ID: 957198646

View in Genome Browser
Species Human (GRCh38)
Location 3:77103087-77103109
Sequence TGGAGCAGAAGGAGCACAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 737
Summary {0: 1, 1: 0, 2: 8, 3: 65, 4: 663}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957198638_957198646 6 Left 957198638 3:77103058-77103080 CCGTTCTGAACACTGGCGCTCCC 0: 1
1: 0
2: 0
3: 6
4: 116
Right 957198646 3:77103087-77103109 TGGAGCAGAAGGAGCACAGGGGG 0: 1
1: 0
2: 8
3: 65
4: 663

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957198646 Original CRISPR TGGAGCAGAAGGAGCACAGG GGG Intronic
900186011 1:1333604-1333626 AGGAGCAGCAGCAGCACAGCCGG - Exonic
900247648 1:1645169-1645191 GGGAGCAGAAGGAGCGCGAGCGG - Exonic
900258875 1:1712307-1712329 GGGAGCAGAAGGAGCGCGAGCGG - Exonic
900420057 1:2552393-2552415 AGGAGCAGCAGGATCCCAGGCGG - Intergenic
900576044 1:3382922-3382944 TGGAGTAGCAGGAGCACAGCTGG - Intronic
901056794 1:6452071-6452093 AGGAGGAGGAGGAGCAGAGGCGG + Exonic
901659644 1:10790410-10790432 TAGAGGAGAGGGAGCTCAGGGGG - Intronic
902377156 1:16035225-16035247 TGGAGGGGAGGGAGCCCAGGGGG + Intergenic
902477572 1:16696434-16696456 AGGAGGAGGAGGAGCAGAGGTGG - Intergenic
902504375 1:16929880-16929902 TGGAGACGCAGGAGCCCAGGGGG + Exonic
903726314 1:25448546-25448568 TGGATCAGAATGAGCTGAGGTGG - Intronic
904335419 1:29794123-29794145 TGGGAGAGAAGGAGGACAGGAGG - Intergenic
904463875 1:30696719-30696741 TGGAAGAGAAGGAGGAGAGGAGG + Intergenic
904464370 1:30699084-30699106 TGGAAGAGAAGGAGGAGAGGAGG + Intergenic
904691197 1:32294376-32294398 TGAGGCAGATGGAGCACTGGAGG - Intronic
904804932 1:33124345-33124367 TGGAGCAGAAGAAGCACGTCAGG + Intergenic
904991002 1:34592563-34592585 TGGAGCAGAAAGAACAAGGGAGG - Intergenic
905006548 1:34714456-34714478 TGGGGCAGAAGGAGAAATGGTGG - Intronic
905592092 1:39173040-39173062 TGGAGTAGAAAAAGCACTGGAGG + Intronic
905857922 1:41327108-41327130 TGGGGCAGAATGAGCTCAGCTGG + Intergenic
906744672 1:48213456-48213478 GGGAGAAGAAGGAGGACTGGAGG + Intergenic
907281285 1:53348952-53348974 AGGAGCAGCAGGAGCTCTGGGGG - Intergenic
908679340 1:66642190-66642212 TGGAGAAGAAGCTGCACAGCGGG - Intronic
909489155 1:76207340-76207362 AGGAGCAGAAGGAGCAGTTGTGG - Intronic
909814700 1:79977167-79977189 TGGAGCAGAAGGAATGCAGATGG + Intergenic
910396501 1:86799376-86799398 AGGAGCAGAAGGAGAAGAAGCGG - Intergenic
910674102 1:89800009-89800031 TGCAGCAGCAGCAGCAAAGGGGG + Intronic
912112038 1:106355260-106355282 TGGAACAGGATGAGCAGAGGAGG - Intergenic
912385150 1:109267784-109267806 TGGAGCAAAAGGACCTCAGGAGG - Intronic
912607391 1:111005633-111005655 TGAAGCAGAAGGATCACTTGAGG + Intergenic
912618771 1:111134051-111134073 TGGGGCAGCAGGAGCAGGGGCGG + Intronic
912664112 1:111563905-111563927 TTGAGCAGAAGGAGGCCAGGTGG - Intronic
912664305 1:111565194-111565216 TGGAGCAGAATGAACAAAGGGGG + Intronic
913544489 1:119853749-119853771 TGGAGGGGAAGGAACAAAGGAGG - Intergenic
913602310 1:120433629-120433651 TGGAGTGGAAGGAACAAAGGAGG + Intergenic
913644702 1:120845025-120845047 CGGCGCAGAAGGTGCACTGGAGG - Intergenic
913991868 1:143620528-143620550 TGGAGGGGAAGGAACAAAGGAGG - Intergenic
914082030 1:144418558-144418580 CGGCGCAGAAGGGGCACTGGAGG + Intergenic
914084736 1:144443008-144443030 TGGAGTGGAAGGAACAAAGGAGG - Intronic
914099074 1:144568271-144568293 CGGCGCAGAAGGGGCACTGGAGG - Intergenic
914176935 1:145287058-145287080 CGGCGCAGAAGGTGCACTGGAGG + Intergenic
914299911 1:146369393-146369415 CGGCGCAGAAGGTGCACTGGAGG + Intergenic
914363484 1:146957235-146957257 TGGAGTGGAAGGAACAAAGGAGG + Intronic
914488193 1:148129899-148129921 TGGAGTGGAAGGAACAAAGGAGG - Intronic
914531663 1:148528550-148528572 CGGCGCAGAAGGTGCACTGGAGG + Intergenic
914588557 1:149085019-149085041 TGGAGTGGAAGGAACAAAGGAGG - Intronic
914636728 1:149559179-149559201 CGGCGCAGAAGGTGCACTGGAGG - Intergenic
914813238 1:151044962-151044984 TGGAGCAGAAAAAGACCAGGTGG + Intronic
914949865 1:152103596-152103618 TGCAGAAGATGGAGCAGAGGTGG + Intergenic
915041452 1:152971385-152971407 TGGAGCCAAAGGATGACAGGAGG - Intronic
915244582 1:154547344-154547366 TTGGGCAGGAGGAGCAAAGGAGG - Intronic
915740609 1:158115896-158115918 TGGAGGAGATTCAGCACAGGAGG - Intergenic
916090960 1:161307329-161307351 TGGACCAGAAGGAGCAGTGCAGG + Exonic
916317962 1:163471439-163471461 TGGTGCAGAAGACACACAGGAGG + Intergenic
916332150 1:163628616-163628638 AGGAGGAGAAGGAGAAGAGGAGG - Intergenic
916484842 1:165249537-165249559 AGCAGCAGAAGCAGCTCAGGTGG + Exonic
917463638 1:175255022-175255044 AGGAGCTGTAGGATCACAGGAGG + Intergenic
917522522 1:175760000-175760022 GGGAGGAGAAGGAGTACATGAGG - Intergenic
917619688 1:176783495-176783517 AGAAGCAGAAAGAGCACAGCTGG + Intronic
918547010 1:185696513-185696535 TGCAGCAGAAGGAGGACGGGTGG - Intergenic
918626364 1:186660302-186660324 TGGAGCAGAAGGAAGAGAGAGGG + Intergenic
918997276 1:191778618-191778640 TTGAGCAAAAAGAGCAAAGGTGG + Intergenic
919449367 1:197752026-197752048 AGGAGGAGAAGGAGAAGAGGAGG + Intronic
919531652 1:198728945-198728967 TTGAGCAGAGGGAGGACAGAAGG - Intronic
920033026 1:203048704-203048726 TGGAGGAGAAGGTGCCCAGAGGG + Intronic
920219167 1:204383678-204383700 GGGAACAGAAGGAGCACAGAGGG + Intergenic
920292836 1:204936073-204936095 TTGGGCAGGAGGAGAACAGGTGG - Intronic
920356322 1:205375909-205375931 TGGAGCAAAAGCAGCAGAGAAGG - Intergenic
920821736 1:209387802-209387824 TTGAGGAGAAGGAGCACAGTAGG + Intergenic
921341957 1:214143168-214143190 TGCAGCAGATGGAAAACAGGAGG + Intergenic
921527343 1:216233964-216233986 TGGGGTAGAAGGATCACAGAAGG + Intronic
923273825 1:232379930-232379952 AGCAGCAGAAGGACCACAGGGGG - Intergenic
924038300 1:239957860-239957882 TGGAGCAGGAGGGGCTCAGCAGG - Intergenic
924080358 1:240389857-240389879 TGAAGCAGGAGGATGACAGGAGG + Intronic
924138579 1:240998527-240998549 TGGAGCAGCAGCAGCAGAGGCGG + Intronic
924225914 1:241921503-241921525 GGGAGCAGATGGGGCAGAGGAGG + Intergenic
924740942 1:246794005-246794027 AGGGGCAGGGGGAGCACAGGGGG + Intergenic
1062822111 10:542185-542207 GGGAGCAGAAGGAGCTCAGGAGG - Intronic
1063590474 10:7390865-7390887 TGAAGCAGAAGGATCACCTGAGG + Intronic
1064585342 10:16834267-16834289 TGGGGCAGAAAGAGCACAGAGGG + Intronic
1064719825 10:18217782-18217804 TGGAGCAGAAAGAGGGAAGGAGG + Intronic
1065241125 10:23706307-23706329 TTAAACAGAAGTAGCACAGGTGG + Intronic
1065786435 10:29220088-29220110 TGGAGCAGGAGGAAGAGAGGGGG - Intergenic
1065790278 10:29254252-29254274 AGGAGGAGAAAGAGAACAGGAGG + Intergenic
1065896404 10:30166609-30166631 TGGAGCAGAAAGAGGACATAGGG - Intergenic
