ID: 957197023

View in Genome Browser
Species Human (GRCh38)
Location 3:77081913-77081935
Sequence CCTTCTGAAGTGAAGGTATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 158}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957197023_957197029 5 Left 957197023 3:77081913-77081935 CCCCATACCTTCACTTCAGAAGG 0: 1
1: 0
2: 1
3: 5
4: 158
Right 957197029 3:77081941-77081963 TACCCTGCCCTCCAGGAACCAGG 0: 1
1: 0
2: 3
3: 43
4: 265
957197023_957197028 -2 Left 957197023 3:77081913-77081935 CCCCATACCTTCACTTCAGAAGG 0: 1
1: 0
2: 1
3: 5
4: 158
Right 957197028 3:77081934-77081956 GGAGAAATACCCTGCCCTCCAGG 0: 1
1: 0
2: 1
3: 32
4: 217
957197023_957197035 18 Left 957197023 3:77081913-77081935 CCCCATACCTTCACTTCAGAAGG 0: 1
1: 0
2: 1
3: 5
4: 158
Right 957197035 3:77081954-77081976 AGGAACCAGGACTGAAACTGAGG 0: 1
1: 0
2: 1
3: 32
4: 415

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957197023 Original CRISPR CCTTCTGAAGTGAAGGTATG GGG (reversed) Intronic
901218232 1:7566723-7566745 CCTCCTGATGTGCAGGGATGAGG - Intronic
906372269 1:45264126-45264148 GCTTCTGAAGAGAAGGTCTTGGG + Intronic
906749314 1:48244612-48244634 TCTTCTGAAGTGAGCCTATGTGG - Intronic
908211525 1:61905375-61905397 ACTTCTAAGGTGAAGGTATTAGG - Intronic
908357518 1:63337206-63337228 AATTCTGAAGTGATGGTATTAGG + Intergenic
908908559 1:69045767-69045789 CCTTATAAAGTGAGAGTATGTGG + Intergenic
913486789 1:119339212-119339234 CCTTCTGAAGTCAAGGAATTTGG - Intergenic
918416999 1:184320342-184320364 CCTGCTGAAGTGAAGGAAGAGGG - Intergenic
918839126 1:189512176-189512198 CTTTATTAAGTGAAGGGATGGGG + Intergenic
921188412 1:212689283-212689305 CCTTCTGAAAGGAAAGGATGGGG - Intronic
921869809 1:220127660-220127682 CTTTCTGGAGTAAGGGTATGTGG + Intronic
924320087 1:242839885-242839907 CCTTTGGAAGTGAATTTATGTGG - Intergenic
1064463426 10:15556428-15556450 GCTTCTGAACTGCAGCTATGGGG + Intronic
1064581769 10:16799947-16799969 CCTTCTGATGAGAAGGCATCGGG - Intronic
1065310722 10:24413769-24413791 CCTGCTGATGTGAAGATATTTGG - Intronic
1065404534 10:25349272-25349294 CCTCATGAAGGGAAGGTAGGAGG - Intronic
1065661567 10:28008485-28008507 CCTTAGGAAGTGAATGGATGGGG + Intergenic
1066444820 10:35472470-35472492 CCTTCTAAGTTGAAGGTATAAGG - Intronic
1067377551 10:45741744-45741766 CCTTCAGCAGTGGAGGTAGGAGG + Intronic
1067885253 10:50082429-50082451 CCTTCAGCAGTGGAGGTAGGAGG + Intronic
1068574322 10:58667326-58667348 TTTTTTAAAGTGAAGGTATGAGG + Intronic
1068702285 10:60032966-60032988 CCATCTGATGGGAAGGTGTGAGG + Intronic
1069049019 10:63772626-63772648 CATTCTTAAATGAATGTATGAGG + Intergenic
1076019072 10:127055605-127055627 CCATCTGGGTTGAAGGTATGAGG - Intronic
1076186676 10:128455584-128455606 GATGCTGATGTGAAGGTATGAGG - Intergenic
1079533246 11:21480464-21480486 CTTTCAGAAGTGAAGCTATTAGG + Intronic
1085918996 11:80928852-80928874 CCTTGTGGAGGGAAGGTAGGAGG - Intergenic
1087082658 11:94186895-94186917 ACTTCTGAATAGAATGTATGAGG - Intergenic
1087370991 11:97283676-97283698 AATTCTGAAGTGAAGTTATTGGG - Intergenic
1088362089 11:109001626-109001648 TCTTCTCAAATGAAGGAATGGGG + Intergenic
1088758054 11:112903410-112903432 CCTTCTGAAGAGGAGGCTTGGGG + Intergenic
