ATGTAGAAGAGAGCTGAGGAAGG - Intronic
930522590 2:52486235-52486257 AAGTAGAGGAATAAGGATGACGG - Intergenic
930624306 2:53679469-53679491 ATGGAGAAGAAAGATGAGGATGG - Intronic
930880473 2:56264553-56264575 ATGCAGGAGACAAATGATGGTGG - Intronic
931043784 2:58327041-58327063 ATGAAGGAAAAAAATGATAAGGG + Intergenic
931058560 2:58501036-58501058 TTTTAGAAGAAAAATGATTTTGG + Intergenic
931174235 2:59836858-59836880 TTGAAGAAGAATACTGATGAAGG - Intergenic
931313521 2:61104948-61104970 AACTAGAAAAAAAATGTTGATGG + Intronic
932426016 2:71635775-71635797 AAGAAAAAGAAAAAAGATGAAGG + Intronic
932766012 2:74470638-74470660 ATAGAGAAGAAAAAGAATGAAGG + Intergenic
933283637 2:80359830-80359852 ATGTTGAAGAAAAATTAGGTTGG - Intronic
933335377 2:80951226-80951248 ATGGAGATGAAAAATGAAGCTGG - Intergenic
933569827 2:83996619-83996641 ATGTTAAAAAAAAATGAAGAAGG - Intergenic
933686445 2:85145393-85145415 ATGAGGAAGAAAAATGAAGTAGG + Intronic
935660221 2:105460464-105460486 ATGGAGAAGAAAAATGTAGGAGG + Intergenic
935704835 2:105847379-105847401 TTGTAGAAAAGAAATGATGTGGG + Intronic
935829428 2:106985210-106985232 ATGTAGCTGGAAAATGGTGAGGG + Intergenic
935871304 2:107452998-107453020 TTGTTGAAGAAAACTGGTGATGG - Intergenic
936548565 2:113414292-113414314 ATAGGGAAGAAAAATGAGGAAGG - Intergenic
936763812 2:115819606-115819628 AAGTAGAAGAAAAATAATAATGG - Intronic
936809669 2:116382784-116382806 AGGCAGAAGAAAAATGATAGAGG - Intergenic
936929144 2:117768861-117768883 ATGTAATAAAAAAATGATAAAGG - Intergenic
936930294 2:117781448-117781470 ATGTAATAAAAAAATGATAAAGG + Intergenic
937310613 2:120900600-120900622 CTGTGGAAGAAACAAGATGAGGG + Intronic
937503582 2:122511105-122511127 ACGTACAAGAAAAATGAGAAAGG - Intergenic
937910108 2:127071439-127071461 ATGTAGAGGGAAAAGGCTGAGGG + Intronic
937992357 2:127671733-127671755 AAGTAGAAGAAAAAGGAAGGAGG + Intronic
939076538 2:137609298-137609320 ATGGAGAAGAAAAAATATGTAGG + Intronic
939294522 2:140242886-140242908 ATGTTGAAGAAAATTTAGGAAGG + Intronic
939345339 2:140958526-140958548 ATATAAAAGAGAAATCATGAAGG + Intronic
939365633 2:141226863-141226885 ATGTGGAAGTAATTTGATGATGG - Intronic
939374904 2:141351841-141351863 AGCTAGAAGAAAAATGAAGATGG + Intronic
939430451 2:142099074-142099096 ATATAGAATAAAAATGAGAATGG + Intronic
939893262 2:147762616-147762638 CTGAAAAAGAAAAGTGATGAGGG - Intergenic
939894506 2:147775494-147775516 ATCTAGGAGAAGAATGATCAGGG + Intergenic
939914975 2:148028862-148028884 ATATAGAAGGAAAATGATTTTGG - Intronic
939918717 2:148081782-148081804 ATGTAGAATAAGAATGGGGAAGG - Intronic
940433996 2:153629196-153629218 ATGCAAAAAAAAAATGATAAAGG - Intergenic
940549536 2:155135658-155135680 TTGTTAAAGAATAATGATGAAGG + Intergenic
940568697 2:155403237-155403259 ATGTAGAAAAAACAGTATGAAGG - Intergenic
941038756 2:160597214-160597236 ATGTAGAAAAAATATAAAGAGGG + Intergenic
941039662 2:160606848-160606870 ATTCAGTAGAAAAATGGTGAAGG - Intergenic
941108744 2:161393696-161393718 AAGTAAAAGAAAAAAAATGATGG - Intronic
941354833 2:164477816-164477838 TTGTAGAATAAATATGTTGATGG - Intergenic
941382026 2:164805035-164805057 ATCTAGAAGACAAATGATGATGG + Intronic
941419581 2:165266090-165266112 TTGTAGAAGAAAATCTATGATGG + Intronic
941950092 2:171146510-171146532 ATATAAAAGAAAAAATATGACGG + Intronic
941973596 2:171379545-171379567 AAATAGATGAAAAATGATAAAGG + Intronic
942092579 2:172508312-172508334 ATCTAGGAGGAAAATCATGAGGG + Intergenic
942176789 2:173342343-173342365 ATCTAGACAAGAAATGATGAGGG - Intergenic
942283717 2:174392537-174392559 ATATAGGTGAAAGATGATGAGGG + Intronic
942342147 2:174959963-174959985 ATGCTGAGAAAAAATGATGATGG + Intronic
942346725 2:175010823-175010845 AGATAAAAGAAGAATGATGATGG + Intergenic
942602189 2:177652700-177652722 ATGAAGGAGAAAAATCATGATGG + Intronic
943017991 2:182537662-182537684 ATGAACAAGAAAAATTAAGAAGG + Intergenic
943026705 2:182638162-182638184 AAATAGAGGAAAAAGGATGAGGG + Intergenic
943332260 2:186573523-186573545 ATTAAGAGGAAAAATGAGGAAGG + Intergenic
943521765 2:188960600-188960622 ATGTTGAATAGAAATGGTGAAGG + Intergenic
943839640 2:192562435-192562457 TGGTAGAATAAAAATGATGTAGG + Intergenic
943921859 2:193717550-193717572 ATGAAGAAGTAAAATAATGTTGG + Intergenic
943949991 2:194121209-194121231 ATGTAGATGAAAACTTCTGAGGG + Intergenic
944066876 2:195628628-195628650 ACTTTGAAGAAAAAGGATGAGGG + Intronic
944208178 2:197179239-197179261 TTGAAAAAGAAAACTGATGAGGG - Intronic
944312144 2:198245495-198245517 ATGTTCCAGAAAAATGATAATGG - Intronic
944472535 2:200069833-200069855 ATGTTGAAGAGAAATGAGAATGG - Intergenic
944543081 2:200772388-200772410 ATGTAGGAAAAAAATGCTAAAGG + Intergenic
945281461 2:208039423-208039445 ATGTGGAAGAAAAAGATTGAGGG - Intergenic