1066220899 10:33335659-33335681 TGGGGCAGAGGGAACACCGGAGG + Intronic
1066347571 10:34603700-34603722 GGGAGTAGAAGGATCAGAGGAGG + Intronic
1066616151 10:37296742-37296764 AGGAGCAGAAGGTAAACAGGTGG + Intronic
1067248759 10:44569907-44569929 TGGAGCTGCAGCAGCAGAGGTGG + Intergenic
1067323129 10:45241205-45241227 TGTGGCAGAAAGAGCACAGAGGG + Intergenic
1067661113 10:48236728-48236750 TGGAGCAGAAGTCTTACAGGTGG + Intronic
1067761972 10:49055207-49055229 TGGAGCAAGAAGAGCTCAGGGGG - Intronic
1069577693 10:69542638-69542660 AGGAGAAGAATGAGCAAAGGGGG + Intergenic
1069613444 10:69790877-69790899 AGGGGTAGAAGGACCACAGGTGG - Intergenic
1069826176 10:71256573-71256595 GAGAGCAGATGGAGCCCAGGTGG + Intronic
1069834276 10:71299032-71299054 TGGAGGTGAAGGGGCACAAGGGG - Intronic
1070214931 10:74368209-74368231 TGGGGCAGAAGAAGCACAGGAGG - Intronic
1070774567 10:79102216-79102238 TGGAGCAGAAGGCGTGCAGTGGG + Intronic
1071519429 10:86319814-86319836 TAGAGTAGAAGGAGGAGAGGAGG - Intronic
1072453953 10:95560652-95560674 GGGAGAAGAAGGGGCACGGGCGG + Intronic
1072697664 10:97615931-97615953 TGAAGCAGAAGGGTCACAGCAGG + Exonic
1073460343 10:103662141-103662163 TGCAGCAGAGGGAGGGCAGGTGG + Intronic
1074203445 10:111259880-111259902 TAGAACAGAAGGAGAAGAGGAGG - Intergenic
1074546871 10:114408134-114408156 GAGAGCAGGGGGAGCACAGGAGG + Intergenic
1074727731 10:116330829-116330851 TGAAGCAGAAGGATCACTTGAGG - Intronic
1074894709 10:117765246-117765268 TGGAGCTGAATGAGAACAGAAGG - Intergenic
1075035593 10:119064524-119064546 TGGAGCAGGAGGAAGACAGAGGG - Intronic
1075448325 10:122529368-122529390 GGGAGTAGAAGGGGCACAAGGGG - Intergenic
1075489564 10:122855003-122855025 CGGAGCAGAAGGAGCTGTGGAGG - Intronic
1075694116 10:124420636-124420658 TAGGGCAGATGGAGCCCAGGGGG - Intergenic
1076316754 10:129547369-129547391 TGGATCAGATGGGGTACAGGAGG - Intronic
1076723669 10:132403801-132403823 TGCAGGGGAAGGGGCACAGGGGG - Intronic
1076859466 10:133133773-133133795 CGGAGCAGGAGGGGCATAGGAGG + Intergenic
1078135479 11:8648412-8648434 TGGAACACAAAGAACACAGGTGG - Exonic
1079357478 11:19742147-19742169 TGGAGTATAAGGGGCTCAGGAGG - Intronic
1079739419 11:24038090-24038112 AGGAGAAGAATGAGCAAAGGGGG + Intergenic
1080587759 11:33696967-33696989 GTGAGAAGGAGGAGCACAGGTGG - Intergenic
1081361753 11:42188620-42188642 TGAAGCAGAAGCACAACAGGTGG - Intergenic
1081462233 11:43282555-43282577 TGAAGCAGAAGGTGCTCAAGGGG + Intergenic
1083880577 11:65546490-65546512 TGCAGCGGAAGGAGCCCGGGAGG + Exonic
1084232157 11:67760953-67760975 GGGAGAAGAAGGAGGAAAGGAGG - Intergenic
1084812269 11:71620240-71620262 TGGAGAGGAAGAAGCACATGGGG - Intergenic
1086308475 11:85508272-85508294 TGCAGCAGAGTGAGCAAAGGAGG - Intronic
1086564839 11:88213384-88213406 TGGAGCAGAAGGAAGAGAGTTGG + Intergenic
1088510416 11:110567521-110567543 GGAAGCAGAAGGGCCACAGGAGG + Intergenic
1089316509 11:117594776-117594798 TGGAGCCTAAGGAAGACAGGAGG + Intronic
1089380664 11:118028889-118028911 AGGAGGGGAAGGAGGACAGGAGG + Intergenic
1089539422 11:119181147-119181169 TGGAGCAGAAGGTGGCCAGAGGG - Intronic
1090831661 11:130424857-130424879 GGTGGCAGCAGGAGCACAGGTGG + Intronic
1091100572 11:132869073-132869095 TGGAGCAAAAGCACCACTGGGGG + Intronic
1091372617 11:135073535-135073557 TTCAGCAGATGGAGCACAGCTGG - Intergenic
1091529408 12:1339899-1339921 TCCAGCAGAAGGGGAACAGGTGG + Intronic
1091561969 12:1621637-1621659 TGAAGCGGGAGGATCACAGGAGG - Intronic
1091635578 12:2194201-2194223 AGGAGGAGGAGGAACACAGGGGG - Intronic
1091690087 12:2589977-2589999 TGGGGCACAAGGAGCACAGGTGG - Intronic
1091779041 12:3202307-3202329 TGGTCCAGGAGGAGCACTGGGGG + Intronic
1092099152 12:5869047-5869069 TGGAGCAGATGGAAGACAGGTGG + Intronic
1092161950 12:6320025-6320047 AGGAGCAGAACGTGCAAAGGCGG + Intronic
1092507386 12:9117591-9117613 GGGAGCAGAAGGAGGACAGAAGG + Intergenic
1092851054 12:12627059-12627081 AGGAATAGATGGAGCACAGGGGG + Intronic
1093676664 12:21948657-21948679 TGCAGCAAAAGCAGTACAGGGGG + Intergenic
1093891274 12:24524782-24524804 TGAAGCAGAAGGATCGCTGGAGG + Intergenic
1094052712 12:26238658-26238680 AGGAGCAGAGGGATCCCAGGAGG - Intronic
1095243178 12:39885166-39885188 TGGGGAAGAAGGATCACTGGAGG + Intronic
1095761432 12:45842023-45842045 TGAGGCAGAAGGATCACTGGAGG + Intronic
1095942269 12:47735046-47735068 TGGAGGGGAAGGAGGAAAGGAGG + Intronic
1095968318 12:47884023-47884045 AGGAGCAGAGGGGGCAAAGGAGG - Intronic
1095968320 12:47884032-47884054 TTGGGCAGTAGGAGCAGAGGGGG - Intronic
1096152685 12:49324272-49324294 TGAAGCAGGAGGATCACTGGAGG + Intronic
1097037918 12:56136286-56136308 GGGAGCAGAATGAACAAAGGTGG + Intronic
1097167069 12:57091626-57091648 TGGGGCAGGAGGAGAAGAGGAGG + Exonic
1097842142 12:64332070-64332092 TGAAGCAGACGGATCACTGGAGG + Intronic
1097951507 12:65434266-65434288 TGGGGCAGAAGGATCAAAGGAGG - Intronic
1098076637 12:66738640-66738662 TGGGTCAGAAGGAGCAAAAGGGG + Intronic
1098598550 12:72301822-72301844 TGGGGGAGAATGAGCACAGATGG + Intronic
1099749038 12:86747134-86747156 TGCAGGATAAGGAGCACTGGAGG - Intronic
1100089493 12:90953681-90953703 TGGAGGAGAACGAGCAGAGAGGG - Exonic
1102726651 12:115071417-115071439 TGGAGCAGAAGGAGGTGATGGGG - Intergenic
1103452512 12:121039163-121039185 TGCTGCAGTAGGGGCACAGGAGG + Exonic
1103623006 12:122200320-122200342 TGGAGGAGAAGGTGGGCAGGCGG + Exonic
1104847288 12:131852861-131852883 GGGAGCAGATGGTGAACAGGCGG - Intergenic
1105038117 12:132941246-132941268 GAGAGCAGAAGCAGCACACGCGG - Intronic
1105424672 13:20284201-20284223 TGGATAGGAAGGAGCAGAGGGGG - Intergenic
1105658858 13:22470893-22470915 TGGAGTAGAAGGAGCACAATTGG - Intergenic
1106465977 13:30015022-30015044 TGGAGGAGAAGGAGCAAACTTGG + Intergenic
1106649398 13:31673571-31673593 TGGAGCTGCAGGCACACAGGTGG - Intergenic
1107164604 13:37269698-37269720 GGGAAAAGAAGGGGCACAGGAGG - Intergenic
1107624742 13:42271589-42271611 TGGCGAAGAAGGAGCCCAGCTGG + Intergenic
1108554654 13:51581375-51581397 TGGAGCAGAAAGAGCTCATCTGG - Intergenic
1108623789 13:52208477-52208499 TCCAGCAGACTGAGCACAGGGGG + Intergenic
1108662929 13:52602556-52602578 TCCAGCAGACTGAGCACAGGGGG - Intergenic
1109350439 13:61173473-61173495 TGGACCAGAAAAAGCACAGTAGG + Intergenic
1110765329 13:79275403-79275425 TGGAGAAGAAGGAGGAATGGAGG - Intergenic
1112654509 13:101435976-101435998 CGAAGTAGAAGGAGGACAGGAGG + Intergenic
1113099022 13:106696900-106696922 TGGAGCGTAGGGAGCACAGAGGG - Intergenic
1113307157 13:109090923-109090945 TGAAGAAAAAGGAGCACAAGTGG - Intronic
1113933385 13:113980514-113980536 TGTAGTAGAAGGCGCACACGAGG - Intronic