1089226402 11:116926560-116926582 CCTTCTCAAGTGAAGGTGAGAGG + Intronic
1094144795 12:27216956-27216978 CCTCCTGCAGTGAAGGGATTGGG - Intergenic
1096026827 12:48373149-48373171 CCTTGTGTAGTGAGTGTATGTGG - Intergenic
1096599908 12:52721872-52721894 CCTTCTGAAGTTCTGGGATGGGG + Intergenic
1101478392 12:105073502-105073524 CCTTCTGAAGTCCACGTATATGG + Intronic
1103102690 12:118193559-118193581 ACTTCTGAAATGAAGGTTCGTGG + Intronic
1109219962 13:59631216-59631238 CCTTCTGAAATGAAGGCAGGTGG + Intergenic
1110356910 13:74577181-74577203 CCTACTGAATTGAAGGTCTATGG - Intergenic
1110896680 13:80761558-80761580 CCAGCTGAAGTGCACGTATGTGG - Intergenic
1112448414 13:99488215-99488237 CCTTCTGCAGTGAAAGTACTAGG - Intergenic
1112657357 13:101465739-101465761 TTTTTTGAAGAGAAGGTATGAGG + Intronic
1114324610 14:21575960-21575982 CTTTCTGAAGTCAAGGAACGCGG - Intergenic
1116668977 14:47817089-47817111 CCTTCTGCAGTGGAGGTAGCAGG + Intergenic
1119463407 14:74831659-74831681 CTATCTGAAGTCAAGGTATAAGG - Intronic
1120686035 14:87538909-87538931 AGTTCTGTAGTGAAGGTATATGG + Intergenic
1121800936 14:96773732-96773754 GATTCTGAATTGAAGGGATGGGG - Intergenic
1123185377 14:106511576-106511598 GCTTCTGTAGAGAAGGGATGTGG + Intergenic
1127242944 15:57138422-57138444 CCTTCAGAAGTCATGGGATGTGG + Intronic
1128146480 15:65334880-65334902 CCAGCTGAAGTGAGGATATGTGG - Intronic
1128661967 15:69508115-69508137 CCTTTTAAAGTGAAGGATTGAGG + Intergenic
1131248202 15:90814185-90814207 CCGTCTGAATTGAGGGTATAGGG - Intronic
1134673657 16:16074369-16074391 CCTTATGATGTGAGGGGATGTGG - Intronic
1135880089 16:26247148-26247170 CCCTCAGAAGTCAAGGGATGGGG + Intergenic
1138073236 16:54014707-54014729 CCTTCTGCAGTGGAGTTAGGAGG - Intronic
1138575609 16:57905494-57905516 CCTTCTGGAAGGGAGGTATGGGG + Intronic
1139252772 16:65511971-65511993 CTTTCTGAAGATGAGGTATGGGG - Intergenic
1139607338 16:68028941-68028963 CCTTCTGAAGTGCTGGAATCAGG - Intronic
1140302910 16:73775474-73775496 CCGTCTGAAATGAGGGTTTGGGG - Intergenic
1140421601 16:74823824-74823846 ACTTCTGGAGTGGAGGTAGGAGG + Intergenic
1141207755 16:81946523-81946545 CTTGCTGAAGTGAAACTATGGGG - Intronic
1144414606 17:15034363-15034385 CCTTGTGAAGTGAAGAAATTGGG - Intergenic
1148647542 17:49227797-49227819 CCTTCTGCAGGGATGGAATGCGG + Intronic
1148806874 17:50268352-50268374 CCTTCTAAAGTGTAGGTTTCTGG - Intergenic
1156785641 18:40910697-40910719 TCTTCAGAATTGAAGGTTTGTGG - Intergenic
1157046258 18:44104764-44104786 CCCTCAGAATTGAAGGTCTGAGG + Intergenic
1161757810 19:6147311-6147333 CCTTCTAGGGTGAAGTTATGTGG - Intronic
1164490994 19:28714390-28714412 TCTTCTCAAGTGGAGGGATGGGG - Intergenic
1165546981 19:36547107-36547129 CCTTATGAATGTAAGGTATGTGG - Exonic
925772483 2:7297127-7297149 CCTTCAGAAATAAAGGTTTGGGG - Intergenic
926792838 2:16592522-16592544 TCTGCTGAAGTGAAGGTGTCTGG + Intronic
928604966 2:32937120-32937142 CCTTCTGAAGAGAAGATTTTCGG + Intergenic
933592115 2:84244577-84244599 CCTTCTGATGAGAATGAATGAGG - Intergenic
936279226 2:111122943-111122965 CCTTCTGAGGGGAGGGTCTGTGG + Intronic
939146402 2:138420391-138420413 CCTTATGTGGTGAATGTATGAGG + Intergenic