946718453 2:222578541-222578563 ATGTAAAAGAAAAAGGAGGCCGG + Intronic
947242264 2:228008259-228008281 ATGTAGGAGAAAAATCTAGATGG - Intronic
948131691 2:235605514-235605536 AGGGAGAAGATAAATGATGCCGG - Intronic
949038031 2:241827748-241827770 AAGTAGAAGAAAAATGATTCTGG + Intergenic
1168732109 20:93560-93582 AGGTTAAAAAAAAATGATGAAGG - Intronic
1168950450 20:1796552-1796574 ATGGTGAAGAGAAATGATGTGGG - Intergenic
1169107838 20:3012307-3012329 AGGTAGATCACAAATGATGAGGG + Intronic
1169904614 20:10589422-10589444 ATGAAGAAGAAAAATAATGTTGG + Intronic
1170321950 20:15109993-15110015 ATGTACAAGGAACATGATGATGG + Intronic
1170511827 20:17085520-17085542 ATGTAGTAGAGAAAAGTTGATGG + Intergenic
1171353733 20:24526684-24526706 AGGAAGAAGAAAAATAATGCTGG - Intronic
1172486438 20:35300748-35300770 AGGGATAATAAAAATGATGAGGG + Intergenic
1172536933 20:35681079-35681101 CTTTAGAATAAAAAAGATGAAGG + Intronic
1172822004 20:37744730-37744752 TTGTAGTAGAATAATGATAAGGG + Intronic
1173092570 20:39987346-39987368 AAGTAGAAAAAAAATGTTAAAGG + Intergenic
1173170580 20:40720394-40720416 ATGCAGCAGAAAAACAATGAAGG - Intergenic
1174095005 20:48081591-48081613 ATGTTGCAGAAAACAGATGAAGG + Intergenic
1174725341 20:52855838-52855860 ATGAAGAAAAACAATGAGGAAGG - Intergenic
1174810210 20:53638988-53639010 ATCTGGATGACAAATGATGAGGG + Intergenic
1175254913 20:57636128-57636150 AGGGAGAAGAAAAATGATGTAGG + Intergenic
1175620535 20:60443186-60443208 AGGCAGAAGAAAAATGACAATGG - Intergenic
1175624556 20:60479519-60479541 AGGAAGAAGTAAGATGATGAAGG - Intergenic
1176593323 21:8664338-8664360 ATGTTGAAATGAAATGATGAAGG + Intergenic
1177279720 21:18965384-18965406 AAATAGAATAAAAATGATGAAGG + Intergenic
1177534381 21:22405229-22405251 AGGTAGGAGAAATAAGATGAAGG + Intergenic
1177754164 21:25324365-25324387 ATCTAGAAGAAAAAAGGAGAAGG + Intergenic
1178181568 21:30167966-30167988 ATGTAAAAGAAAAAGGAAAAGGG - Intergenic
1178237032 21:30854898-30854920 AAGTAGAACAAAAATAAAGAAGG + Intergenic
1179244837 21:39623932-39623954 ATGTAGCAGATACATGAAGAGGG - Intronic
1179297261 21:40074521-40074543 ATGTAGCAAAAACATAATGAAGG - Intronic
1179900219 21:44388468-44388490 ATGGAGAAGGACAGTGATGATGG + Intronic
1181323601 22:22027334-22027356 AGGTGGAAGATAAATGATAATGG + Intergenic
1181352100 22:22266409-22266431 ATATAAAAAAAAAATGTTGAAGG + Intergenic
1181381857 22:22511261-22511283 ATCTGGAACAAAAAGGATGATGG - Intergenic
1182409013 22:30166024-30166046 ATGAAAAAGAAGAATAATGAGGG - Intronic
1182864207 22:33588392-33588414 CTCTAGAAGAAAGATGAGGAAGG + Intronic
1183754206 22:39744131-39744153 AGGTAGAAGACAACTGTTGATGG + Exonic
1183826805 22:40394747-40394769 ATCTAGAAGAGTAGTGATGAGGG - Intronic
1184006223 22:41711437-41711459 GCCTAGAAGGAAAATGATGAAGG - Intronic
1184447856 22:44562002-44562024 ATGTAGAAGTAAAATCATGGCGG + Intergenic
1184738599 22:46413637-46413659 ATGTAAAAGAAAAATGAAAAAGG - Intronic
1185200069 22:49496427-49496449 ATGTTAAAGAAAAATAAAGATGG - Intronic
1185281032 22:49969982-49970004 ATGTAGCAGAAACATGGTGAGGG + Intergenic
949121385 3:388764-388786 TTATAGAAGAAAAATGGAGAAGG + Intronic
949570963 3:5292620-5292642 ATCTATCAGAAAAATAATGAAGG - Intergenic
949583696 3:5416041-5416063 ATGTAATAAAAAAATGATAAAGG + Intergenic
949862380 3:8517897-8517919 ATGGAGAACAAAATTCATGAAGG + Intronic
951020057 3:17773594-17773616 TTTTAGCAGAATAATGATGATGG - Intronic
951385754 3:22040164-22040186 ATGTGTAAGGAAAATCATGAGGG - Intronic
951666217 3:25127051-25127073 ATGCAGGCGAAAGATGATGATGG - Intergenic
952443316 3:33355540-33355562 ATGAAGAAGAACAAAGTTGAAGG + Intronic
952561635 3:34601796-34601818 ATGTAAAAGAAAATCAATGAAGG + Intergenic
952654258 3:35765273-35765295 CCGAAGAAGAAAAAAGATGAGGG - Intronic
954350162 3:50036709-50036731 AAGTAGAACAAAAAGGATTAGGG + Intronic
955210650 3:56937575-56937597 ATGTAGAAGACAACACATGAAGG + Intronic
955397929 3:58570107-58570129 GTATAGAAGTAAAATGATAACGG + Intronic
956238237 3:67099176-67099198 GGGTAGAAGAAAAATGATATAGG + Intergenic
956252483 3:67249338-67249360 ATTTAGAAAGAAAATCATGAAGG + Intergenic
956317178 3:67951078-67951100 AGGCACAACAAAAATGATGAAGG + Intergenic
956527088 3:70177038-70177060 ATATACAAGAAAGATGATGCAGG + Intergenic
957192623 3:77029351-77029373 ATGTAGAAGAAAAATGATGAGGG + Intronic
957273500 3:78061424-78061446 ATATAGAAGAGAAATTAAGAAGG - Intergenic
957477594 3:80746489-80746511 CTGAAGAGGAAAAATTATGATGG + Intergenic
957545157 3:81627563-81627585 ATGTGGAAGTAAAATAAAGAGGG + Intronic
957753420 3:84454376-84454398 ATGTAGAAGAAAACTCATTATGG + Intergenic
957840659 3:85664582-85664604 ATAAGGAAAAAAAATGATGATGG - Intronic
957900485 3:86482532-86482554 ATGAAGAAGAGAAAGCATGAAGG - Intergenic