1114260369 14:21032219-21032241 GGGAGAAGAGGCAGCACAGGAGG + Intronic
1115203889 14:30880696-30880718 TGGAACAGAAGGACCACATGTGG + Exonic
1115295798 14:31825500-31825522 AGGAGGAGAAGGAGAACAAGGGG - Intronic
1115501526 14:34053987-34054009 AGGAGCAGGAGGACCACTGGAGG - Intronic
1116475138 14:45331211-45331233 AGGAGGAGAAGGAGAAGAGGAGG - Intergenic
1116991641 14:51283647-51283669 TGGAGGAAAAGGACCACAGTGGG - Intergenic
1117727069 14:58685153-58685175 TAGAGCAGAAGGATCACTTGAGG - Intergenic
1118020830 14:61712319-61712341 TAGAACAGAATGAGCAAAGGGGG + Intronic
1118759146 14:68868370-68868392 TGAAGCAGAAGGATCACTTGAGG + Intergenic
1119048749 14:71345102-71345124 TGGGGGAGAAGGAGAGCAGGAGG + Intronic
1119189431 14:72670361-72670383 CGGAGGAGGAGGAGCCCAGGAGG + Exonic
1119661226 14:76453186-76453208 CGGAACAGAAGGAGCATAGGAGG + Intronic
1119725649 14:76920447-76920469 TGTCCCAGAAGGAGCACTGGAGG - Intergenic
1121374722 14:93397824-93397846 TGAAGCAGAAGGATCACTTGAGG + Intronic
1121494760 14:94384553-94384575 TGGAGTAGAAGGATCACTGTGGG - Intronic
1121708595 14:96019958-96019980 TGGAGCAGGAAGGGGACAGGAGG + Intergenic
1122366006 14:101195166-101195188 GGGAGCTGCAGGAGCACAGGTGG + Intergenic
1122426185 14:101607517-101607539 TGGAGGAGGAGGAGGAGAGGTGG - Intergenic
1122451515 14:101812349-101812371 AGGAGCAGAAGGAACCAAGGAGG + Intronic
1122466677 14:101938491-101938513 TGGACCAGTGGGAGCACAGCTGG - Intergenic
1123427820 15:20187227-20187249 TGGGGCAGCAGGAGCAGAGTAGG - Intergenic
1123453720 15:20395677-20395699 TGGAGGAAAAGGAGAAAAGGAGG - Intergenic
1123681607 15:22768174-22768196 GGGAGCAGGAGGAGCAGATGCGG - Intergenic
1123681616 15:22768216-22768238 GGGAGCAGGAGGAGCAGATGAGG - Intergenic
1123681635 15:22768300-22768322 GGGAGCAGGAGGAGCAGATGAGG - Intergenic
1123681644 15:22768342-22768364 GGGAGCAGGAGGAGCAGATGCGG - Intergenic
1123681648 15:22768363-22768385 GGGAGCAGGAGGAGCAGATGTGG - Intergenic
1123681652 15:22768384-22768406 GGGAGCAGGAGGAGCAGATGGGG - Intergenic
1123681663 15:22768426-22768448 GGGAGCAGGAGGAGCAGATGGGG - Intergenic
1123681674 15:22768468-22768490 GGGAGCAGGAGGAGCAGATGAGG - Intergenic
1123681683 15:22768510-22768532 GGGAGCAGGAGGAGCAGATGCGG - Intergenic
1123681687 15:22768531-22768553 GGGAGCAGGAGGAGCAGATGCGG - Intergenic
1123681700 15:22768594-22768616 TGAAGCAGGAGGAGCAGATGCGG - Intergenic
1123681711 15:22768657-22768679 GGGAGCAGGAGGAGCAGATGCGG - Intergenic
1123681715 15:22768678-22768700 GGGAGCAGGAGGAGCAGATGGGG - Intergenic
1123681729 15:22768741-22768763 TGAAGCAGGAGGAGCAGATGCGG - Intergenic
1123681742 15:22768825-22768847 GGGAGCAGGAGGAGCAGATGCGG - Intergenic
1123681746 15:22768846-22768868 GGGAGCAGGAGGAGCAGATGGGG - Intergenic
1123681766 15:22768930-22768952 GGGAGCAGGAGGAGCAGATGGGG - Intergenic
1123681772 15:22768951-22768973 GGGAGCAGGAGGAGCAGATGAGG - Intergenic
1123681782 15:22768993-22769015 TGGAGCAGGAGGAGCAGGTGCGG - Intergenic
1123681795 15:22769074-22769096 GGGAGCAGGAGGAGCAGATGCGG - Intergenic
1123681799 15:22769095-22769117 GGGAGCAGGAGGAGCAAATGGGG - Intergenic
1123681810 15:22769137-22769159 GGGAGCAGAAGGAGCAGATGCGG - Intergenic
1123681820 15:22769200-22769222 GGGAGCAGGAGGAGCAGATGCGG - Intergenic
1123681824 15:22769221-22769243 GGGAGCAGGAGGAGCAGATGGGG - Intergenic
1123681830 15:22769242-22769264 TGAAGCAGAAGGAGCAGATGGGG - Intergenic
1123681835 15:22769284-22769306 GGGAGCAGGAGGAGCAGATGCGG - Intergenic
1123681839 15:22769305-22769327 GGGAGCAGGAGGAGCAGATGGGG - Intergenic
1123681867 15:22769452-22769474 GGGAGCAGAAGGAGCAGATGCGG - Intergenic
1123681874 15:22769494-22769516 GGGAGCAGAAGGAGCAGATGCGG - Intergenic
1123681877 15:22769515-22769537 GGGAGCAGGAGGAGCAAATGGGG - Intergenic
1123681883 15:22769536-22769558 GGGAGCAGGAGGAGCAAATGGGG - Intergenic
1123681920 15:22769746-22769768 GGGAGCAGAAGGAGCAGATGCGG - Intergenic
1123681923 15:22769767-22769789 GGGAGCAGAAGGAGCAAATGTGG - Intergenic
1123681929 15:22769809-22769831 GGGAGCAGGAGGAGCAGATGGGG - Intergenic
1123681935 15:22769830-22769852 GGGAGCAGGAGGAGCAGATGCGG - Intergenic
1123681939 15:22769851-22769873 GGGAGCAGGAGGAGCAGATGCGG - Intergenic
1123681943 15:22769872-22769894 GGGAGCAGGAGGAGCAGATGCGG - Intergenic
1123681956 15:22769953-22769975 GGGAGCAGGAGGAGCAGATGCGG - Intergenic
1123681978 15:22770079-22770101 GGGAGCAGAAGGAGCAGATGCGG - Intergenic
1123681981 15:22770100-22770122 AGGAGCAGGAGGAGCAGATGGGG - Intergenic
1123681990 15:22770142-22770164 GGGAGCAGGAGGAGCAGATGGGG - Intergenic
1123682187 15:22770730-22770752 GGGAGCAGGAGGAGCAGATGCGG - Intergenic
1124333819 15:28842625-28842647 GGGAGCAGGAGGAGCAGATGCGG - Intergenic
1124333823 15:28842646-28842668 GGGAGCAGGAGGAGCAGATGGGG - Intergenic
1124333834 15:28842688-28842710 GGGAGCAGGAGGAGCAGATGAGG - Intergenic
1124333843 15:28842730-28842752 GGGAGCAGGAGGAGCAGATGCGG - Intergenic
1124333852 15:28842772-28842794 GGGAGCAGGAGGAGCAGATGCGG - Intergenic
1124333891 15:28842973-28842995 GGGAGCAGGAGGAGCAGATGCGG - Intergenic
1124333902 15:28843036-28843058 TGAAGCAGAAGGAGCAGATGCGG - Intergenic
1124333905 15:28843078-28843100 GGGAGCAGGAGGAGCAGATGCGG - Intergenic
1124333934 15:28843246-28843268 AGGAGCAGGAGGAGCAGATGCGG - Intergenic
1124462526 15:29905869-29905891 TGGAACAGGTGGAGCACAGAGGG + Intronic
1124994908 15:34713972-34713994 TGTAGCAGATGGAGCAGAGGGGG + Intergenic
1125551606 15:40549290-40549312 TGGAGCACAAAGAACAAAGGAGG - Intronic
1125555205 15:40579041-40579063 TGGAGCAGAAGTAGTGTAGGCGG + Intergenic
1125590497 15:40851786-40851808 TGAAGCAGAAGGATCACTTGAGG + Intronic
1126698957 15:51350682-51350704 TGGTGCACAAGGAAGACAGGAGG + Intronic
1127182284 15:56434189-56434211 TGAAGCAGCTGGAACACAGGAGG - Exonic
1127239276 15:57094118-57094140 TGGGGCAGAAGGATCACTTGAGG - Intronic
1127359914 15:58236399-58236421 TGGAGCAGGAGGAAGAGAGGAGG - Intronic
1127886139 15:63202497-63202519 TGCAGCAGAATGGGAACAGGAGG + Intronic
1129061924 15:72867223-72867245 TGGTGCAGAAAGAGCACTGTGGG - Intergenic
1129386797 15:75200883-75200905 TGGAGCAGCTGGAGCTGAGGAGG - Intronic
1129686501 15:77689159-77689181 TAGAGGAGAAGCAGCAGAGGTGG + Intronic
1129799116 15:78400210-78400232 TGAAGCAGGAGGATCACTGGAGG + Intergenic
1129904006 15:79173205-79173227 TGGAGCTGCAGAAGCACTGGCGG - Intergenic
1130042539 15:80417511-80417533 GGGAGGAGAAGAAGCAGAGGGGG - Intronic
1130408368 15:83623484-83623506 CAGAGCTGCAGGAGCACAGGTGG + Intergenic
1131509256 15:93040423-93040445 TAGAGCAGCAGCAGCAAAGGGGG - Intronic
1131572573 15:93553924-93553946 TGCAGCCGAAGGAGCAAAGTTGG - Intergenic
