ID: 957193733

View in Genome Browser
Species Human (GRCh38)
Location 3:77040971-77040993
Sequence TGCCCCCAAGGAGCCCGTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 158}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957193733_957193737 30 Left 957193733 3:77040971-77040993 CCGGCACGGGCTCCTTGGGGGCA 0: 1
1: 0
2: 1
3: 21
4: 158
Right 957193737 3:77041024-77041046 CTGCTGTAAGTGGAATGTGTTGG 0: 1
1: 0
2: 2
3: 9
4: 168
957193733_957193736 20 Left 957193733 3:77040971-77040993 CCGGCACGGGCTCCTTGGGGGCA 0: 1
1: 0
2: 1
3: 21
4: 158
Right 957193736 3:77041014-77041036 TGTTTCTAAACTGCTGTAAGTGG 0: 1
1: 0
2: 1
3: 27
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957193733 Original CRISPR TGCCCCCAAGGAGCCCGTGC CGG (reversed) Intronic
900516998 1:3087076-3087098 TGCTCCCAAGAAGACAGTGCCGG - Intronic
900539569 1:3196098-3196120 TGCCCCCAGTGAGCTCCTGCTGG - Intronic
900594501 1:3474580-3474602 TGCCCCCAGGGGGCTCCTGCAGG - Intronic
900605660 1:3522523-3522545 TGCCTCCCAGGAGGCCGTCCTGG - Intronic
900981741 1:6049665-6049687 AGCCCCCGAGGAGCCCCTACAGG - Intronic
902273676 1:15324608-15324630 TGCACCCAAGCAGCCAGTGGGGG + Intronic
902921119 1:19666395-19666417 TGCCCGCAAGCAGGCCGTGCAGG + Exonic
903000195 1:20259933-20259955 TTCCTCCCAGGACCCCGTGCAGG - Intergenic
903019282 1:20382655-20382677 TGGACCCAAGGAGCCAGTGTGGG - Intergenic
904751245 1:32742287-32742309 TGACCCCCAGGAGCTGGTGCTGG + Intronic
906460227 1:46030936-46030958 TGCCCCTAAGGAGACCTGGCAGG + Intronic
907258259 1:53196758-53196780 TGCCCGGAAGGAGCCAGTCCGGG + Exonic
907338392 1:53715781-53715803 TGGCCCCATGGAGGCCGTGGAGG + Intronic
913983555 1:143545147-143545169 TCCCCCCAAGGAGGCCGACCAGG + Intergenic
915593610 1:156884161-156884183 GGGCCCCAAGGACCCCGTGGGGG + Intergenic
918302769 1:183219060-183219082 TCCCCCCAAGCTGCCGGTGCAGG + Intronic
920693558 1:208164756-208164778 TGCCCCCAGGGAGCCGCTGCCGG - Intronic
922933887 1:229409525-229409547 TGCCCCCTAGGAGCCCATGCAGG - Intergenic
923893320 1:238239399-238239421 TGACTCCATGGAGCTCGTGCAGG - Intergenic
1066134259 10:32427292-32427314 TGCCACCAAGGAACTCTTGCTGG - Intergenic
1067918048 10:50421836-50421858 TGCCCCAAAGGGACCCATGCAGG + Intronic
1070793695 10:79204593-79204615 TGCCCCCAAGGAGCTCAACCTGG - Intronic
1072727243 10:97822124-97822146 TGCCCCCCGTGAGCCCGGGCAGG - Intergenic
1075047522 10:119158155-119158177 AGCCCCCAAGGAGCTGGGGCAGG + Intronic
1075196898 10:120367588-120367610 CGGCCCCAAAGAGCACGTGCTGG - Intergenic
1076198691 10:128540566-128540588 TGCCCGCTAGGAGCCGGCGCCGG + Intergenic
1076858565 10:133129064-133129086 TGCCCTGAAGGCACCCGTGCAGG - Exonic
1077177940 11:1199022-1199044 TGCCCCCCAAGAGCCAGGGCAGG - Intronic