939386205 2:141502218-141502240 CCTTCTGAAGTAATGAAATGTGG + Intronic
939655450 2:144818729-144818751 ACTTCTGGAGTGATAGTATGAGG + Intergenic
939714754 2:145570133-145570155 CCTGTTTAAGTGAGGGTATGTGG - Intergenic
939940207 2:148340191-148340213 CCTTCTGGCATGAAGGTATTGGG - Intronic
944349308 2:198708276-198708298 TCTCCTGAAGAGTAGGTATGGGG - Intergenic
1169501417 20:6164338-6164360 TCTTCTGAAATGAAGGAAGGTGG + Intergenic
1171879469 20:30607082-30607104 CCTTTTGAATTTAAGGAATGTGG + Intergenic
1174678418 20:52380058-52380080 CCATCTGAAGGGAATGTATTTGG + Intergenic
1174851924 20:54004101-54004123 ACTTCTGATGTGATGGTATTAGG + Intronic
1175028379 20:55927697-55927719 GGCTCTGAAGTGAAGGTATATGG - Intergenic
1175576358 20:60063601-60063623 CCTTCTGCAGTGAAGGGAATAGG + Intronic
1179288451 21:39997807-39997829 CCCTCTGAAGTGAAGGTGGTGGG - Intergenic
1182874463 22:33678998-33679020 CCTGCTGAATTGAAGGGATCCGG - Intronic
1185089175 22:48756320-48756342 CCTTCTGGGGTGAAGGGAGGGGG + Intronic
952085124 3:29811576-29811598 CATGCTGAAGAGAAGGCATGAGG + Intronic
953033449 3:39192360-39192382 CCTTCTGAAATGGACGTATTAGG - Intronic
956952670 3:74299902-74299924 CCTTCTGAAGTCAATGGAGGAGG - Exonic
957197023 3:77081913-77081935 CCTTCTGAAGTGAAGGTATGGGG - Intronic
958961709 3:100516910-100516932 CCTTGTGAAGTGAAAAGATGGGG + Intronic
960057523 3:113285721-113285743 CCTTCAGCAGTGAAGGAAAGTGG - Intronic
960271059 3:115675311-115675333 CCTTGAGAAGTGAAGGCAGGAGG - Intronic
967102628 3:186228836-186228858 CCTTCTTGTGTGAAGGTCTGGGG + Intronic
967388694 3:188934396-188934418 AATTCTGAACTGAGGGTATGTGG + Intergenic
967947718 3:194817556-194817578 CCATCTGAAGTGCAGGGTTGAGG - Intergenic
969832983 4:9813479-9813501 CCTTGTGAAGGGAATGAATGTGG - Intronic
970425753 4:15944821-15944843 CTTTCTTAAGTGCATGTATGTGG - Intergenic
971036115 4:22694490-22694512 CCGTCTAAACTTAAGGTATGAGG + Intergenic
971913292 4:32824599-32824621 CCCTGTACAGTGAAGGTATGAGG + Intergenic
973042701 4:45492434-45492456 TATTCTGAATTGAAGGTATTGGG - Intergenic
974259233 4:59503513-59503535 TCTTCTGTAGTGAAGATTTGAGG - Intergenic
974551275 4:63378646-63378668 CCTTCTGAATTTAAAGTATTGGG - Intergenic
975886569 4:78973401-78973423 CCTTTTGAACTTAAGGTATTTGG + Intergenic
976621914 4:87136911-87136933 CACTCTGGAGTGAAGGCATGTGG - Exonic
976879266 4:89898778-89898800 CCTTCTCAGGTGAAGTTAGGTGG + Intronic
977411011 4:96664140-96664162 CCTTCTGGAATGAGGGTCTGTGG - Intergenic
978574065 4:110170998-110171020 CCTTCTGAATTGAGGGTCTCAGG - Intronic
980705226 4:136484568-136484590 CCTTCAGAAATGAAGATTTGGGG - Intergenic
981031282 4:140128168-140128190 CCATCTTAATTGAAGGTAGGAGG - Intronic
988004152 5:25386281-25386303 ACTTCTCTAGTGAAGATATGAGG + Intergenic
989519785 5:42387935-42387957 GTGTTTGAAGTGAAGGTATGAGG - Intergenic
991616520 5:68502477-68502499 CCATCTGAGGTGCAGTTATGGGG + Intergenic
992015047 5:72567049-72567071 CCTTCTGAAGGGACGGTATGGGG + Intergenic
995392100 5:111651054-111651076 GCATCTGAAGTGAAGGATTGAGG - Intergenic
995879168 5:116824737-116824759 CATTATAAAGTGAGGGTATGGGG - Intergenic
998885592 5:146690804-146690826 CCTTCTGTACTGAAGGTACAGGG - Intronic