1131629619 15:94162767-94162789 AGGAGCTGAAGGGGCACAGAAGG - Intergenic
1132120418 15:99170793-99170815 GGCTGCAGCAGGAGCACAGGTGG - Intronic
1132256833 15:100383539-100383561 TGGTGCAGAAGGAGCCCAGGGGG + Intergenic
1132426968 15:101725586-101725608 TGCAGGAGAAGGAGCGGAGGGGG + Intergenic
1133301746 16:4786878-4786900 TGAAGCAGAAGGATCCCTGGAGG - Intronic
1134128163 16:11630469-11630491 TGGAGCAGGCGGGGCACAGGAGG - Intronic
1134607063 16:15579587-15579609 TTGAGCAGAAAGAGCCCAAGTGG + Intronic
1134861292 16:17562640-17562662 TGGTGCTGAAGGAACACCGGAGG - Intergenic
1135049800 16:19183673-19183695 TGGAGTCGAGGGAGTACAGGTGG - Exonic
1135256213 16:20943454-20943476 TGAAGCAGGAGGAGCACTTGAGG - Intronic
1135282829 16:21167428-21167450 TGGAGCCTAAGGAGGAGAGGGGG + Intronic
1136413569 16:30090899-30090921 GGGGGCAGAAGGGGCAGAGGTGG + Exonic
1136454340 16:30371774-30371796 TGGAACATGAGGAGCACAGAGGG - Intronic
1137424394 16:48365529-48365551 AGGAGCAGAAAGAGCCCAGGAGG - Exonic
1137490357 16:48927323-48927345 TGGGGCTGAAGGGGCAAAGGAGG + Intergenic
1137699469 16:50486430-50486452 AGGAGAAGAAGAAGAACAGGAGG - Intergenic
1137744549 16:50810961-50810983 GGGAGCAGAAGGAGCCTTGGAGG - Intergenic
1138075776 16:54041259-54041281 GGCAGGAGAGGGAGCACAGGGGG + Intronic
1138105439 16:54285176-54285198 TGGAGGAGGAGGAGCTCGGGGGG - Exonic
1138124435 16:54427145-54427167 TAGATCTGAAGGGGCACAGGAGG + Intergenic
1138619213 16:58198088-58198110 CGGAGAAGAAGGAGGAGAGGAGG + Intergenic
1139133345 16:64172537-64172559 TGGAGCAGCAAGAGAACATGGGG + Intergenic
1139435519 16:66934561-66934583 TGGAGCAGAAGGCGCTGAGAAGG + Exonic
1139831875 16:69805962-69805984 TGAAGCAGAAGGATCACTTGAGG + Intronic
1139962797 16:70727684-70727706 TGGAGAAGCAGGAGGGCAGGTGG + Intronic
1140357003 16:74315025-74315047 TGGAGCCAAAGGAGCTCAGGAGG - Intergenic
1141096208 16:81164922-81164944 TTCAGCAGAAGCAGCACAAGAGG + Intergenic
1141142328 16:81504703-81504725 TGGAGCACACACAGCACAGGTGG - Intronic
1141705376 16:85661724-85661746 TGGACCTGGAGGAGCGCAGGCGG + Exonic
1141805224 16:86337402-86337424 GGGAGCAGCAGGAGCCCTGGCGG - Intergenic
1142432442 16:90037230-90037252 AGGAGCAGATGGAGGACATGCGG + Exonic
1142812883 17:2403865-2403887 TGGAGCAGATGGAGTATTGGGGG - Intergenic
1143313124 17:6009998-6010020 TGGAGCAGAAGAGGGACAGCAGG - Intronic
1143515884 17:7418999-7419021 GTGAGGAGAAGGGGCACAGGCGG - Exonic
1143655520 17:8291359-8291381 TGGATGAGAAGGTGCACAGCTGG + Exonic
1143712081 17:8742161-8742183 TGGAGCAGAAGGACCACTCCCGG + Intronic
1144041389 17:11414110-11414132 AGGAGGAGAAGGAGGAGAGGAGG - Intronic
1144101041 17:11942546-11942568 TGGGGAAGAAGGAGCACTGGGGG + Intronic
1144163564 17:12585102-12585124 TGGAGGAGGAGTAGTACAGGAGG - Intergenic
1145753088 17:27369071-27369093 TGAAGCAGAGGGAGGACAGAAGG + Intergenic
1146021162 17:29280492-29280514 TGAAGCAGAAGGATCACTTGAGG + Intronic
1146386420 17:32379956-32379978 TGGTTCAGAAAGATCACAGGAGG - Exonic
1146633605 17:34488088-34488110 AGGAGCAGGTAGAGCACAGGAGG + Intergenic
1146677845 17:34785789-34785811 TGGAACCAAAGGAACACAGGAGG - Intergenic
1146987348 17:37232896-37232918 TGGAGGAGGAGGAGGACAAGGGG - Intronic
1147008018 17:37420215-37420237 TGGGGCAGAAGGATCACTTGAGG + Intronic
1147162233 17:38574923-38574945 GGGAGCAGAGGGAGCTGAGGAGG + Intronic
1147327336 17:39675756-39675778 GGGAGGAGAAGGGGTACAGGCGG + Intronic
1148540294 17:48475003-48475025 TGGGGCAGGAGGATCACCGGTGG - Intergenic
1149633821 17:58149858-58149880 TGGAGAAGAAGAAGCAGAGCTGG - Intergenic
1149856418 17:60087051-60087073 TGAAACACAAGGAACACAGGAGG + Intergenic
1149857908 17:60099490-60099512 TGGGGCAGGAGGAGGAAAGGAGG + Intergenic
1150291055 17:63982420-63982442 TGGGGCAGAGGGAGGGCAGGAGG + Intergenic
1150434128 17:65140969-65140991 TGGAGCTGCAGGGGCACAGGAGG - Intronic
1151212429 17:72554646-72554668 TGGCTCTGGAGGAGCACAGGAGG - Intergenic
1151868072 17:76818060-76818082 TGGAGCAGGAGGAAGAGAGGGGG + Intergenic
1152315796 17:79579638-79579660 TGGAGCAGAATGTGGTCAGGTGG + Intergenic
1152746491 17:82042457-82042479 AGGGCCAGAGGGAGCACAGGGGG + Intergenic
1153184834 18:2474379-2474401 TGGAGCTGCAAGAGCAGAGGAGG + Intergenic
1153837917 18:8980978-8981000 AGAAGAAGAAAGAGCACAGGAGG + Intergenic
1154387401 18:13907071-13907093 TGGAGCAAAAAGAGCAAAGTTGG + Intronic
1154415779 18:14174519-14174541 TGGAGCAGTAGGAGGGCAGGCGG - Intergenic
1156722481 18:40086985-40087007 TCGAGGAGAAGGAGCTCAAGAGG + Intergenic
1156962558 18:43050628-43050650 TGGGGCAGATGGAGGACAGAAGG - Intronic
1157493371 18:48138975-48138997 TGGGGCAGATAAAGCACAGGCGG + Intronic
1157688772 18:49664182-49664204 TGGAGTAGAAGTAGAGCAGGTGG - Intergenic
1158884687 18:61815990-61816012 TGGAGGAGGAGCAGGACAGGCGG - Exonic
1159409712 18:68055258-68055280 GGAAGCAGAGGGAGCCCAGGTGG + Intergenic
1159918838 18:74209403-74209425 TAGAGCAGAAGGAGGGAAGGAGG - Intergenic
1160105871 18:75975658-75975680 TGGAGCAGAATGAGCAAAGGGGG + Intergenic
1160969355 19:1760561-1760583 TGGAGGAGCTGGGGCACAGGGGG - Intronic
1161069614 19:2253558-2253580 TGGAGGAATAGGCGCACAGGTGG + Intronic
1161259417 19:3328555-3328577 TGAAGCAGAAGGATCACTTGAGG + Intergenic
1161586985 19:5110973-5110995 TGGAGGAGAAACAGAACAGGAGG - Intronic
1161614576 19:5262898-5262920 GGGAGCAGAAGGGGCACAAAGGG + Intronic
1161626593 19:5330565-5330587 AGGAGCCCAAGGTGCACAGGAGG - Intronic
1161797257 19:6394173-6394195 AGGAGCAGGAGAAGCACAGCGGG + Intergenic
1162717711 19:12644341-12644363 GCCAGCAGAAGGACCACAGGTGG - Intronic
1162795122 19:13083028-13083050 AGGAGCAGGAGGGGAACAGGAGG - Intronic
1162990891 19:14301429-14301451 TGCATCAGGAGGAGCACTGGAGG + Intergenic
1163054846 19:14710473-14710495 TGAAGCAGAATCAGCAAAGGGGG + Intronic
1163061200 19:14763613-14763635 GAGAGGAGGAGGAGCACAGGAGG - Intronic
1163061214 19:14763687-14763709 AGGAGGAGAAGGAGAAGAGGAGG - Intronic
1163581073 19:18139088-18139110 GGGAGCAGGAGGAGAACTGGGGG - Exonic
1163714654 19:18866711-18866733 AGGAGCAGAGGGAGCGGAGGAGG + Exonic
1164249635 19:23465774-23465796 AGGAGGAGAAGGAGGACATGAGG - Intergenic
1164249643 19:23465811-23465833 AGGAGGAGAAGGAGGAGAGGAGG - Intergenic
1164249652 19:23465845-23465867 AGGAGGAGAAGGAGGAGAGGAGG - Intergenic
1164249890 19:23467297-23467319 AGGAGGAGAAGGAGGATAGGAGG - Intergenic
1164292282 19:23879449-23879471 AAGAGAAGAAGGAGCATAGGAGG + Intergenic
1164292395 19:23880091-23880113 AGGAGAATAAGGAGGACAGGAGG + Intergenic
1164292542 19:23880900-23880922 TGGAGCAGGAGGAGTAGAGGAGG + Intergenic
1164324510 19:24180006-24180028 AGGAGGAGAAGGAGGAGAGGAGG + Intergenic