1079822230 11:25145583-25145605 TGCCCTAAAGGAGCCCCTGAAGG - Intergenic
1080386294 11:31812996-31813018 TGCGACCAAGGAGCCCGGGCAGG + Intronic
1084005795 11:66322893-66322915 TGCCCCTAAGGAGCCTCTGGAGG - Intergenic
1084636924 11:70398834-70398856 TGGGCCCAAGGAGGCCGGGCAGG + Intronic
1087128768 11:94651365-94651387 AGCCCTCAGGGACCCCGTGCTGG + Intergenic
1089732426 11:120527503-120527525 TGCCTTCCTGGAGCCCGTGCTGG + Intronic
1093563556 12:20574186-20574208 TACCCCCATGGACCTCGTGCTGG - Intronic
1096208421 12:49742453-49742475 TGACCCCAAGCAGCCCGGGCTGG - Intronic
1100442478 12:94629449-94629471 TGCCCTCAAGGAGCTCAGGCTGG - Intronic
1104688450 12:130806265-130806287 GGCCCCCACGGAGCCCTGGCAGG - Intronic
1105274308 13:18905816-18905838 TGCCCCCAACCAGCCCTTGCTGG - Intergenic
1106113571 13:26797862-26797884 GGCCCCCAAGGATCCAGTGTTGG - Intergenic
1106793435 13:33179975-33179997 TGACCCCAAGGACCTCCTGCAGG - Intronic
1108662514 13:52599970-52599992 TGCCGCCAAGGAACCCGGACAGG + Intergenic
1118258507 14:64225659-64225681 GGGCTCCAGGGAGCCCGTGCTGG - Exonic
1121422347 14:93824596-93824618 TGCTCCCAGGGAGCCCCAGCAGG + Intergenic
1122317728 14:100835747-100835769 TGCCCCCGACAAGCCCCTGCTGG + Intergenic
1122399281 14:101457828-101457850 CGCCGCCAAGGTGCCCGCGCAGG - Intergenic
1122978858 14:105182044-105182066 TGCCCCCGTGGAGGCCGTGGTGG - Intergenic
1124099938 15:26683699-26683721 TGCCCCCTAGGAGCATGTGGTGG - Intronic
1124578409 15:30929286-30929308 TGCCCCCGAGGAGAGCCTGCGGG + Exonic
1125502028 15:40245835-40245857 TGCTACCAAGGGGCCCATGCAGG + Intronic
1127961889 15:63896177-63896199 TGTTCCTAAGGAGCCCGAGCTGG - Intergenic
1128497331 15:68206003-68206025 AGCCCCCGAGGAGCCTGTGGTGG - Intronic
1128532534 15:68464504-68464526 TGCTCCCAAGGAGGCCCTGCCGG - Intergenic
1129268471 15:74407405-74407427 GGCCCTCAAGAAGCCAGTGCTGG + Intergenic
1131059520 15:89395966-89395988 TCCCCCCAAGGAGACCAGGCAGG + Intergenic
1132232352 15:100193453-100193475 TGCCTCCAAGGCCCCAGTGCTGG - Intronic
1132292639 15:100714088-100714110 GGCCCCCTGGGAGCACGTGCAGG + Intergenic
1133239078 16:4403983-4404005 GGCCCCCAGGGAGCCCCTTCTGG - Intronic
1134243362 16:12522051-12522073 TGGCCCCGAGGGGCCCCTGCTGG + Intronic
1135685694 16:24496754-24496776 TGCCACCAAGGAGCCAGGCCTGG - Intergenic
1136202950 16:28700620-28700642 AGCCTCCACGGAGCCTGTGCGGG - Intronic
1136540139 16:30924158-30924180 TGCGCCCAAGGAGCCCCCGTTGG + Intronic
1139711910 16:68782290-68782312 TGCCCCCAAGGTGGGTGTGCAGG - Intronic
1140725427 16:77807359-77807381 TGCCCCCAGGGAGGGGGTGCAGG - Intronic
1141651368 16:85394830-85394852 TGTGCCCAAGGAGCCAGGGCTGG - Intergenic
1142130909 16:88431061-88431083 GGCCCCCAAGGATCCCCTGCAGG + Exonic