1000343394 5:160294727-160294749 CCTTCTGGAGTGGAGGACTGGGG + Intronic
1000870746 5:166574275-166574297 CCTTCTGAGGTGACCGTATTTGG - Intergenic
1001079322 5:168655456-168655478 CCGTCGGAAGAGAAGGTAGGAGG + Intergenic
1002866311 6:1125278-1125300 CCTTCTGGACTGAGGGTAGGTGG - Intergenic
1008051095 6:46901238-46901260 CCTTGTCAGGTCAAGGTATGGGG - Intronic
1008632770 6:53379648-53379670 CCTTCTAAAGTTAAGGTAAAGGG - Intergenic
1009183938 6:60551615-60551637 CCTCCTGAAGTGATGGTAACAGG - Intergenic
1014795039 6:125714945-125714967 CCTTCTGAACTCCTGGTATGTGG - Intergenic
1016877996 6:148882550-148882572 TCTTCTACAGTGAAGGAATGGGG + Intronic
1017207350 6:151817794-151817816 CCCTATGAAGGGAAGATATGAGG - Intronic
1017262650 6:152405003-152405025 CTTTCTGAATTGAAGGCATCAGG - Intronic
1018246229 6:161826983-161827005 CATTGTGAAGAGCAGGTATGAGG - Intronic
1019746952 7:2706048-2706070 CCTTCTGAAGTGTGGGGCTGGGG - Intronic
1021198585 7:17699683-17699705 CCAAGTGAAGTGAAGATATGTGG + Intergenic
1023019221 7:35995362-35995384 CTTTCTGAAGTGAAGGGCTGTGG + Intergenic
1024605758 7:51021437-51021459 CCTTGGGAGGTGAAGGTAGGAGG - Intronic
1026251253 7:68673021-68673043 CCTTGTTAAGTAAAGGCATGAGG + Intergenic
1026469715 7:70684759-70684781 TCCTCTGCAGTGAAGGAATGAGG - Intronic
1029181653 7:98706180-98706202 CCCTCTGACATGGAGGTATGAGG + Intergenic
1031598593 7:123675996-123676018 TCTACAGAAGTGATGGTATGTGG - Intergenic
1037373571 8:18205538-18205560 CCATCTGCAGTGATGGTTTGCGG + Intronic
1037528045 8:19746988-19747010 CCCACTAAAGTGAAGGCATGTGG - Intronic
1037928252 8:22862102-22862124 CCGGCTGAACTGAAGGTATGGGG + Intronic
1044903866 8:96978654-96978676 CCTTAGAAAGTGAAGGCATGTGG + Intronic
1047517015 8:125563907-125563929 CCTTCTGAAGTGAACCAGTGGGG - Intergenic
1048129078 8:131673378-131673400 CCTTCTGAAGTAAAGTTTGGTGG - Intergenic
1048353357 8:133633755-133633777 CCTTCCAAAGTGCAGGTATTGGG + Intergenic
1049665876 8:143842221-143842243 CCCTCTGCAGTAAAGGTTTGGGG + Intergenic
1052670385 9:31549839-31549861 TCTTCTGTAGTGAAGGCATATGG - Intergenic
1053873172 9:42515209-42515231 CCTTCTAAAGTGGCTGTATGGGG + Intergenic
1054262068 9:62876875-62876897 CCTTCTAAAGTGGCTGTATGGGG + Intergenic
1054269157 9:62951543-62951565 CCTTCTAAAGTGGCTGTATGGGG - Intergenic
1055584373 9:77742749-77742771 CCTTCTATAGTGAAGGACTGTGG + Intronic
1056691586 9:88812823-88812845 CCAGCTAAAGTGCAGGTATGCGG - Intergenic
1059235721 9:112759202-112759224 TTTTCTGAAGAGAAGGTTTGCGG + Intronic
1062345547 9:136112861-136112883 CCTTCTGATCCGAAGGTCTGGGG - Intergenic
1185622062 X:1456080-1456102 CCTTCTGGAATGCTGGTATGGGG - Intergenic
1185651057 X:1648481-1648503 CATTTTTAAGTTAAGGTATGTGG + Intergenic
1186038644 X:5452234-5452256 CCTTCTAATGTGATGGTATTAGG + Intergenic
1186725719 X:12356456-12356478 CATCCTGAAGTGATGGTATTAGG + Intronic
1189196245 X:39155921-39155943 GGTTCTGAAGTGAAAGTATAAGG + Intergenic
1190789044 X:53682852-53682874 CCTTCTGAGGGGGAGGAATGAGG + Intronic
1194316027 X:92379115-92379137 CCTTCTGAATTGGAGGGGTGAGG + Intronic
1195613042 X:106890759-106890781 CCTTTTTAAGTGAAGCCATGAGG + Intronic
1199819722 X:151432721-151432743 CCTTCTTAAGCGGAGGTACGGGG + Intergenic