958438591 3:94128303-94128325 ATACAGAAGAATAATGATGGTGG + Exonic
958788309 3:98623054-98623076 CTGTACAAGAAGCATGATGAGGG + Intergenic
958843722 3:99240276-99240298 AGGTAGTGGAAAAATGATGTAGG - Intergenic
958868429 3:99528333-99528355 ATGAAGAAGAAAAATAATTAAGG - Intergenic
958965947 3:100558398-100558420 TTGTAGAAGATAAAGGCTGATGG - Exonic
959236675 3:103731677-103731699 AGGTAAAAGAGATATGATGATGG - Intergenic
959338786 3:105100933-105100955 AAGTAGAAGAAAAATGTTGATGG - Intergenic
959572257 3:107897323-107897345 AGGTAAAACAAAAATGGTGATGG - Intergenic
959577719 3:107952286-107952308 ATTTAGAAGAAGAATAAGGAGGG + Intergenic
959869031 3:111305167-111305189 ATTTAGGTGAAAAATGGTGAAGG + Intronic
959977310 3:112475084-112475106 ATTTAGAAGGAAGATAATGATGG + Intronic
960184603 3:114623494-114623516 ATGCAGAAGAATAAAGAAGAGGG + Intronic
960340569 3:116470058-116470080 ATTTAGAAAGAAAATGATTAAGG - Intronic
960427825 3:117530790-117530812 AAGGAGAAGAAAGATGAAGAGGG - Intergenic
960553269 3:119000644-119000666 ATTCAGATGAGAAATGATGATGG - Intronic
960562191 3:119096992-119097014 ATGTGGAAGAATAATCAAGATGG - Intronic
960734760 3:120766592-120766614 GTTTAGAAGATAAAAGATGAAGG - Intronic
960912012 3:122658710-122658732 AGGTAGAAGAAAAATGTTTAAGG + Intergenic
962463316 3:135634688-135634710 ATTTTGAAGAAATATTATGAAGG + Intergenic
962503542 3:136021172-136021194 ATTTAGGAGATAAATAATGAGGG + Intronic
963076612 3:141353209-141353231 CGGTAGAAGAGAAATGGTGAAGG - Intronic
964024853 3:152060120-152060142 ATGTAGAAAATAAATGCTAAAGG - Intergenic
964470587 3:157050220-157050242 ATGTAGAAGACATTTGGTGAAGG + Intergenic
964818049 3:160738586-160738608 ATGTAGCAGAAAAATAAACATGG + Intergenic
964941878 3:162167952-162167974 ATGCAGAAGAAAAATGAAAGGGG - Intergenic
965006649 3:163034998-163035020 ATATAGAAGAAAAAAGTAGAAGG - Intergenic
965289461 3:166860654-166860676 ATCTAAAGGCAAAATGATGATGG - Intergenic
965632284 3:170745548-170745570 ATGTAGAAGAAAACAGAGTAAGG - Intronic
965925207 3:173970506-173970528 ATGTGGAAGCCAGATGATGAAGG + Intronic
966205797 3:177405006-177405028 ATGTAGAAGAAAAGGAATGGTGG + Intergenic
966388765 3:179429498-179429520 GTTCAGAAGAAAAAAGATGAGGG + Intronic
966660914 3:182413554-182413576 ATTGAGAAGAAAAATGCTAAGGG + Intergenic
966767405 3:183475674-183475696 AAGGAGAAGAAAAATGTAGATGG + Intergenic
966905010 3:184515792-184515814 ATGTTGAATAATAATGATCATGG + Intronic
967337140 3:188357146-188357168 AAGAAGAACAAAAATGATTAAGG + Intronic
967709952 3:192695414-192695436 ATGTACATGCAAAATGATAATGG - Intronic
968227515 3:196983613-196983635 ATGTAGAACAGAGAGGATGAGGG - Intergenic
968466777 4:755874-755896 CTGAAGAAGAAAAATGAGGAGGG - Intronic
968794738 4:2695286-2695308 ATGAAGAAAAAAAATCATTATGG - Intronic
969955206 4:10882414-10882436 AAGAAGAAGAAAAAGGAAGAGGG - Intergenic
970017331 4:11526579-11526601 ATGCAGAAGAAAGATGATGCAGG - Intergenic
970122362 4:12770819-12770841 TGGGTGAAGAAAAATGATGAGGG + Intergenic
970422216 4:15915953-15915975 ATGTTGAAGATAAATGATAATGG - Intergenic
971278280 4:25218535-25218557 ATGTAAAAGAAAAGTAATCATGG + Intronic
971399322 4:26261429-26261451 AAGTAGAAAAGAAATGAGGAAGG + Intronic
971655250 4:29336006-29336028 TTATAGAAGAAAAAGGAGGAAGG - Intergenic
971743310 4:30547480-30547502 AAGGAGAAGAATAATTATGAAGG + Intergenic
971894032 4:32566775-32566797 ATGTTGAAGGAAAATGATGATGG + Intergenic
972250106 4:37290801-37290823 GTGAAGAGCAAAAATGATGATGG - Intronic
972645020 4:40959506-40959528 ATTTAGAAGAATAATGACGTTGG - Intronic
973059413 4:45701994-45702016 ATGTAGAAAAACAATGACTATGG + Intergenic
973148883 4:46863405-46863427 TTGTAAAAGAAAATTCATGAAGG + Intronic
973948881 4:55990057-55990079 ATTTACAAGAAAAAAGAAGATGG - Intronic
973996225 4:56462124-56462146 ATGAAGAATCAAAATGAGGACGG + Intergenic
974359489 4:60858118-60858140 AATTAGAAAAAAAATGATTAGGG - Intergenic
974801449 4:66824200-66824222 ATGCTGAATAAAAGTGATGAGGG + Intergenic
974805715 4:66877662-66877684 ATCCAGAAGAAAAAAGATGATGG + Intergenic
975048718 4:69832374-69832396 ATGTTGCAGAAAAATCAGGAGGG + Intronic
975146688 4:70975313-70975335 ATATAAAAGATAAATCATGATGG - Intronic
975293408 4:72704101-72704123 ATGTAAAAGAAAGATGAGAAAGG + Intergenic
975425601 4:74223399-74223421 AAGTAGGAGCTAAATGATGAGGG + Intronic
975549330 4:75594957-75594979 GTTTAGCAGAAGAATGATGAGGG + Intronic
975951331 4:79775417-79775439 ATGTTGAATAAAAGTGGTGAAGG - Intergenic
976177060 4:82365390-82365412 TTTTAGAAGAATAATTATGATGG - Intronic
976366110 4:84234139-84234161 ATGGAGAATAAAAATGATGAAGG + Intergenic
976380881 4:84396936-84396958 ATGAAGAAGAAAAAATATGATGG + Intergenic
976537445 4:86234687-86234709 ATTAATAAGAAAATTGATGATGG - Intronic
