ID: 957199055

View in Genome Browser
Species Human (GRCh38)
Location 3:77108618-77108640
Sequence ACCCTGGTGATGTAGGGTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 136}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957199047_957199055 0 Left 957199047 3:77108595-77108617 CCTCAGGTGGCAGTGAACCTTCC 0: 1
1: 0
2: 1
3: 16
4: 179
Right 957199055 3:77108618-77108640 ACCCTGGTGATGTAGGGTAGGGG 0: 1
1: 0
2: 1
3: 4
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957199055 Original CRISPR ACCCTGGTGATGTAGGGTAG GGG Intronic
900745511 1:4357958-4357980 CCCCTGGTGCTCTGGGGTAGAGG + Intergenic
905816589 1:40955624-40955646 ACCCTGGTGATGTTGCAGAGAGG + Intergenic
906655585 1:47546071-47546093 ACCCTGCTGGAGTAGGGTGGAGG - Intergenic
907221729 1:52911889-52911911 ACTCTGGTCATCTAGGGCAGAGG - Intronic
910475698 1:87603830-87603852 ATCCTGGTAATGTGGGGGAGTGG - Intergenic
915205974 1:154270595-154270617 ACCCTGGTGGTGTACGGATGAGG + Exonic
915330831 1:155111459-155111481 ACCCAGGTGCTGTGGGGCAGAGG + Intergenic
920678343 1:208054321-208054343 AGCCTGGTGGTGGAGGGGAGTGG + Intronic
922576594 1:226665007-226665029 AGCCAGGTGATATAGGGCAGAGG + Intronic
922819191 1:228472142-228472164 TCCCTGGTGAAGTGGGGTGGGGG - Intergenic
924469956 1:244334193-244334215 ACCCTGGAGAAGGAGGGAAGGGG - Intergenic
1063378109 10:5566194-5566216 AACCAGGTGATGTAGGCAAGAGG - Intergenic
1064488380 10:15821501-15821523 ACCCTGCTGGTTTAGGGTGGGGG + Intronic
1067524033 10:47027725-47027747 ACCTTGTGGATGCAGGGTAGGGG - Intergenic
1068620216 10:59174178-59174200 ACCCTGAAGATGTAGGGTGAGGG - Intergenic
1072709683 10:97707811-97707833 TCCCTGGAGCTGTAGGGCAGGGG - Intergenic
1075678072 10:124310420-124310442 ACCCTGGGGGTGGGGGGTAGGGG + Intergenic
1076078404 10:127555996-127556018 CCCCTGGTGTTGGACGGTAGAGG - Intergenic
1077368477 11:2170795-2170817 AGCCTGGTGGGGGAGGGTAGGGG + Intronic
1082218667 11:49605436-49605458 ACCATGGTGATGGGGGATAGTGG - Intergenic
1086630905 11:89018682-89018704 ACCATGGTGATGGGGGATAGTGG + Intronic
1087838824 11:102902088-102902110 ATTCTGGTGATCTGGGGTAGTGG - Intergenic
1092984449 12:13831993-13832015 CCCCTGGTGGTGAAGGGCAGTGG + Intronic
1095886442 12:47193457-47193479 ACCATGGTGATTGAGGGTTGGGG - Intronic
1096483325 12:51958264-51958286 ACCATGGTGATCTAGGGCAGTGG + Intronic
1097262011 12:57725613-57725635 CCCGTGGTGATCTGGGGTAGGGG - Intronic
1097333811 12:58360080-58360102 ACCCTGGGGATATAGGCAAGTGG + Intergenic
1098474801 12:70887934-70887956 TCCCAGGTGATGTAGGATATAGG + Intronic
1100556539 12:95700136-95700158 ACCCTGGTTGTGTAGTGCAGTGG + Intronic
1106012134 13:25835055-25835077 AGCATGGTGATGAAGGGCAGGGG + Intronic
1106606539 13:31234391-31234413 ACCATGGTGAAGTGGGGCAGGGG + Intronic
1111349545 13:87009239-87009261 ATGCTGGTGATGCAGGGGAGAGG + Intergenic
1118434946 14:65762282-65762304 GCCCAGGTAATGTGGGGTAGTGG + Intergenic
1118568516 14:67169486-67169508 ACCCTGGTGATTCAGGGAAAGGG + Intronic