1164538481 19:29105023-29105045 TGGAGCAGATGGGGGAGAGGTGG + Intergenic
1164767084 19:30780488-30780510 AGAAGCAGAAGGAGCAAAGAGGG - Intergenic
1165104143 19:33459023-33459045 TGAATGAGAAGGAGCACAGCTGG + Intronic
1165818254 19:38656897-38656919 TGGATCAGAGGAAGCACAGAAGG + Intronic
1166106520 19:40600584-40600606 TGGAGCGGGAGGAGGGCAGGGGG - Intronic
1166221232 19:41365941-41365963 TGAGGCAGAAGGATCACATGAGG - Intronic
1166902176 19:46073039-46073061 TGGAGCAGGAAGTGGACAGGAGG + Intronic
1167396499 19:49232941-49232963 TGGTGTAGAAGAAGCAGAGGAGG - Intergenic
1167429020 19:49443632-49443654 TGGAGCAGATGGTGAAGAGGAGG + Intergenic
1168120168 19:54247567-54247589 TGGGGCAGCAGGAGGACAGCTGG - Intronic
1168121136 19:54253232-54253254 TGGGGCAGCAGGAGGACAGCTGG - Intronic
1202711593 1_KI270714v1_random:22260-22282 AGGAGGAGGAGGAGCAGAGGTGG - Intergenic
925621718 2:5800247-5800269 TACAGCTGAAGGAGCACAGAAGG + Intergenic
925663265 2:6225010-6225032 TGGAAAAGAAGCAACACAGGAGG - Intergenic
925973072 2:9121235-9121257 TGCAGCGGAAGGATCACCGGTGG + Intergenic
926250579 2:11153462-11153484 TGGGGCAGAAGGGGAAGAGGAGG + Intergenic
926354024 2:12023343-12023365 AGGAGAAGAATGAGCAAAGGGGG - Intergenic
926481575 2:13403581-13403603 TGGAGGAAAAGGAGAAAAGGAGG + Intergenic
927847630 2:26479655-26479677 TGGAGCAGAATGGGCCCAGAAGG + Intronic
927863498 2:26574849-26574871 TGCAGCAGCAAGAGCACAGGCGG + Intronic
928025033 2:27732540-27732562 TGAAGCAGGAGGATCACTGGAGG - Intergenic
928182561 2:29079920-29079942 GTGAGCAGAAGGAGCCCAGCAGG - Intergenic
928220078 2:29396173-29396195 TGGAGTATAAGCAGCACGGGAGG - Intronic
929488578 2:42376408-42376430 TGGAGAAGCAGGAGTGCAGGTGG - Intronic
929584759 2:43106640-43106662 TGTTGCAGAAAGAGCACAGAAGG - Intergenic
930112026 2:47686836-47686858 GGGAGCAGAAGGAGCTGAGAAGG - Intergenic
930125480 2:47792923-47792945 TGATGCAGAAGGATCACTGGAGG - Intronic
930330149 2:49972899-49972921 TGGAGCAGATGGAGGACAGAAGG - Intronic
931057287 2:58486987-58487009 TGCAGCAGAAGGAGAAAATGAGG - Intergenic
931743074 2:65266430-65266452 TGGAGCAGAGTGAGCAAGGGAGG + Intronic
932571262 2:72939673-72939695 TGGAGCTGGAGGAGCAGAGATGG - Intergenic
933247615 2:79993691-79993713 TGGGGCAGACAGAGCAAAGGAGG + Intronic
933441119 2:82315434-82315456 TGCAGAAGAAGGAGAAGAGGAGG - Intergenic
933797759 2:85934225-85934247 ACGAGCAGAAGGAGCAAACGTGG - Intergenic
934519508 2:95011009-95011031 TGGAGCTGGAGGCACACAGGCGG - Intergenic
934572465 2:95381734-95381756 TGGAGCAGCAGGAGGGGAGGAGG - Intronic
934590604 2:95546757-95546779 TGGAGAGGAAGAAGCACATGGGG - Intergenic
936067061 2:109340323-109340345 AGGAGCAGCAGGCACACAGGAGG + Intronic
936109342 2:109652172-109652194 TGGCGCAGCAGAAGCACAGCAGG - Intergenic
936452294 2:112642806-112642828 TGGAGTAGAGGGAGCTCAAGTGG - Intergenic
937071087 2:119063823-119063845 TGCAGCTGCAGGAGCACAAGAGG - Intergenic
937337660 2:121071723-121071745 TAAAGCGGAAGGAGCAGAGGAGG - Intergenic
937975473 2:127579816-127579838 TGAAGCAGAAGGATCACCTGAGG - Intronic
938258311 2:129877659-129877681 GGGAGCGGAAGGAGCAGGGGTGG + Intergenic
938416309 2:131105879-131105901 TGGAGCAGAGGGAGCAGCAGGGG - Intronic
938632679 2:133185402-133185424 TGGAGCAAAAGAAGCATAGCTGG - Intronic
939355499 2:141096353-141096375 TGAAGCAGGAGGATCACTGGCGG + Intronic
940311381 2:152282618-152282640 TGGAGTAGAAAAAGCACATGGGG - Intergenic
940794361 2:158061556-158061578 TGAAGGAGTAGGAGCTCAGGAGG - Intronic
941038205 2:160590535-160590557 GGGAGGAGAAGGAGAAGAGGAGG - Intergenic
941283990 2:163586183-163586205 TTGAGCAGAAGGAGTAAAGGGGG + Intergenic
942349717 2:175039610-175039632 TTGAGCAGAAGGTACACAGGTGG + Intergenic
943495003 2:188609432-188609454 TGGAGCAAAAGGAAGACAGAGGG + Intergenic
943685223 2:190810949-190810971 TGGAGCACAATGAGCCCAGGAGG - Intergenic
945428268 2:209734732-209734754 TGGAGTAGAAGGAGAATAAGGGG + Intergenic
946169830 2:217888293-217888315 TGGAGCAGATGGAGGAGAGGAGG - Intronic
946170904 2:217894957-217894979 GGGAGGAGAAGGAGAACAGATGG - Intronic
946323962 2:218973337-218973359 TGGAGTAGAAGGAACCCAGAAGG - Intergenic
946491292 2:220151758-220151780 TGGGGCTGATGGAGCACAGCTGG - Intergenic
947468771 2:230381051-230381073 TGGTGCAGAGGAAGCCCAGGTGG + Intronic
947852044 2:233296211-233296233 TGAGGCAGAAGGATCACTGGAGG + Intergenic
948078992 2:235190084-235190106 TGGAGCCGAAGGAGGAGATGGGG - Intergenic
948308166 2:236965383-236965405 TGGAGCAAGAGATGCACAGGTGG - Intergenic
948316941 2:237035186-237035208 CAGAGGAGAAGCAGCACAGGTGG + Intergenic
948660159 2:239501969-239501991 TGGAGCAGAAGGAGCTGGGCAGG - Intergenic
948956922 2:241300244-241300266 TGGCCCAGATGGAGCACCGGGGG - Intronic
1168873883 20:1156301-1156323 TGGAAGAGAAGGAGAAGAGGAGG + Intronic
1169518539 20:6345457-6345479 TGGAGCAGGAGGAAGAGAGGGGG + Intergenic
1169855835 20:10101878-10101900 TGCAGCAGAAAGAGAACACGTGG - Intergenic
1170942033 20:20856029-20856051 TGGTACAGAAAGAGCACAAGGGG + Intergenic
1171447936 20:25217823-25217845 TGAAGGAGAAGGACCAGAGGAGG - Intronic
1172071817 20:32262945-32262967 TGAAGCAGAAGGATCACTTGAGG + Intergenic
1172444977 20:34988171-34988193 TGGAGCAGGAGGAGTACAAGCGG + Exonic
1172733497 20:37108624-37108646 TGGATCACAATGAGCTCAGGAGG - Exonic
1172812586 20:37659644-37659666 TGGAACAGAAAGAGAACAGTTGG + Intergenic
1173741118 20:45402914-45402936 TGGAGCAGGAGGATCACTTGAGG + Intronic
1173790766 20:45826543-45826565 GGGAGAAGGAGGAGCACTGGTGG - Intronic
1173951457 20:46996849-46996871 TGGAGCAGGAGGAAGAGAGGGGG + Intronic
1174171112 20:48618754-48618776 TGGAGCTGAAGGAGCTGAAGGGG - Intergenic
1174202868 20:48819386-48819408 AGGAGGAGAAGGAGCCCTGGTGG - Intronic
1174979091 20:55372046-55372068 TGGAGCAGAAAGAACAAAGCTGG - Intergenic
1175116133 20:56683812-56683834 TGGAGCAGAAGCAGCAGAGAGGG + Intergenic
1175518292 20:59583280-59583302 GGGAGCAGAGGGAGGAAAGGTGG + Intronic
1175888958 20:62307652-62307674 TGGAGCAGAAGGGGCTGGGGTGG - Exonic
1175986785 20:62768048-62768070 AGGGGCAGCAGGAGCACTGGAGG - Intergenic
1176093391 20:63328825-63328847 GGGAGGACAAGGAGGACAGGAGG - Intronic
1176857562 21:13984785-13984807 TGGAGCAGTAGGAGGGCAGGCGG + Intergenic
1176867045 21:14059437-14059459 TGGAGCGGTAGGAGGGCAGGTGG - Intergenic
1177735292 21:25081643-25081665 TGGAGCAGGAGGAACAGAGAAGG + Intergenic
1178219973 21:30645172-30645194 AGGAGAAGAATGAGCACAAGGGG + Intergenic
1178548306 21:33512815-33512837 TGAGGCAGAAGAAGCCCAGGAGG - Intronic
1178598803 21:33978217-33978239 TGGAGCTGAGGGAGTAGAGGAGG + Intergenic
1179563079 21:42229009-42229031 TGGACCAGCAGGCGCAGAGGCGG - Intronic