976891801 4:90057582-90057604 ATTTAAAAGAAAAATCCTGAAGG - Intergenic
976897001 4:90125416-90125438 AGGTAGAAGAAAAATGCCAAAGG + Intergenic
976921041 4:90443281-90443303 ATGCAGAAGAATAATGATGCTGG - Intronic
976965074 4:91027984-91028006 ATGGAAAAGAAAAAAGAAGAGGG + Intronic
977011046 4:91633735-91633757 ATGTCGAAGTAAAATGAGAAGGG - Intergenic
977373839 4:96174350-96174372 AGGGAGGAGAAAAATGAGGAGGG - Intergenic
977432449 4:96947703-96947725 ATGTAAAAGAAAAAAGAGAAAGG + Intergenic
977629824 4:99229965-99229987 ATGTAATAAAAAAATGATAAAGG - Intergenic
977656404 4:99526034-99526056 ATGTTGAATAGAAATGATGAGGG + Intronic
977921432 4:102647867-102647889 ATACAGGAGAAAACTGATGAAGG + Intronic
978068331 4:104434189-104434211 ATTTAGAATAAAAATTTTGATGG - Intergenic
978288611 4:107109990-107110012 ACTTAAAAGAAAATTGATGAGGG - Intronic
978317565 4:107456404-107456426 ATGCAGAACAAAAAAGAAGATGG + Intergenic
978506159 4:109459175-109459197 ATGTGGAAGAAAACTGAAGCAGG + Intronic
979012685 4:115391362-115391384 ATGTTGAATAGGAATGATGAGGG - Intergenic
979048927 4:115904848-115904870 ATGTTGAAGGAGAATGAAGAGGG + Intergenic
979156944 4:117406145-117406167 GTGGAGAAGAAAAATCAAGATGG + Intergenic
979177560 4:117682998-117683020 ATGCAATAGAAAAATGATAAAGG - Intergenic
979226539 4:118292282-118292304 ACGTAGTTGAAGAATGATGATGG - Intronic
979369603 4:119868448-119868470 AGGTAGAAGGAACATGAAGAAGG + Intergenic
979605116 4:122630339-122630361 ATGTAGGAGAAAGATGATTTGGG + Intergenic
979785378 4:124711445-124711467 ATGAGGAAGAAAAATGCAGAAGG - Intronic
979969629 4:127117945-127117967 ATTTAGTAGAGAAATGATGTTGG - Intergenic
980006390 4:127547188-127547210 GTTTAGCAGACAAATGATGAGGG + Intergenic
980242595 4:130196412-130196434 ATATAGAATAAGAATGATAAGGG - Intergenic
980270725 4:130580792-130580814 ATGCAGAAGAGAAATCATGGAGG - Intergenic
980954191 4:139411430-139411452 GTCCAGATGAAAAATGATGATGG + Intronic
981375296 4:144008247-144008269 ATGTAGCAGAAAGAGAATGAGGG + Intronic
981385916 4:144130446-144130468 ATGTAGCAGAAAGAGAATGAGGG + Intronic
981818521 4:148859221-148859243 ATGTTGAAAATGAATGATGATGG + Intergenic
982250384 4:153400207-153400229 ATGGTGATGAAAAATGATAAAGG - Intronic
982317868 4:154049300-154049322 ATGGAGAAAAAAAATCATGTAGG + Intergenic
982941383 4:161561758-161561780 ATGTAGAAGAAAAAGAATTCTGG - Intronic
983363039 4:166751072-166751094 ATGGAGAAGAAAAGTGATTAAGG - Intronic
983439860 4:167767956-167767978 ATATTGAATAAAAATGGTGAGGG + Intergenic
983447299 4:167869552-167869574 ACGTGGAAGCTAAATGATGAGGG - Intergenic
983840676 4:172454206-172454228 ATGTAGAGGAAAACACATGAGGG - Intronic
983851059 4:172581506-172581528 ATGTAGAAGAGAAGAGCTGATGG - Intronic
984036367 4:174673100-174673122 AGGATGAAAAAAAATGATGAGGG + Intronic
984519334 4:180783342-180783364 AGGTTGAAGAAAAATGAATAGGG - Intergenic
984546574 4:181111617-181111639 ATGGAGAAGAAAACAAATGACGG - Intergenic
984737941 4:183128575-183128597 AAGTAGAAAGTAAATGATGAAGG - Intronic
984967214 4:185149864-185149886 ATGTATGAGAAAAATTATGGAGG + Exonic
985202050 4:187494093-187494115 ATGTGGAAGAAAAATGGAGCAGG + Intergenic
985377039 4:189351969-189351991 ATGCAGAAGAAAAATTATATAGG + Intergenic
986128271 5:4903964-4903986 ATAAAGAAGAGAAATCATGAAGG - Intergenic
986811979 5:11369711-11369733 GTGTTGAAGAAAAATGAGGCAGG + Intronic
986918548 5:12657068-12657090 ATCTTAAAGAAAATTGATGATGG + Intergenic
986981865 5:13457402-13457424 ATACAGAAGAGAAAAGATGAGGG + Intergenic
987154045 5:15070003-15070025 TTGTAAAGGAAAAATGAGGAGGG + Intergenic
987430242 5:17824184-17824206 ATGTTGAATAAGAGTGATGAGGG - Intergenic
987434328 5:17875642-17875664 ATGTAGAAGAACAAAAATGATGG + Intergenic
988106075 5:26750156-26750178 AAGGAGAAGAAAAAAGAGGAGGG - Intergenic
988219964 5:28331999-28332021 ATGAAGAAGAAAAAAGAGTATGG - Intergenic
988554169 5:32222004-32222026 ATTGTGAAGAACAATGATGATGG + Intergenic
988645542 5:33091673-33091695 ATGTGGAAGAAAAATATTAAAGG - Intergenic
988787340 5:34577255-34577277 TTCTGGAAGAAAAATGATGTAGG + Intergenic
989279023 5:39620822-39620844 GTGGAGAAGAAAAAGGATGTAGG - Intergenic
990370292 5:55110872-55110894 ATGTTGAAAAAATATTATGACGG - Intergenic
990897708 5:60716402-60716424 ATGTTGAATAAAAATAATGAAGG - Intergenic
991268039 5:64745923-64745945 ATGTAGAAGAAAAAAAAAGGTGG + Intronic
991292002 5:65042228-65042250 AGGAAGAAGAAAAATGCTGGAGG - Intergenic
991395560 5:66201358-66201380 ATGTAGAGGAACAAGAATGATGG - Intergenic
992899836 5:81283051-81283073 ATGAAGAATAAAAAGAATGAAGG - Intergenic
993007707 5:82446209-82446231 AGGAAGAAGAAAAATGTTGTTGG + Intergenic
993290579 5:86063044-86063066 AGGTAGAAGAAATGTGAGGAAGG - Intergenic
993355690 5:86904423-86904445 ATGGAGAAGAGAGGTGATGAAGG - Intergenic