1119573381 14:75695907-75695929 ACCCTGGGGAGGGAGGGGAGGGG - Intronic
1124636105 15:31366136-31366158 GGCCGGGTGATGCAGGGTAGGGG - Intronic
1126590191 15:50331438-50331460 ACCCTGGTGATCCAGGGAAATGG + Intronic
1127177888 15:56381576-56381598 ACCCTAGTGATATTGGGCAGGGG - Intronic
1129179809 15:73866967-73866989 AGCCTGGTGAGTTTGGGTAGGGG + Intergenic
1131919240 15:97304720-97304742 ATCAAGGTGATGTTGGGTAGGGG - Intergenic
1133330931 16:4973437-4973459 ACCCAGCTGATGAAGGGAAGTGG - Intronic
1134826613 16:17289629-17289651 ACCCTGATGATGTTGGGTCTTGG - Intronic
1137314188 16:47299442-47299464 AAGCTGGTGGTGTTGGGTAGAGG + Intronic
1138174582 16:54884959-54884981 AACCTGGTGATAGGGGGTAGGGG + Intergenic
1139442489 16:66975421-66975443 ACCCAGGTGTTTTAAGGTAGTGG - Intergenic
1141031036 16:80588878-80588900 ACCTTGGTGTTGAAGGGAAGGGG - Intergenic
1141477175 16:84281758-84281780 GCCCTGGTGATGACGGGTAGGGG - Intergenic
1141497882 16:84422513-84422535 ACCCTGGTGCAGTATGGGAGGGG + Exonic
1142611763 17:1112304-1112326 ACCCTGGGGATGGAGGACAGTGG + Intronic
1143020908 17:3916805-3916827 ACCCTGGTGGGGGAGGGTGGAGG - Intergenic
1144957673 17:19027314-19027336 AGCCGGGTGAGGCAGGGTAGGGG + Intronic
1144977483 17:19147202-19147224 AGCCGGGTGAGGCAGGGTAGGGG - Intronic
1150847540 17:68675023-68675045 GCCCTGGTAATGGAAGGTAGTGG - Intergenic
1151398186 17:73838860-73838882 ACCCTGGTGATGGAAAGCAGGGG - Intergenic
1151456854 17:74231706-74231728 AGCCCCGTGATGTAAGGTAGTGG + Intronic
1152904399 17:82962443-82962465 ACACGGGTGATTTAGGGTGGAGG + Intronic
1152904415 17:82962497-82962519 ACACGGGTGATTTAGGGTGGAGG + Intronic
1152904430 17:82962551-82962573 ACACGGGTGATTTAGGGTGGAGG + Intronic
1152904445 17:82962605-82962627 ACACGGGTGATTTAGGGTGGAGG + Intronic
1152982682 18:293383-293405 ACCCTGGAGATGTGGGGTGAGGG + Intergenic
1163773137 19:19202756-19202778 ACCCTAGAGATGGAGGGTCGAGG + Intronic
1167574811 19:50312896-50312918 ACCCTGGTGAAGCAGGGGTGAGG - Intronic
1167773636 19:51540398-51540420 ACCCTGGTGATCAGGGGTGGAGG + Intergenic
926345653 2:11942719-11942741 ACACTGGGGATGGAGGGGAGAGG - Intergenic
928445474 2:31330073-31330095 ATCCAGGTGAGGTTGGGTAGGGG - Intergenic
929206807 2:39305317-39305339 ATACTGATGATGTTGGGTAGAGG + Intronic
929910244 2:46083618-46083640 ATCCTGGTGCTGCAGGGCAGAGG + Intronic
930035297 2:47081263-47081285 ACCCTGGTGGTGTCTGGGAGGGG + Intronic
931763268 2:65434499-65434521 ACGCTGGTGATGTGTGGTGGTGG + Intergenic
933774296 2:85762601-85762623 TCCCTCCTGGTGTAGGGTAGGGG + Intronic
942624455 2:177884525-177884547 ACCATGGGGAGGTGGGGTAGAGG + Intronic
943748174 2:191484079-191484101 GCCCTGGTGGTGAAGGTTAGGGG + Intergenic
948686616 2:239674467-239674489 ACCCTGGTGAGGCAGAGTTGTGG + Intergenic
1169713931 20:8594458-8594480 AACCTGATGAAGTAGGTTAGGGG + Intronic
1170567963 20:17617280-17617302 ACCCCAGTGATGGAGCGTAGGGG - Intronic