1181313623 22:21958522-21958544 TGTAGCAGTAGGGGCACAGCGGG + Exonic
1181345185 22:22214884-22214906 TGGAGAAGCTGGAGCAGAGGTGG - Intergenic
1182123082 22:27799399-27799421 TGGGGCCGAGGGAGCGCAGGCGG + Exonic
1183579682 22:38716498-38716520 TTGAGCCGGAGGAGCACAGTGGG - Intronic
1183601389 22:38842555-38842577 TGGAGGAGGAGGAGCTCGGGGGG + Intronic
1183654812 22:39178176-39178198 TGGAGGAGGATGGGCACAGGGGG + Intergenic
1183795440 22:40113356-40113378 TGTCTCAAAAGGAGCACAGGTGG - Intronic
1183831590 22:40420975-40420997 CGGACCAGAAGCAGGACAGGGGG - Exonic
1184045731 22:41971293-41971315 AGGAGCCGTAGGAGGACAGGAGG + Intergenic
1184364293 22:44039910-44039932 TGAGGCAGAAGGATCACTGGAGG - Intronic
1184487956 22:44792514-44792536 TGGAGGAGCAGGAGGGCAGGGGG - Intronic
1185075959 22:48682361-48682383 TGGGGCAGAAGGGGTACAGGTGG + Intronic
1185221917 22:49633288-49633310 GGGATCAGAAAGAGCAGAGGAGG - Intronic
949143983 3:672932-672954 TGGAGCAAAGGGAGCAAAGCTGG + Intergenic
949266896 3:2167906-2167928 TGAAGCAGAAGGATCACTTGAGG + Intronic
950381845 3:12622667-12622689 TGGAGCAGAAGGAAGGTAGGGGG - Intronic
950671813 3:14531927-14531949 AGGAGCAGAAGGTGCCCCGGAGG - Intronic
954602271 3:51878784-51878806 TGGAGGAGAAGGATGACACGGGG + Intergenic
954690349 3:52392365-52392387 TGGAGCCCCAGAAGCACAGGTGG + Intronic
955876746 3:63498622-63498644 TGGAACAGCAGGAGCAAAGGCGG + Intronic
956788326 3:72661096-72661118 TGGGGCAGAAGGAGGAGGGGAGG + Intergenic
957075457 3:75599421-75599443 TGGAGAGGAAGAAGCACATGGGG + Intergenic
957195541 3:77062511-77062533 GTGAGCAGAAGGGGCACAGCTGG + Intronic
957198646 3:77103087-77103109 TGGAGCAGAAGGAGCACAGGGGG + Intronic
957218662 3:77353960-77353982 TGGAGTTGAAGGAGCAGTGGTGG - Intronic
957381076 3:79430551-79430573 GGGAACAAAAGGAGCACAGAAGG + Intronic
958448501 3:94244205-94244227 AGTAGCAGCAGCAGCACAGGTGG - Intergenic
959077371 3:101763441-101763463 TGCAGCAGAAGGATCACTTGAGG - Intronic
959349893 3:105249055-105249077 AGGAGCAAAAGGAGGGCAGGGGG - Intergenic
959381849 3:105650687-105650709 TGAAGCAGGAGGATCACAGAAGG - Intergenic
960055845 3:113275918-113275940 GGCAGCAGAGGGAGCATAGGGGG - Intronic
961002275 3:123382037-123382059 TGGAGCAGAGGGACAACAGGGGG - Intronic
961033323 3:123625102-123625124 TGGAGGAGAAGGCACAGAGGTGG - Intronic
961819848 3:129570455-129570477 GGGAGCAGGAGGAGCAGAGAGGG - Intronic
962334240 3:134511705-134511727 AGGAGGAGACGGAGCAAAGGGGG + Intronic
964415796 3:156446205-156446227 TGGAGCTTAAGGATCTCAGGTGG + Intronic
965672053 3:171157472-171157494 AGGAGCAGAAAGAGCAGAGGCGG - Exonic
965791293 3:172390879-172390901 TGGAGCAGCAGGAGCCGTGGTGG + Intronic
967101883 3:186222373-186222395 TGGAGCTGAAGGAGTTCTGGTGG + Intronic
967235928 3:187383462-187383484 TGGAGAAGACGGGGCCCAGGTGG + Intergenic
967238390 3:187411770-187411792 TGAGGCAGAAGGATCACATGAGG + Intergenic
968479720 4:827689-827711 AGGAGCAGATGGAGCAGAGCAGG - Intergenic
968647159 4:1746712-1746734 AGGTGCCGCAGGAGCACAGGTGG - Intergenic
968709099 4:2099621-2099643 TGGAGCAGAAAGGGGACAGCAGG + Intronic
968912682 4:3484051-3484073 CGGGCCAGAAGGTGCACAGGGGG + Intronic
969108962 4:4829377-4829399 TGGAGAGGAAGGAGGACATGAGG - Intergenic
969174732 4:5389925-5389947 TGCAGCTGCAGGAGCAGAGGTGG + Intronic
969475835 4:7422051-7422073 TGGAGGAAAAGTAGCAAAGGGGG - Intronic
969937447 4:10696328-10696350 TGGAGCAGATGCAGCAAAGGGGG - Intergenic
970357917 4:15276128-15276150 TGGAGCAAAAAGATCACAGCTGG + Intergenic
970596529 4:17605282-17605304 AGGAGCAGGAGAATCACAGGAGG - Intronic
970860677 4:20699580-20699602 TGGAGCTACAGGAGCACAGAAGG + Intronic
971294675 4:25377577-25377599 GGGAGCAGACCCAGCACAGGCGG - Intronic
971482519 4:27127126-27127148 CCGGGCAGAAGGAGCACAGCAGG - Intergenic
971643789 4:29169694-29169716 TGTGGTAAAAGGAGCACAGGAGG + Intergenic
971875723 4:32306019-32306041 TCTAGCAGAAGGAGGCCAGGCGG - Intergenic
972714592 4:41632895-41632917 GGGAGGTGAAGGAGGACAGGTGG + Intronic
973116039 4:46460591-46460613 TGGAGCAGAAAGAACAGAGCTGG + Intronic
973182466 4:47286507-47286529 TGGCGTAGCAGGAGCACAGGGGG - Intronic
973692904 4:53457279-53457301 AGGAGCAGAAAGAGTACAAGTGG - Intronic
973737344 4:53885663-53885685 TCTAGCAGAATGTGCACAGGAGG + Intronic
973786512 4:54337489-54337511 TGGAGCACAATGAGCAAGGGAGG - Intergenic
976563504 4:86528638-86528660 TGAAGCAGAAGGATCACCTGAGG - Intronic
977079522 4:92506944-92506966 TTTAGCAGTAGAAGCACAGGAGG - Intronic
977421094 4:96800759-96800781 TGAAGGAGAAGAAGAACAGGAGG - Intergenic
978104014 4:104879615-104879637 TGGAGCAGAAGTGGCAGAGCTGG - Intergenic
979379791 4:119995189-119995211 GGGAGCAGAAGGAGGAATGGAGG - Intergenic
981527193 4:145718751-145718773 TGGAACAGGATGAGCAAAGGTGG - Intronic
981551784 4:145948870-145948892 AGAAGGAGAAGGAGAACAGGTGG - Intergenic
982548354 4:156763094-156763116 GTGTGCAGAGGGAGCACAGGAGG - Exonic
982812541 4:159844222-159844244 TGGAGCAGAGTGAGCAGGGGTGG - Intergenic
984019965 4:174473742-174473764 TGGACCCGGAGGAGCAAAGGGGG + Intergenic
984391329 4:179137863-179137885 AAGAGCAGAATGAGAACAGGAGG + Intergenic
984848162 4:184125481-184125503 TGGGGCAGAGGGAGCGCAGGAGG + Intronic
984934936 4:184881825-184881847 TGGAGCAGAGGGAGCAAGTGGGG + Intergenic
984969891 4:185178739-185178761 TGGAACAGACTTAGCACAGGTGG + Intronic
985716788 5:1467464-1467486 TGGAGCAGGAGGAAGAGAGGAGG - Intronic
986040056 5:3985044-3985066 TGAAGGACAAGGGGCACAGGAGG + Intergenic
986392594 5:7300170-7300192 GGGAGCAGGAGGAGCAGATGCGG - Intergenic
986392615 5:7300275-7300297 GGGAGCAGGAGGAGCAGATGCGG - Intergenic
986392626 5:7300338-7300360 GGAAGCAGGAGGAGCACATGCGG - Intergenic
986392656 5:7300548-7300570 GGGAGCAGGAGGAGCAGATGCGG - Intergenic
986392665 5:7300590-7300612 TGAAGCAGAAGAAGCAGATGGGG - Intergenic
986392669 5:7300632-7300654 GGGAGCAGGAGGAGCAGATGCGG - Intergenic
986408978 5:7457499-7457521 AAGGACAGAAGGAGCACAGGTGG - Intronic
986804301 5:11294082-11294104 TGAAGCTGCAGGAGCACTGGTGG + Intronic
987004179 5:13692449-13692471 AGGAGGTGAAGGAGAACAGGTGG - Intronic
987373895 5:17217415-17217437 GGGAGCAGAGGGAGTGCAGGGGG + Intronic
987717671 5:21593140-21593162 TGGAGCAGGAGGAAGAGAGGTGG - Intergenic
987971786 5:24955653-24955675 TGGAGCAGGAGGAAGACAGATGG - Intergenic
989154155 5:38328206-38328228 CAGAGCAGGAGGAACACAGGGGG + Intronic
989708707 5:44370421-44370443 TTGAGCACAAAGAGCACATGAGG - Intronic
990863972 5:60359810-60359832 TGGATAAGAAAGAGAACAGGTGG - Intronic
990900815 5:60747021-60747043 TGGAGCAGAGGGAACAAAGTGGG + Intergenic
991057716 5:62337725-62337747 TGAAGCAGGAGGATCACATGAGG + Intronic
991503241 5:67298406-67298428 TGGGGCAGAAAGATCAAAGGAGG - Intergenic