993516806 5:88846701-88846723 ATGCAGTAGAAAAAAGAAGAAGG - Intronic
994045460 5:95304415-95304437 GTGTAGAAGGAAAATGAAAAAGG + Intergenic
994180692 5:96762714-96762736 ATGTATAAGAAAAAATATAAAGG - Exonic
994232464 5:97323782-97323804 ATGTAGGAGAATAATGGTGGTGG - Intergenic
994255304 5:97586654-97586676 ATGTAGAAGAACAAAGAAGTTGG + Intergenic
994719137 5:103360725-103360747 AGGCAGAAGAGAAATGATGGAGG + Intergenic
994987215 5:106951954-106951976 ATATAGAAGTATAATGATTAAGG - Intergenic
995559564 5:113365715-113365737 CTGTAGAGGAAACATGATGCTGG + Intronic
996053772 5:118962597-118962619 ATGGAGAAGAAAAAGGAAGTGGG + Intronic
996555619 5:124776307-124776329 GTGCAGAAGCAAGATGATGATGG + Intergenic
996592448 5:125162410-125162432 ATGAAGAAAAAAAATGTTAAGGG + Intergenic
996819872 5:127614866-127614888 ATATAGAACAAAACTGATGTCGG + Intergenic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
997153296 5:131523594-131523616 ATGGAGAGGAAAAAAGGTGAAGG + Intronic
997888644 5:137655425-137655447 ATGTAAAACAAAAATTATAAAGG + Intronic
998343321 5:141438308-141438330 ATGTATAAGAAAAATTATGGTGG - Intronic
998707715 5:144782910-144782932 TTGTGGAAGCCAAATGATGAAGG + Intergenic
999115209 5:149156865-149156887 ATTTAGAAGAATAAAGGTGAAGG + Intronic
999330556 5:150671196-150671218 ATGTGGCAGAAAAATAAAGATGG + Intronic
999564046 5:152837980-152838002 CTGTAGAAGATGAATAATGAGGG + Intergenic
999599998 5:153252302-153252324 ATGTACAAGAAACATGGTGCTGG + Intergenic
999938796 5:156517560-156517582 ATGAAGAAAAAAAATGTTTAGGG + Intronic
1000097389 5:157984006-157984028 ATATGGAAGAAAAAAGATGCAGG + Intergenic
1000435466 5:161202464-161202486 GTTTAGAGGAAAAATGATAAAGG - Intergenic
1000633656 5:163619054-163619076 ATGAAGAAGAAAAAGGAAGAGGG - Intergenic
1001202471 5:169730741-169730763 CTGTAGAACAAAAATGCTTAAGG - Intronic
1001710894 5:173777140-173777162 AAGTTGAGGAAAAATAATGAGGG + Intergenic
1002829172 6:803455-803477 AAGTAGAAGAAAAAGAAGGACGG - Intergenic
1002873973 6:1194310-1194332 ATGTAGAAGAAAGGTGTAGAAGG - Intergenic
1003093251 6:3121991-3122013 ATGTAGAAGAAAAAGGAGATGGG + Intronic
1003145740 6:3508847-3508869 AAACAGAAGAAAAATGAGGAGGG - Intergenic
1004003345 6:11615916-11615938 ATGTAGAAAAACAATCATTAAGG - Intergenic
1004421187 6:15471434-15471456 ATGCAGAAGACAACAGATGAGGG - Intronic
1004665320 6:17743981-17744003 ATACTGAAGAAAAATGAAGAGGG + Intergenic
1004786281 6:18971408-18971430 ATGAAAAAGAAAAATGAATAGGG - Intergenic
1005037827 6:21573312-21573334 CTGAAGAAGAAAAACAATGATGG - Intergenic
1005691998 6:28315606-28315628 ATGTAGAAGAGAAAGACTGATGG - Intergenic
1005701077 6:28400668-28400690 ATGAAAAAGAAAAATGGTGAGGG + Intergenic
1006169246 6:32083640-32083662 AAAAAAAAGAAAAATGATGATGG - Intronic
1006253153 6:32807618-32807640 ATGTACCAGCAAAATGATGTGGG + Intergenic
1007294121 6:40808739-40808761 ATCTATAGGAAAAATGTTGAAGG + Intergenic
1007469090 6:42076734-42076756 ATGAAGAAGAAAAGTGATCCTGG - Intronic
1007648702 6:43402841-43402863 ATATTGAAAAAAATTGATGAAGG - Intergenic
1007701841 6:43770369-43770391 ATGTTTAAGAAAAAAGAAGAGGG - Exonic
1008200392 6:48580769-48580791 ATTTAGAGAAAAAATGAGGAAGG + Intergenic
1008350610 6:50485081-50485103 ATGTTGAATAAGAATAATGAGGG - Intergenic
1008521690 6:52367726-52367748 GTGTAGAGGAAAGATGAGGATGG + Intronic
1008756396 6:54799510-54799532 ATATAGAAACAAAATTATGATGG - Intergenic
1008919004 6:56823253-56823275 ATGTGGAACAAAAATACTGAGGG - Intronic
1008950888 6:57157660-57157682 ATATAAAATAGAAATGATGAAGG - Intronic
1009435852 6:63617807-63617829 ATGAAGAGCAAAAATGAAGATGG - Intergenic
1009753754 6:67907853-67907875 AGATAGAAGAAAATTGATGTAGG - Intergenic
1011852416 6:91646682-91646704 ATCTAGAAAAAAAATGATGGAGG + Intergenic
1012043831 6:94243622-94243644 ATGTAGAAGATAAATAAAGGTGG - Intergenic
1012058914 6:94452438-94452460 AGGTTGAATAAAAGTGATGAGGG - Intergenic
1012500073 6:99878991-99879013 ATGTAGCATAAAAATAAAGAAGG - Intergenic
1012864688 6:104604197-104604219 ATTTACAAGAAAAAGGATGACGG - Intergenic
1013002550 6:106038505-106038527 ATGAAGAAGAAAAGGGATGCTGG + Intergenic
1013032574 6:106349298-106349320 ATGTAGAAGAAAAGTGCAAAAGG + Intergenic
1013116665 6:107108782-107108804 AGGTAGAAAAAAAATTAAGAGGG + Intronic
1013777890 6:113699362-113699384 TTGTAAAGGAAAAATGAAGAGGG + Intergenic
1013939773 6:115646880-115646902 ATGAAGAAAAAAAATGTTAAGGG + Intergenic
1014272752 6:119350969-119350991 AAGTAGACGACAAATAATGATGG - Intergenic
1014598049 6:123369861-123369883 GTGAAGGAGAAAACTGATGAGGG - Intronic
1015013448 6:128380030-128380052 ATATGGAAGAAAAAGGATGAAGG + Intronic
1015063216 6:128993815-128993837 ATGCAGAAGAAAAATTAATAGGG + Intronic
