ID: 957193733

View in Genome Browser
Species Human (GRCh38)
Location 3:77040971-77040993
Sequence TGCCCCCAAGGAGCCCGTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 158}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957193733_957193736 20 Left 957193733 3:77040971-77040993 CCGGCACGGGCTCCTTGGGGGCA 0: 1
1: 0
2: 1
3: 21
4: 158
Right 957193736 3:77041014-77041036 TGTTTCTAAACTGCTGTAAGTGG 0: 1
1: 0
2: 1
3: 27
4: 196
957193733_957193737 30 Left 957193733 3:77040971-77040993 CCGGCACGGGCTCCTTGGGGGCA 0: 1
1: 0
2: 1
3: 21
4: 158
Right 957193737 3:77041024-77041046 CTGCTGTAAGTGGAATGTGTTGG 0: 1
1: 0
2: 2
3: 9
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957193733 Original CRISPR TGCCCCCAAGGAGCCCGTGC CGG (reversed) Intronic