992146809 5:73858897-73858919 TGGAGCAGAGGGAGTAAGGGAGG - Intronic
992565316 5:77990317-77990339 AGGAGCCAAAGGAGCACAGGAGG - Intergenic
992645671 5:78808827-78808849 CCGAGCAGAGGGAGCCCAGGGGG - Intronic
993101028 5:83540020-83540042 TGGAGCAGAAGGACCCACGGTGG + Exonic
993177463 5:84505886-84505908 TGGATCAGAAGGAGAAAAGATGG + Intergenic
993622571 5:90186198-90186220 AGGAGGAGAAGGAGAAGAGGAGG - Intergenic
994964349 5:106648728-106648750 TGGACCTCAAGGAGCAAAGGAGG + Intergenic
995248922 5:109967009-109967031 TGGAGCAGTGGCAGCAGAGGGGG - Intergenic
995793938 5:115922643-115922665 AGGAGCTGAAAGAGTACAGGTGG + Intergenic
995838535 5:116421802-116421824 TAGAGCAGAAGGAGGGAAGGGGG + Intergenic
996369842 5:122741572-122741594 TGGAGCAGTGGGAGCATTGGTGG - Intergenic
996509762 5:124305042-124305064 GGGAGAAGAAGGAGGACTGGAGG - Intergenic
996610004 5:125367225-125367247 TGAAGCAGAAGGATCACTTGAGG + Intergenic
996892260 5:128435601-128435623 GGGTGCAGCAGGAGCACAGATGG + Intronic
997031754 5:130138196-130138218 TGGAGCAAAAGAGGCACAGCTGG + Intronic
997432667 5:133851555-133851577 TGGAGGAGAAGGGGCACAGAAGG - Intergenic
999269492 5:150288604-150288626 TGAGGCAGCAGGAGCACGGGGGG - Intronic
999272101 5:150302625-150302647 TGGGGAAGAGGGAGCAAAGGCGG - Exonic
1000150461 5:158495644-158495666 TGGAATGGAAGGAGCACAGTTGG - Intergenic
1000243029 5:159426330-159426352 TGGACCAGCAGGAGCACCTGAGG + Intergenic
1000402167 5:160841451-160841473 TGAAGCAGAAGAAATACAGGAGG + Intronic
1000930689 5:167247604-167247626 GGGAGGAGAAGAAGCAGAGGAGG - Intergenic
1002114376 5:176946864-176946886 TTGAGCAGAAGGATGGCAGGGGG + Intronic
1002387849 5:178882455-178882477 TGGAGCAGAAGGATCAGAGGAGG - Intronic
1002450934 5:179318096-179318118 TGGACCAGGAGGAACACAGCAGG + Intronic
1002589842 5:180282901-180282923 GGGAGGAGAAGCAGCAGAGGCGG + Intronic
1003040325 6:2682017-2682039 TTGAGCAGGAGGAGAGCAGGAGG - Intronic
1004424081 6:15496106-15496128 TGGAGCAGCAGAAGCAGAGGTGG - Intronic
1004990429 6:21130957-21130979 TGGTGCAGAAGGAAAACTGGGGG - Intronic
1005000206 6:21232686-21232708 AGGACTAGAAGCAGCACAGGAGG - Intergenic
1005125444 6:22441838-22441860 TGAGGCAGAAGGATCACATGAGG - Intergenic
1005867114 6:29944598-29944620 TGGAGGAGGAAGAGCTCAGGTGG + Exonic
1005925757 6:30444218-30444240 TGGAGCAGGAGGAGGAAGGGAGG - Intergenic
1006513566 6:34534154-34534176 AGAAGCAGCAGGAGCAAAGGAGG - Exonic
1006810714 6:36818739-36818761 TGGAGTAGAGGGAAGACAGGTGG - Intronic
1007345758 6:41228460-41228482 AGGAGCAGCAGCAGCACAGGTGG - Exonic
1007389368 6:41541434-41541456 TGGAGCAGAAGAACCACAGGGGG + Intergenic
1007453048 6:41954629-41954651 GGAAGCAGAAGGATCACTGGAGG - Intronic
1007700997 6:43766514-43766536 TGGAGCAGAGGAAGCCAAGGAGG - Intergenic
1008050870 6:46899235-46899257 GGGAACAGAAGGAGATCAGGTGG + Intronic
1008078995 6:47175343-47175365 AGGACCAGAAGGATCACAAGGGG - Intergenic
1008095577 6:47336296-47336318 TGGAGCAGAGGGAGCATGGAAGG - Intergenic
1010461819 6:76122254-76122276 AGAAGCAGAAGGAGGACATGGGG - Intergenic
1010952133 6:82049444-82049466 TGGAGCAGAAGGGTTACTGGAGG - Intergenic
1011090528 6:83593491-83593513 TAGAGCAGGAGGAGCAGTGGTGG + Exonic
1012101037 6:95085182-95085204 AGGGGCTGAAGGAGCCCAGGGGG + Intergenic
1013231995 6:108168038-108168060 TGGGGCAGAGGGAGCAGAGAAGG + Exonic
1013780478 6:113723261-113723283 GGGAGAAGAAGGAGCAAACGTGG + Intergenic
1013807045 6:114007721-114007743 GGGAGCAGAAGCAGCCCATGGGG + Intronic
1014233325 6:118928613-118928635 TGAAGCAGAAGGATCACTTGAGG + Intronic
1014574225 6:123050615-123050637 TGGAGCAGAATGAGCTATGGGGG + Intronic
1015457001 6:133437736-133437758 GGGAGGAGAATGAACACAGGAGG + Intronic
1015928647 6:138334827-138334849 TGGAGAAGAAGGATCCCAGCCGG + Exonic
1015998502 6:139018821-139018843 TGTAGTAAAAGGAGGACAGGAGG + Intergenic
1017190840 6:151651040-151651062 TGGAGGAGAAGGAGAAAAGAAGG - Intergenic
1017870113 6:158479930-158479952 TGGAGAGGTAGGAGCAGAGGCGG - Exonic
1018029118 6:159828141-159828163 TGGAGCAGGAGGAAGACAGAAGG + Intergenic
1018610882 6:165646695-165646717 TGGAGCAGCAGGGGAGCAGGTGG - Intronic
1018633924 6:165843921-165843943 TGGAGCAGCAGGAGCACCTCTGG + Intronic
1019341281 7:510257-510279 GGGAGGAGAAGGAGCACCTGGGG - Intronic
1019358826 7:594582-594604 TGGGACAGAAGGAGCTGAGGAGG + Intronic
1019377455 7:700688-700710 AGGAGGAGAAGGAGAACAGGAGG + Intronic
1019575570 7:1736011-1736033 TGACGCAGCAGGTGCACAGGCGG + Intronic
1019724346 7:2592885-2592907 TGGGGCAGGAGGAGCACAAAAGG - Intronic
1019859070 7:3640087-3640109 TGGAGCAGGAGGATCACTTGAGG - Intronic
1020906986 7:14075612-14075634 TGGATCAGATGGACCACAGAGGG + Intergenic
1021208520 7:17814075-17814097 AGGAGCAGGAGGAGCAGTGGGGG - Intronic
1021313777 7:19120297-19120319 TGGAGCAAAAGTAGTCCAGGAGG + Intergenic
1022561917 7:31358328-31358350 TGGATCAGAAAGAGCAAAGCGGG - Intergenic
1023134049 7:37033226-37033248 CGGAGCAGGAGGAGCGCAGACGG + Intronic
1023897356 7:44445073-44445095 TGGAGGAGAGGGAGAACAGGTGG - Intronic
1024194304 7:47043753-47043775 TGAAGAAGAAAGTGCACAGGTGG - Intergenic
1024658368 7:51471439-51471461 TGGGGCAGAAGCAGCACTGACGG - Intergenic
1024950713 7:54857787-54857809 TGGAGCTGAACGAACACAGGAGG + Intergenic
1025014061 7:55424641-55424663 TGAAACAGAAGGAGGACAAGGGG + Intronic
1025827464 7:65022150-65022172 TGCAGCAGAAGGATCACTTGAGG - Intergenic
1025915002 7:65858607-65858629 TGCAGCAGAAGGATCACTTGAGG - Intergenic
1025945077 7:66099161-66099183 GGGAGGAGAAGGAGCGGAGGAGG + Intronic
1025945116 7:66099295-66099317 GGGAGGAGAAGGAGCGGAGGAGG + Intronic
1025950103 7:66138473-66138495 TGAAGCAGTAGGAGTAGAGGGGG - Intronic
1026217729 7:68364459-68364481 GGGAGGAGAAGGAGAAGAGGAGG - Intergenic
1026984919 7:74548669-74548691 TGAAGCAGAAGGATCACTTGAGG + Intronic
1027581668 7:80004599-80004621 TGGAGCAAAATGAGCAGTGGTGG + Intergenic
1028644267 7:93077436-93077458 TGGAGGAGAAGGAGCACTCTGGG - Intergenic
1029254465 7:99260243-99260265 TGGAGCAGGAGGAGTACAAGAGG + Intergenic
1029422097 7:100477179-100477201 TGGAGAAGGAGGAGGAGAGGGGG + Intronic
1029451110 7:100642165-100642187 TGGAGAAGGAGGGGCACAGGTGG + Intronic
1029606910 7:101604767-101604789 TGGAGCTGAAGAAGCACAGTGGG - Intergenic
1030007612 7:105134341-105134363 TGGAGCAGGAGGAGGAGAGAAGG - Intronic
1031948762 7:127869275-127869297 TGGAGCAGAGGGAGCAAAGGTGG + Intronic
1032080457 7:128856080-128856102 AGGACCAGAAGAAGCACAGAAGG - Intronic
1032195578 7:129786445-129786467 TGGAGGAGAAAGACCACAGGCGG + Intergenic
1032711009 7:134460130-134460152 TGGAGCAGAAAGAGCAGTTGGGG - Intergenic