1142223101 16:88864900-88864922 TGCCACCAAGGGCTCCGTGCAGG - Exonic
1142287897 16:89178898-89178920 TGACCCCAAGAAGCCAGTGGCGG - Intronic
1142501869 17:337578-337600 TGCCACCCAGGACCCCGTCCAGG + Intronic
1143159713 17:4861203-4861225 TGGCCCCAAGCAGCACGTCCTGG - Intronic
1144663136 17:17084407-17084429 TGCCAGCAAGGAGCCCCGGCCGG - Intronic
1146143385 17:30388707-30388729 TGCCCCCTGGGAGCCTGTGGCGG + Intronic
1147907298 17:43831728-43831750 TGCCCCCGAGGAGCCCGAGTGGG + Intronic
1148239839 17:45993035-45993057 TGCCACCAAGGAGCAAGTGCAGG - Intronic
1151472100 17:74325112-74325134 TGCCCCTGAGGAGCCTGTGTTGG - Intergenic
1152091777 17:78251251-78251273 TGCCCCTGAGCAGCCTGTGCTGG + Intergenic
1152610685 17:81313841-81313863 TCCCCCCAAGGAGACCGAGGTGG + Exonic
1152662813 17:81550851-81550873 AGCCCCCGAGGAGGTCGTGCGGG + Exonic
1152823610 17:82449915-82449937 TGGCCCCAGGGACCCCGTTCTGG + Intronic
1152925342 17:83085096-83085118 GGCCCCCGAGGAGTCCGTGAAGG - Exonic
1154466004 18:14643071-14643093 TGCCCCCAACCAGCCCTTGCTGG - Intergenic
1155274036 18:24168998-24169020 TGCCGCCAAGGAGTTTGTGCCGG + Intronic
1156160321 18:34351027-34351049 TGGCACCAAGGAGCACTTGCAGG - Intergenic
1156454078 18:37283052-37283074 CGCCCCCAAGGAGGCAGTGCTGG + Intronic
1160968286 19:1756087-1756109 TGCCCCCAGGCAGCCCGTCCAGG + Intronic
1160975617 19:1790870-1790892 GGCCCCCAGGCAGCCAGTGCGGG - Intronic
1161086784 19:2339101-2339123 TGCGCCTAAGGAGCCGGTGCTGG + Exonic
1161291619 19:3496748-3496770 GGACCCCAAGCAGCCCCTGCAGG - Exonic
1161302270 19:3548401-3548423 GGCCTCCAGGAAGCCCGTGCTGG + Intronic
1163034228 19:14562235-14562257 TGCTGGAAAGGAGCCCGTGCCGG - Intronic
1163125969 19:15244387-15244409 TGCCACCCAGGTGCCCGTCCTGG - Exonic
1163215236 19:15871558-15871580 AGTCCCCAAGCAGCCCCTGCTGG + Intergenic
1163251268 19:16127675-16127697 TGCACCCAAGAAGCCCCGGCTGG - Intronic
1164684142 19:30156093-30156115 AGGCCCCAGGGAGCCAGTGCAGG + Intergenic
1165346965 19:35254543-35254565 GGACCCCAAGGAGCCCGAGGAGG - Intronic
1166301331 19:41913499-41913521 TGCCCCCCTGCAGCCCGTCCTGG - Intronic
1166745682 19:45140864-45140886 TGGCCCCCAGGAGCCCTTTCAGG + Intronic
926238523 2:11067928-11067950 TGCCCCCAGGAATCCCCTGCAGG + Intergenic
929893195 2:45936206-45936228 TGCCCCCAAGCACCCCTTGGGGG + Intronic
930262660 2:49165737-49165759 TGTCCCCAAGGAGTGGGTGCTGG - Intergenic
932180114 2:69639502-69639524 TTCCCCCAAACAGCCCCTGCTGG + Intronic
935803891 2:106727913-106727935 TGCCCTCAAGGAGTCCGTGGTGG + Intergenic
936263017 2:110978514-110978536 TCCCCCAAAGGAACCGGTGCAGG + Intronic
938236001 2:129707876-129707898 TTCCCCCAGGGAGCCCATGCAGG - Intergenic