1015132815 6:129833036-129833058 TTGAAAAAGAAAAATGATGCAGG + Intronic
1015370589 6:132447379-132447401 ATTTAGAAGGAAAATGATAAAGG - Exonic
1015509892 6:134027995-134028017 ATGTAGAAGGAAAAAAATCAAGG - Intronic
1015835181 6:137413199-137413221 GTTTAGAAGAAAAATAATAAAGG - Intergenic
1016012744 6:139155424-139155446 ATGTAGGGGAAAAATGAGGTAGG + Intronic
1016170023 6:141002027-141002049 AGGTAGAAGGAAAATGATATAGG - Intergenic
1017270988 6:152505042-152505064 ATCCAGAAGAAAATTGATGCAGG + Intronic
1017588765 6:155955430-155955452 ATGTAGAAGAAAAGAAATGCAGG + Intergenic
1018114526 6:160570762-160570784 ATGAAGGAAAAAAATGTTGAGGG - Intronic
1019071722 6:169352292-169352314 ATGAAGGAGAAAAATGTTAAGGG - Intergenic
1019246975 6:170715655-170715677 ATGTAGAAGGAATATGGTAAAGG + Intergenic
1019793152 7:3030424-3030446 AAGTAGATGAAAAATGGTGCTGG - Intronic
1019853919 7:3585582-3585604 ATGAAGAAGGAAATTGATCAGGG + Intronic
1020222089 7:6247017-6247039 AGGTAGTAGAAAAAAGCTGATGG + Intronic
1021132503 7:16928191-16928213 TTAGAGAGGAAAAATGATGATGG - Intergenic
1021447124 7:20745769-20745791 GTGAGGAAGAAAAATGATAAAGG - Intronic
1021536340 7:21708921-21708943 ATGAAAAAGTCAAATGATGATGG + Intronic
1021663498 7:22947014-22947036 ATCTGTAAGAAAAATGATGGAGG - Intronic
1021823589 7:24522954-24522976 ATGTAGAAGAAAAAAAAATAAGG - Intergenic
1022633843 7:32112267-32112289 AAGAAGATGAAAAAAGATGAAGG - Intronic
1023789449 7:43741381-43741403 ATGAAAAAGAAAAATTGTGAGGG + Intergenic
1024763947 7:52633942-52633964 ATGAAGAAGAACAATTAAGAGGG - Intergenic
1024786779 7:52916693-52916715 AGGTAGAAGAGAACTGATAATGG - Intergenic
1025482311 7:60996641-60996663 ATGATGAAGTGAAATGATGATGG + Intergenic
1026063650 7:67049221-67049243 ATAGAGAAGAAATATGTTGAAGG - Intronic
1026191884 7:68136359-68136381 AAGAAGAAGAAAAAGGAGGAGGG + Intergenic
1026284830 7:68954035-68954057 AGGAAGAAGAAAAATCAGGAGGG - Intergenic
1026500755 7:70941569-70941591 ATTTAGAAAAAAAAAGAAGAAGG + Intergenic
1027487260 7:78777553-78777575 GAGTAGGAGAAAGATGATGATGG - Intronic
1027587146 7:80072510-80072532 ATGTTGAATAAAAGTGATGAAGG - Intergenic
1027714079 7:81647145-81647167 ATGTACAAGGAATATTATGAAGG + Intergenic
1027880479 7:83829127-83829149 TGGTAGAAGTAAAATGATGAGGG - Intergenic
1028849568 7:95522498-95522520 ATGTAGAGGCAAATTTATGATGG - Intronic
1030302448 7:107988043-107988065 AAGTGAAAGAAAAAAGATGACGG + Intronic
1030482079 7:110116929-110116951 ATGTGAAAAAAAAATGATGTAGG + Intergenic
1030656223 7:112171439-112171461 AAGTAGAAAAAAAAAGATAAAGG - Intronic
1030723716 7:112899870-112899892 ATGTAGATAAACAAAGATGAAGG + Intronic
1031537450 7:122952787-122952809 ATCTACCACAAAAATGATGATGG + Intergenic
1031630295 7:124035868-124035890 AAGTATAAGAAAAATGCTCATGG + Intergenic
1031790686 7:126099344-126099366 AAGTAGAAGAAGAATTAAGAAGG - Intergenic
1032287070 7:130546978-130547000 ATCAAGGAGGAAAATGATGATGG + Intronic
1032585023 7:133138429-133138451 ATTTAAAAAAAAAATGAGGAAGG - Intergenic
1032993778 7:137423219-137423241 ATGTAAAAGAAAAGTGCTGCTGG + Intronic
1033018912 7:137701297-137701319 ATGTTGAATAAAAGTGGTGAGGG - Intronic
1033252311 7:139771434-139771456 AAGTACAAGAAAAATAAAGACGG + Intronic
1033832494 7:145270667-145270689 ATGTCAGAGAAAAATGATAATGG + Intergenic
1033907789 7:146226794-146226816 ATCTAAAAGAGAAATGGTGAGGG + Intronic
1033974763 7:147087674-147087696 ATTTATAAGAAAAATAATCAAGG + Intronic
1034001801 7:147421958-147421980 CTGTACAAGAAACATGTTGACGG - Intronic
1034524702 7:151650315-151650337 ATTTAGAAGAAAAATGGTAATGG + Intronic
1034915927 7:155038986-155039008 ATTAACAAGAAAAATGATGCAGG - Intergenic
1035501166 8:92298-92320 ATGTAGAAGGAATATGGTAAAGG - Intergenic
1035519373 8:265111-265133 ATGTTGGAGAAAAAAGATAAGGG - Intergenic
1036057552 8:5274597-5274619 ATGTGGAACAAAAATGATGAGGG + Intergenic
1036223456 8:6939758-6939780 ATGTAGAGGCAAAATGAGAAGGG + Intergenic
1036236327 8:7042501-7042523 ATGTAGAGGCAAAATGAGAAGGG + Intergenic
1036623895 8:10449025-10449047 TGGTAGAAGAAAAATGATCCAGG + Intergenic
1036731136 8:11265929-11265951 TTTTTGAAGAAAAATGAGGAGGG - Intergenic
1036805853 8:11832831-11832853 AGGCAAAGGAAAAATGATGAGGG - Intronic
1037024333 8:14014401-14014423 ATGAGGAAGAAAGAGGATGAGGG + Intergenic
1037469627 8:19194680-19194702 ATAAAGAAGAAGAATGACGAGGG + Intergenic
1037514686 8:19618864-19618886 GTGTGGAAGAAAATGGATGATGG - Intronic
1037560255 8:20067225-20067247 ATGTTGAAGAAGACTGGTGAGGG + Intergenic
1039140933 8:34387266-34387288 GTGGAGAAGAACAAAGATGAAGG + Intergenic
1039157718 8:34580411-34580433 AAGGAGAACAAAAATAATGATGG - Intergenic
1039196502 8:35037751-35037773 ATGTAGGAGAAAAATCTAGATGG + Intergenic