1032761543 7:134947711-134947733 TGGAGGAGGAAGAGCAGAGGAGG + Exonic
1033537733 7:142327749-142327771 TGGAGCTGAAGGTGCTCAGCTGG + Intergenic
1033543622 7:142380232-142380254 TGGAGCTGAAGGTGCTCAGCTGG + Intergenic
1033551266 7:142450411-142450433 TGGAGCTGAAGGTGCTCAGCTGG + Intergenic
1033553537 7:142468983-142469005 TGGAGCTGAAGGTGCTCAGCTGG + Intergenic
1033555737 7:142487266-142487288 TGGAGCTGAAGGTGCTCAGCTGG + Intergenic
1033598976 7:142875682-142875704 TGCAACAGAAAGAGAACAGGTGG + Intronic
1034527961 7:151678089-151678111 TGGAGCAGGAGGGACACGGGTGG - Intronic
1035119008 7:156549379-156549401 TGGGAGAGAAGGAGCCCAGGAGG - Intergenic
1036468960 8:9032767-9032789 GGGAGGGGAAGAAGCACAGGTGG + Exonic
1036913712 8:12784428-12784450 TGGAGCAGGAGGAAGAAAGGGGG - Intergenic
1037515516 8:19627589-19627611 TGAAGCAGAAGGATCACTTGAGG + Intronic
1037619981 8:20555217-20555239 AGGAGCAGAGGGAACCCAGGGGG - Intergenic
1037838568 8:22228678-22228700 TGCAGCAGATGGAGCCGAGGAGG + Intronic
1038010772 8:23474381-23474403 TGGAGCAAAAGGAGCTCAAGGGG + Intergenic
1038222818 8:25626976-25626998 TGGAGCTTAAGGAACACAAGTGG + Intergenic
1038259119 8:25978155-25978177 TGGGGTAGACGGAGCACATGGGG - Intronic
1038483259 8:27915987-27916009 CAGAGGAGAAGGAGCCCAGGAGG - Intronic
1038487878 8:27949649-27949671 TGGGGTGGAAGGAGGACAGGAGG - Intronic
1039804987 8:40990160-40990182 TGCAGGATAAGGAGCATAGGGGG + Intergenic
1040871177 8:52101190-52101212 TGGAGCACACAGCGCACAGGTGG - Intergenic
1041696796 8:60744376-60744398 TGGACCAGAAGGATCAAAGTGGG + Intronic
1041917683 8:63152778-63152800 TGGAGAAGAAGGAGGAATGGAGG + Intergenic
1042482354 8:69318420-69318442 TGGAGAAGAAAGGGCACATGAGG + Intergenic
1043143796 8:76625198-76625220 GGAAGGAGAAGGAACACAGGAGG + Intergenic
1043472760 8:80578526-80578548 GGGAGCGGGAGGAGCAGAGGCGG - Intergenic
1043483577 8:80676872-80676894 TGCAGGAGGCGGAGCACAGGCGG + Intronic
1043695636 8:83213131-83213153 TGGAGCAGCAGGTCCACAGTAGG + Intergenic
1043702712 8:83312004-83312026 GTGGGCAGAAGGAGCCCAGGAGG - Intergenic
1043975385 8:86579557-86579579 TGGATCTGAAGGAGCAAATGAGG - Intronic
1045173753 8:99698032-99698054 TGGGGCAGCAGGAGGACAGGTGG - Intronic
1045856338 8:106769639-106769661 TGGAGCAGGAGGAGCCCACATGG - Exonic
1046357028 8:113100893-113100915 TGTGGCAGATGGAGCAGAGGTGG + Intronic
1046527256 8:115396413-115396435 TGGAGGAGAAAGAGCCCAGGAGG - Intergenic
1047081968 8:121472409-121472431 TGGAGCAGGAGGGGCAGAGACGG - Intergenic
1047185544 8:122629742-122629764 AGAATCAGAAGGGGCACAGGTGG + Intergenic
1048444399 8:134482328-134482350 TGGGGCAGAAGCAGCAGATGAGG + Intronic
1048625411 8:136179711-136179733 TGGTGCAGATGGATCACAGAGGG + Intergenic
1048988316 8:139747365-139747387 TGGAAGGGAAGGAGTACAGGAGG + Intronic
1049191293 8:141289174-141289196 GAGAGCAGAAGGGGCAGAGGCGG + Intronic
1049273229 8:141707202-141707224 AGGAGCAGAAGCAGGAGAGGAGG - Intergenic
1049276841 8:141724249-141724271 GAGAGCAGCAGGAGCACAGCGGG + Intergenic
1049277486 8:141727036-141727058 CGGAGCAGAAGGAGCCCAGCGGG - Intergenic
1049456688 8:142695573-142695595 AGGAGCAGAAGGAGAGCAGAGGG - Intergenic
1049945296 9:589416-589438 TGGAAAAGAAGGAGCAAAAGAGG + Intronic
1050013684 9:1210909-1210931 TGGAACAGAAGGAGAACAAGAGG - Intergenic
1050542511 9:6682208-6682230 TGGGGCAGATACAGCACAGGCGG - Intergenic
1050740992 9:8821113-8821135 AGGAGCAGAGGGATCAGAGGAGG - Intronic
1051767817 9:20543664-20543686 AGGAGGAGAAGGAGAAGAGGAGG + Intronic
1051898627 9:22014395-22014417 TGAAGCAGGAGGAGCTTAGGAGG - Intronic
1051921499 9:22271960-22271982 TGGAGCAGGAGGAAGAAAGGGGG - Intergenic
1052270240 9:26620887-26620909 TGGAGGAGTAGGATTACAGGTGG + Intergenic
1052995448 9:34549597-34549619 AGGGGCAGAAGGAGGAGAGGGGG - Intergenic
1054887424 9:70213692-70213714 TGGTCCACAAGAAGCACAGGGGG - Intronic
1054904286 9:70401099-70401121 TGGAGCAGGAGGATCACTTGAGG + Intronic
1056477950 9:86971030-86971052 TGGAGGAGAAAGAGAAGAGGAGG + Intergenic
1057549000 9:96038495-96038517 AGAAGCAGAAGGAGCCCAGCGGG + Intergenic
1057748281 9:97769939-97769961 TGGGGCAGAAGGAACAGATGTGG - Intergenic
1057804612 9:98211364-98211386 AGGAACAGAAGGAGCCTAGGTGG - Intronic
1057807624 9:98231225-98231247 TGGAGTAAGAGGAGCAGAGGAGG + Intronic
1059743035 9:117171670-117171692 GAGAGAAGAAGGAGCAAAGGGGG - Intronic
1060052403 9:120386763-120386785 TGGAGCAGGAGCTGCAGAGGAGG - Intergenic
1060228868 9:121812687-121812709 TGGAGCAGATGGAGGTCACGTGG - Intergenic
1060826509 9:126690917-126690939 AGCAGCAGAAGCAGCCCAGGTGG - Exonic
1061005170 9:127924822-127924844 TAGGGCAGGAGGGGCACAGGTGG - Intronic
1061038435 9:128126226-128126248 TGGACCAGAGGGAACAGAGGTGG - Intronic
1061893161 9:133633357-133633379 TGGAGCAGAGGCAGCAGGGGTGG + Intergenic
1061942926 9:133892682-133892704 AGGGGCACAAGGAGCTCAGGAGG + Intronic
1061967602 9:134025132-134025154 AGGAGCAGAAGGAGGAGTGGAGG - Intergenic
1062187779 9:135227845-135227867 CGGGGCTGAAGGAGGACAGGCGG - Intergenic
1062234750 9:135502459-135502481 TGGAGCAGCAGGTGGACATGAGG + Intronic
1062543528 9:137051951-137051973 TGGAGCAGGAGGAGGTCTGGGGG - Intronic
1203773151 EBV:59495-59517 AGGAGGAGAAGGAGCATACGAGG - Intergenic
1203773860 EBV:62205-62227 TGGAGCTGGTGGAGCACAGTGGG - Intergenic
1185920734 X:4089254-4089276 AGGAGGAGAAGGAGAAGAGGAGG - Intergenic
1186891698 X:13965449-13965471 TGGAGCGGTAGGAGAACAAGGGG - Intergenic
1187065342 X:15830249-15830271 TGGGGCAGGAGGAGGAAAGGAGG + Intronic
1187953711 X:24495294-24495316 TGGAGCAAATGAAGCAAAGGAGG - Intronic
1189096036 X:38140770-38140792 AGGAGCAGATGCAGCACATGTGG + Intronic
1189538805 X:41964920-41964942 TGAGGCAGAATGAGCCCAGGAGG - Intergenic
1190128212 X:47724263-47724285 TGGAGAAGAAAGAGCACAAATGG - Intergenic
1190302571 X:49065211-49065233 AGAAGCTGAAGCAGCACAGGAGG - Intronic
1190515832 X:51222918-51222940 TGCAGCATAAGCAGCAGAGGTGG + Intergenic
1193547174 X:82844930-82844952 TGGAGCAGGAGGAAGAGAGGAGG - Intergenic
1196730979 X:118941218-118941240 AGGAGAAGAAGGAGAAGAGGAGG + Intergenic
1198116770 X:133551790-133551812 TGGAGCTAGAGGGGCACAGGAGG - Intronic
1198450982 X:136767160-136767182 GGGAGCAGCTGGAGGACAGGCGG - Intronic
1198467554 X:136917125-136917147 AGGAGGAGAAGGAGAAGAGGAGG - Intergenic
1199250775 X:145659483-145659505 TGGACCTGAAGGTGCACAGAAGG + Intergenic
1199854678 X:151750778-151750800 TGGAGGGGAGGGAGCAAAGGTGG - Intergenic
1199901119 X:152173340-152173362 TGGAGAGAAAGGAGCACAGTAGG + Intronic
1200427415 Y:3036696-3036718 TGTAGCAGAAGGAGATGAGGAGG + Intergenic
1201474276 Y:14364040-14364062 TGAAACAAAAGGAGAACAGGAGG + Intergenic