938577315 2:132616684-132616706 GGCCCTCAAGGAGCTCATGCTGG - Intronic
946302362 2:218831755-218831777 TGGCCACATGGAGCCCGGGCTGG - Exonic
947526340 2:230878783-230878805 TGCCCCCCAGGAGCACAAGCAGG + Exonic
1174421054 20:50399417-50399439 TGTCCCCCAGGAGACTGTGCTGG - Intergenic
1175624072 20:60475877-60475899 GGCACCCTAGGAGCCCCTGCAGG + Intergenic
1176173585 20:63707531-63707553 CGCTCCCCAGGAGCCCCTGCAGG + Intronic
1176808582 21:13515525-13515547 TGCCCCCAACCAGCCCTTGCTGG + Intergenic
1180127580 21:45802729-45802751 TGTCCCCAAGGACCCCAGGCAGG + Intronic
1181066875 22:20310984-20311006 TGGCCCCAAGGGCCCTGTGCCGG + Intergenic
1182249019 22:28984820-28984842 TTCCTCCAGGGTGCCCGTGCAGG - Intronic
1183691581 22:39392682-39392704 TCCCACCATGGAGCCCGTGATGG + Intergenic
1183703012 22:39460353-39460375 TGCCCCCAAGCAGCCAGCACAGG - Intronic
1184294621 22:43515652-43515674 TGCCCCTCAGGAGCCAGAGCCGG - Intergenic
1185066685 22:48635765-48635787 TGTCCCTGAGGAGCCAGTGCAGG + Intronic
1185409181 22:50673736-50673758 TCCCCCCAAGGACCCCTGGCCGG - Intergenic
950141289 3:10617831-10617853 TGCCCCAAGGGAGCACGAGCTGG + Intronic
952748376 3:36803337-36803359 TGCCCCCATGGGGGCTGTGCTGG + Intergenic
954456659 3:50603297-50603319 TGCCCCCAAGGAGTGTTTGCTGG - Intergenic
955377647 3:58411414-58411436 CACCCCCAAGGAGCCTGCGCTGG - Intronic
957193733 3:77040971-77040993 TGCCCCCAAGGAGCCCGTGCCGG - Intronic
964221732 3:154354620-154354642 TGCCCTCAAGGAGCCTGTAGAGG - Intronic
968761021 4:2442852-2442874 TGCCCCCAAGGCCACCGCGCAGG - Intronic
973652295 4:53008159-53008181 TAGGCCCAAGGAGCCCATGCAGG + Intronic
973820277 4:54657282-54657304 TCCGCCCAAGAAGCCCCTGCCGG - Intergenic
977666464 4:99651009-99651031 TGCCCCCAATAAGCCCGAGCAGG - Exonic
978809062 4:112830852-112830874 TGCCCACCTGGAACCCGTGCTGG - Intronic
983216492 4:165007370-165007392 TGCCCCTGAGGAGCCTGGGCAGG - Intergenic
985088045 4:186334414-186334436 TGCCCCTAAGCAGCCTTTGCTGG + Intergenic
990984126 5:61626186-61626208 TGCCCCCGAGGAGGCAGAGCTGG + Intergenic
992646798 5:78818935-78818957 TGCCCCTAAGGAGCCAGAGAGGG - Intronic
993905610 5:93620669-93620691 TGCCCTGAAGGAGACCGCGCGGG - Exonic
997639956 5:135442620-135442642 TGCCCCTCAGGAGTCCCTGCAGG + Intergenic
999262751 5:150247716-150247738 TGCCCCCAACGAACTGGTGCAGG + Intronic
999322786 5:150625346-150625368 TGCCCCCACGGCGCCCATGTTGG - Intronic
1000280435 5:159777129-159777151 TTCCCCTATGGAGCCCTTGCAGG - Intergenic
1001526600 5:172433579-172433601 GGCCACCAAGGAGCCCCTGCCGG + Intronic
1001538767 5:172522285-172522307 TGGCCCCAAGGTGCCAGTACTGG + Intergenic
1002326889 5:178415621-178415643 TGCCCTCATGGAGCCAGGGCGGG - Intronic
1002887890 6:1312265-1312287 TGCCCCGAAGACGCCCGCGCGGG + Intergenic