1039261995 8:35781902-35781924 AGGTAAAAGGATAATGATGAGGG + Intronic
1039598527 8:38812752-38812774 ATGAAGGGGAAAAATGAGGATGG - Intronic
1039674505 8:39646885-39646907 AAGTAGAAGGAGAATGAAGAGGG + Intronic
1039695605 8:39907122-39907144 ATGGAGAAAAAAAATGATATAGG + Intronic
1039968756 8:42303801-42303823 ATGCAGAAGAAAAATGGGGCTGG - Intronic
1040393733 8:46974711-46974733 AGGGAGAAGAAAAATAATTATGG + Intergenic
1040632376 8:49230403-49230425 ATCCAGGAGAAAAGTGATGAGGG + Intergenic
1041172570 8:55160010-55160032 ATGTAGAAAAGAAATGATGTAGG + Intronic
1041172571 8:55160034-55160056 ATGTAGAAAAGAAATGATGTAGG + Intronic
1041305572 8:56454664-56454686 AAGTAGAAGAAAAGAAATGATGG + Intergenic
1041825133 8:62086996-62087018 AGATAGAAGAAAAATGATGAAGG + Intergenic
1042256161 8:66806015-66806037 ATGTAGAAGAAATATGAAAAAGG - Intronic
1042501388 8:69513260-69513282 AAATAGAAGAAAAATTATGTAGG - Intronic
1042594839 8:70435991-70436013 ATGGAGAGGAAAAACGATCATGG - Intergenic
1042699721 8:71599170-71599192 AAGCAGAAGAAAAAAGGTGAAGG - Intergenic
1043054493 8:75420562-75420584 ATATTGAACACAAATGATGAAGG - Intronic
1043647502 8:82539074-82539096 ATATAGAAGAACATTTATGATGG - Intergenic
1043764238 8:84109399-84109421 ATGAAAAAGAAAAATAAGGAAGG - Intergenic
1044230732 8:89774826-89774848 AGGAAGAAGAAAAAGGATTAAGG + Intronic
1044275461 8:90294392-90294414 AGGTAGAAGAAAAAAGAGGAAGG - Intergenic
1044298059 8:90551355-90551377 TTGTAAAACAAGAATGATGATGG - Intergenic
1044700037 8:94957423-94957445 ATTTAGAAGAAAGAAGATAAGGG + Intronic
1044939296 8:97324317-97324339 ATTTAGAAGAAAAATGATGGTGG - Intergenic
1045131091 8:99153815-99153837 AGAGAGAAGAAAAATGATAAAGG - Intronic
1045991028 8:108308360-108308382 AAGTAAAAGAAAAATGTTGGAGG - Intronic
1046001791 8:108429867-108429889 ATGAAAAACAAAAATGATGTTGG - Intronic
1046897396 8:119487699-119487721 AGGTAGAAGAAAAACCAGGAGGG - Intergenic
1047083720 8:121493479-121493501 ATGTTGGAGAAAAATGAGGATGG + Intergenic
1047112950 8:121811289-121811311 ATGGAAAAAAAAAATGCTGAAGG - Intergenic
1047160409 8:122371511-122371533 ATGTAAAAAAAAAATAATAAAGG + Intergenic
1048571272 8:135659148-135659170 AGGTAGGAGGAAAATCATGAAGG - Intergenic
1048776310 8:137950372-137950394 ATGTAATAGAAAAATAATGGTGG - Intergenic
1049004570 8:139846516-139846538 AATAAGAAGAAAAATGAAGATGG + Intronic
1049029146 8:140020968-140020990 ATGTAAAAACAAAAAGATGAAGG - Intronic
1049904431 9:202880-202902 ATAGGGAAGAAAAATGAGGAAGG + Intergenic
1050132791 9:2429937-2429959 CAGTAGAAGAAAAATGATCGTGG - Intergenic
1050159651 9:2704260-2704282 ATGGAGAAGAAAAATAAATAAGG + Intergenic
1050308731 9:4331671-4331693 ATGACGAAGAAATATGATGAAGG + Intronic
1050348086 9:4713528-4713550 AAGTAGAAAAAAAAGGCTGATGG - Intronic
1051512141 9:17889874-17889896 ACGTAGCTGAAAAATAATGAGGG - Intergenic
1051563339 9:18468223-18468245 ATGTAGAAAAAAGAAGATCAAGG + Intergenic
1051581784 9:18684039-18684061 GTGGAGGAGAAAAATGAAGAGGG - Intronic
1051981127 9:23018770-23018792 ATGAAGGAAAAAACTGATGATGG - Intergenic
1052177803 9:25485702-25485724 ATTTAGAAAAAAAACAATGAAGG - Intergenic
1052406837 9:28072033-28072055 ATGTAGAAGGAGGATGAAGATGG - Intronic
1052489235 9:29142749-29142771 ATGCTGAATAAAAATGGTGAGGG - Intergenic
1053138708 9:35668376-35668398 ATGTAGATGAAAAATTTAGAAGG + Intronic
1053179508 9:35956442-35956464 ATGTTCTAGAAAAAAGATGATGG - Intergenic
1053727003 9:41014454-41014476 ATAGGGAAGAAAAATGAGGAAGG + Intergenic
1055195769 9:73591665-73591687 ATTTAGGAGAGAGATGATGATGG - Intergenic
1055413007 9:76051945-76051967 ATGCAGAAGGAAAATCATCATGG + Intronic
1055448888 9:76412392-76412414 ACATAGAAGAAAAATAATGTAGG - Intergenic
1055662836 9:78523260-78523282 ATGTAAAAAAAAAATGAAGTTGG + Intergenic
1055894531 9:81159978-81160000 ATGAAGAATATATATGATGAGGG - Intergenic
1055917913 9:81425665-81425687 CTGTGGTAGAGAAATGATGATGG - Intergenic
1056026389 9:82500739-82500761 ATGAAGTAGAAAAATAAAGAAGG - Intergenic
1056422458 9:86442282-86442304 AGGTAGAAGAAAAATGAATCCGG - Intergenic
1056623010 9:88230281-88230303 CTGAAAAAGAAAAATAATGAGGG - Intergenic
1057419275 9:94897131-94897153 ATTTTGAAGAGTAATGATGAGGG + Intronic
1057640003 9:96810337-96810359 AGGTAGAAGACAAATAAGGAAGG + Intergenic
1058059900 9:100484224-100484246 ATTTAGAAAAAAGATGATGATGG - Intronic
1058111217 9:101032364-101032386 ATGTAGGTGTTAAATGATGAGGG + Intronic
1058250737 9:102692589-102692611 CAGAAGATGAAAAATGATGAAGG + Intergenic
1058296919 9:103320226-103320248 ATGTAGAAGAAATAAGATGTTGG + Intergenic
1058328562 9:103728610-103728632 ATCTAGACAAGAAATGATGAGGG - Intergenic
1058391020 9:104495928-104495950 ATGTCTAAGAAAAATGTTCAAGG - Intergenic
1058547974 9:106081374-106081396 ATGTAGAAAACCAAAGATGAAGG + Intergenic