1004614782 6:17280428-17280450 TGGCCCCAAAAAGCCAGTGCGGG - Intergenic
1006840859 6:37027179-37027201 TGCCCACAAGGGGCAGGTGCCGG - Intronic
1007284600 6:40738399-40738421 TGTCCCCAGGGAGCCCCAGCCGG - Intergenic
1015796401 6:137016241-137016263 TGTCCCCATGGAGCCCCAGCTGG - Intronic
1017825170 6:158076340-158076362 TGCCCCCCAGGAGACAGTGCAGG - Intronic
1018744268 6:166750091-166750113 TGCCCCTGAGGTGCCCATGCCGG + Intronic
1019064832 6:169288144-169288166 TGCCTCCATGGAGCCCCTGGAGG - Intergenic
1019557185 7:1638440-1638462 TACCGCCGGGGAGCCCGTGCTGG + Intergenic
1019575425 7:1735433-1735455 TGCCCTCCAGGAGGCCGGGCTGG - Intronic
1020046776 7:5046257-5046279 TGCTCCCGAGGGGCCCGGGCCGG - Exonic
1020100189 7:5390029-5390051 TGGGCCCAAGGAGCCTGTGGGGG + Intronic
1021524573 7:21573033-21573055 TGTCCCCAAGGATCTTGTGCAGG - Intronic
1021629437 7:22629958-22629980 TGCCCCCATGGATCCCCAGCAGG - Intronic
1022410344 7:30135026-30135048 GGCCCCGGAGGAGCCCGCGCAGG + Exonic
1025004174 7:55342565-55342587 TGCCGCCAAGGAGCCCGCCATGG + Intergenic
1025249774 7:57344050-57344072 TGTCCCCCAGGAGACTGTGCTGG + Intergenic
1025864265 7:65365673-65365695 TGCCCCCAGGAAGCACCTGCAGG + Intergenic
1026623807 7:71974877-71974899 TGCCCAAATGGAGCCTGTGCTGG - Intronic
1026727326 7:72879745-72879767 TGCTCCCGAGGGGCCCGGGCCGG - Exonic
1027116530 7:75485982-75486004 TGCTCCCGAGGGGCCCGGGCCGG + Exonic
1027121823 7:75527684-75527706 TGCTCCCGAGGGGCCCGGGCCGG + Intergenic
1027275297 7:76549721-76549743 TGCTCCCGAGGGGCCCGGGCCGG - Intergenic
1029721010 7:102364271-102364293 TGCTCCCGAGGGGCCCGGGCCGG - Exonic
1032188845 7:129751060-129751082 TGTCTCCAAGGAGCCTGTACAGG + Intronic
1033036417 7:137879948-137879970 TGCCCCCTGGGAGCCCTCGCTGG - Exonic
1033600443 7:142885246-142885268 TGCTCCCAAGGAGCCAGTCCGGG + Intronic
1037696446 8:21228191-21228213 TGCCCCTAGGAAGCCTGTGCTGG - Intergenic
1046696445 8:117345154-117345176 TGCCCCAAAGGGACCCATGCAGG - Intergenic
1049285725 8:141774214-141774236 TGACCCCAGGGACCACGTGCTGG - Intergenic
1051429136 9:16964205-16964227 TGGTCCCAAGGAGCCCATTCAGG + Intergenic
1055096993 9:72423886-72423908 TCCACCCAGGGAGCCCATGCCGG - Intergenic
1060471345 9:123951146-123951168 TGCCTCCATGGAGCCTGGGCAGG + Intergenic
1062130918 9:134892587-134892609 TGACCCCAGGGAGCCCGCCCTGG - Intergenic
1062143193 9:134971534-134971556 TGCCCCAAAGCAGCCCTTGGGGG - Intergenic
1062270774 9:135707355-135707377 TGTCCCCAAGGGTCCCCTGCCGG + Intronic
1062315516 9:135965210-135965232 TGCCACTAAGGAGCCCCTGCTGG - Intergenic
1189362537 X:40363812-40363834 GGCCCCCAAGGAGGCAGTGGAGG - Intergenic
1192221222 X:69198603-69198625 TGCTCCAAAGGAGGCCATGCAGG + Intergenic