1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1058633799 9:107017179-107017201 AGAAAGAAGAAAAAGGATGAGGG - Intergenic
1058703921 9:107623448-107623470 ATGAAGAAGAAAAGTGGTGTTGG - Intergenic
1059614832 9:115938218-115938240 AAATAGAAGAAGAAAGATGATGG + Intergenic
1060077785 9:120608935-120608957 ATCTAGGTGAGAAATGATGAAGG - Intronic
1060434716 9:123583561-123583583 ATATAGGGGAAAAATGATGATGG - Intronic
1060709678 9:125846641-125846663 ATGTAGAAGGAGAAAGCTGATGG - Intronic
1061060741 9:128249206-128249228 AAGAAGAAGAAATATAATGAGGG + Intronic
1061867923 9:133504622-133504644 AGTTAGAACAATAATGATGATGG + Intergenic
1062676205 9:137745983-137746005 ATCCAGAAGAAAAATGAGCAGGG - Intronic
1203607746 Un_KI270748v1:71114-71136 ATGTAGAAGGAATATGGTAAAGG + Intergenic
1185502664 X:610324-610346 ATGTAGGAGAAAAACCAAGAGGG - Intergenic
1185815174 X:3148334-3148356 TTGGAGAAGAAAGATGAAGAGGG + Intergenic
1186090081 X:6037571-6037593 ATGCAGAACAATAATGCTGAAGG - Intronic
1186322374 X:8443021-8443043 TTGAAGAAGAAAAATGATTATGG - Intergenic
1186581497 X:10824706-10824728 ATGTAGAGGAAAAATTACGAAGG + Intronic
1186888985 X:13941593-13941615 ATGTAGAAGCAATATGTTTAAGG - Intergenic
1188208946 X:27395138-27395160 ATATCCAAGAAAAATGAAGATGG + Intergenic
1188661194 X:32760897-32760919 ATGAAGAAGAAATAAGAGGAAGG - Intronic
1188919049 X:35948938-35948960 ATGTAGAATTAAAAAGATGGAGG + Intronic
1189716116 X:43868282-43868304 ATGTAGAAGAAAAATCATTTGGG - Intronic
1190129858 X:47737719-47737741 ATGTAGGAGTAAAAATATGAAGG + Intergenic
1190679513 X:52812736-52812758 ATGTTGATAAAAAATGATCATGG + Intronic
1190869594 X:54413989-54414011 ATGCAGATGAGAGATGATGATGG + Intergenic
1190944355 X:55076218-55076240 ATGCTGATAAAAAATGATGATGG + Intronic
1190945601 X:55090196-55090218 ATGCTGATAAAAAATGATGATGG + Intronic
1191102826 X:56750826-56750848 ATTCAGGAGAAAAATGTTGAGGG - Intergenic
1192167253 X:68833756-68833778 ATTTAGAAGTAAAAAGCTGAAGG - Intronic
1192307459 X:69977291-69977313 GGCTAGAAGAAAAATGATAATGG - Intronic
1192601620 X:72470402-72470424 AGGTAGAAGAAATATGATGGAGG - Intronic
1192678724 X:73228986-73229008 AAAAAGAAGAAAAATGATGGAGG - Intergenic
1192771015 X:74190738-74190760 ATGTGGAATAAAAGTGGTGAAGG + Intergenic
1192880770 X:75281299-75281321 ATGTTGAAGAGGAATGGTGAGGG + Intronic
1192907210 X:75564123-75564145 ATGCAAAAAAAAAATGATAAAGG - Intergenic
1192997886 X:76531829-76531851 ATGAAGAAAAAAAATGTTAAGGG - Intergenic
1193228688 X:79016406-79016428 ATGTTGAAGAGGAATGGTGAGGG - Intergenic
1193399063 X:81020904-81020926 ATGTGCAAGCAAAGTGATGAAGG + Intergenic
1193492307 X:82165186-82165208 ATATAGAAGCAAAATGAGGGAGG + Intergenic
1193640633 X:84006499-84006521 ATGTGGCACAAAAATGGTGAGGG - Intergenic
1193651129 X:84133816-84133838 ATGTACAAAAGAAATGATGTGGG - Intronic
1193680725 X:84515997-84516019 TTGTAGAAGAAAAAAAATTAAGG - Intergenic
1193738801 X:85193228-85193250 ATGGGGAGGAAAAATGATGATGG + Intergenic
1194115109 X:89887397-89887419 ATGTGGAAGAACAGTGGTGAAGG + Intergenic
1194426677 X:93747449-93747471 AGGGAGAAAAAAGATGATGAAGG + Intergenic
1194773340 X:97931806-97931828 ATGGTGAATATAAATGATGATGG - Intergenic
1194874339 X:99167798-99167820 ATGTTGAAGTGAAATGGTGAAGG - Intergenic
1194943122 X:100036441-100036463 GTGTAGAGGATAAATGATGTTGG - Intergenic
1194946266 X:100071909-100071931 CTACAAAAGAAAAATGATGATGG + Intergenic
1195625383 X:107000750-107000772 ATGTAGAAAAATATTCATGAAGG + Intergenic
1195872660 X:109502019-109502041 ATGTTGGAGCAAAATCATGAGGG + Intergenic
1195964093 X:110414403-110414425 AAGTGGAGGAAAAAGGATGAGGG + Intronic
1196347202 X:114677317-114677339 ATCTAGATGAAAGTTGATGAGGG + Intronic
1196480748 X:116144650-116144672 CTTTAGAAGAAAAATGATGGAGG - Intergenic
1196584255 X:117410844-117410866 ATGAAGAAAAAAAATGTTAATGG + Intergenic
1196661655 X:118276992-118277014 AAGAAGAAGAAAAATAATGTGGG - Intergenic
1197087785 X:122499441-122499463 CTGTAGAAGAAACAGGATGAAGG - Intergenic
1197375654 X:125678979-125679001 CTGAAGAATAAAAGTGATGAAGG + Intergenic
1197533968 X:127664354-127664376 ATGTTGAATAGAAGTGATGAAGG + Intergenic
1197905429 X:131419861-131419883 TTGAAGAAGAAAAATAATGAAGG + Intergenic
1198368146 X:135964205-135964227 ATGCAGAAGAAAAATCATTGAGG - Exonic
1198626089 X:138576661-138576683 ATATAGACAAAGAATGATGAGGG - Intergenic
1198927134 X:141811256-141811278 TTTTAGAAAAAAAATGATAATGG - Intergenic
1199087898 X:143650237-143650259 GTATAGAGGAAAAAAGATGAAGG - Intergenic
1199101082 X:143801317-143801339 ATGCAGAAGAAAAGAGAAGAAGG + Intergenic
1199670582 X:150144848-150144870 ATGAAAAAGAAATGTGATGAGGG - Intergenic
1201865630 Y:18650820-18650842 ATGTAGAATAAAAATAGGGAAGG - Intergenic