1170906667 20:20521408-20521430 AATCTGGGGATGAAGGGTAGTGG + Intronic
1173494839 20:43511127-43511149 ACCCGGGAGGTGGAGGGTAGAGG - Intronic
1176784959 21:13244651-13244673 TCCTTAGTGGTGTAGGGTAGAGG - Intergenic
1180653874 22:17402455-17402477 ACTGTGCTGATGTAGGGCAGAGG + Intronic
1182904774 22:33925991-33926013 ATCCTGGTTATGTAGGTTTGGGG + Intergenic
1185339137 22:50283831-50283853 ACCCTGGTGATGACGGGCGGCGG + Exonic
949578778 3:5365642-5365664 AACCATGTGATCTAGGGTAGGGG + Intergenic
951477762 3:23126587-23126609 ACCCTGCTGATGAAGGGATGAGG - Intergenic
952514168 3:34087415-34087437 ATACTGGTTATGCAGGGTAGAGG - Intergenic
954639952 3:52091934-52091956 ACCCAGGTGATGAATGGTGGAGG + Intronic
956127087 3:66020870-66020892 TCCCAGGTGAAGTAGGTTAGGGG - Intronic
957199055 3:77108618-77108640 ACCCTGGTGATGTAGGGTAGGGG + Intronic
957527582 3:81396938-81396960 ACACAGGTGATGTAGCATAGTGG + Intergenic
961298128 3:125903609-125903631 ACCCTGGAGGTGGAGAGTAGCGG - Intergenic
961428814 3:126865428-126865450 AAGCTGGTGGTGGAGGGTAGAGG - Intronic
961444355 3:126972255-126972277 ACCCCCGTGATGGAGGGTGGGGG + Intergenic
961771712 3:129254835-129254857 AGCCAGGTGATGTGGGGTGGAGG + Intronic
966833888 3:184034485-184034507 GCTCTGGTGATGGAGGGTGGTGG + Intronic
967101996 3:186223214-186223236 CCGCCGGGGATGTAGGGTAGAGG - Intronic
968594248 4:1474165-1474187 GCCCTGGTGATGGAGGGGTGAGG + Intergenic
973227993 4:47808215-47808237 AACCTGGTGATGTACGGCATAGG - Intronic
973791427 4:54381406-54381428 ACCCTGGAGATTTAGGACAGTGG + Intergenic
984597706 4:181689531-181689553 ATTCTGGTGAAGTAGGGTTGCGG + Intergenic
986079239 5:4372432-4372454 ACCAGGGTGATGTATGGTAAGGG - Intergenic
992432972 5:76727582-76727604 AGCCTGGTAGTGTAGGGTTGAGG - Intronic
992793944 5:80238703-80238725 ACCCTGGAGACAGAGGGTAGAGG + Intronic
995836523 5:116405354-116405376 AGCCTGGTGATGTAGGGAGGAGG - Intronic
995943835 5:117618143-117618165 AAGCAGGTGATGTAGTGTAGAGG + Intergenic
997253942 5:132412208-132412230 ATCCTGCTGAGGTAGGGCAGCGG - Intronic
998458720 5:142293788-142293810 AGCCTGGGGATGTGGGGGAGAGG + Intergenic
999812722 5:155143090-155143112 TCCCTGGGGATGCAGGGTTGGGG - Intergenic
1002373943 5:178775134-178775156 ACCCTGGTGCTGGAGTGGAGTGG + Intergenic
1005972321 6:30771014-30771036 AGCCTGGTGATGTGGGGATGAGG - Intergenic
1006467959 6:34207195-34207217 CCCTTGGTGATGCAGGCTAGGGG + Intergenic
1008004919 6:46400753-46400775 ACCCTGCTGCTGTGGGGCAGTGG - Intronic
1010696426 6:78979987-78980009 ACCCTGGAGAGTTAGGGTAAAGG + Intronic
1012821006 6:104084423-104084445 AGCCTGTTGATTTAAGGTAGGGG - Intergenic
1013314148 6:108924895-108924917 ACGCTGGTGATGGAGAGAAGGGG + Intronic
1013572365 6:111441869-111441891 AACCTGTTGATGTGGGGTATGGG + Intronic
1014865811 6:126528619-126528641 ACTCTGGTAATGTAGGGTCTAGG + Intergenic
1019384395 7:746470-746492 ACCCTGGGCATGTTGGGTGGGGG - Intronic
1019968229 7:4518737-4518759 ACGCTGGTGTTGTTGGGTGGTGG - Intergenic
1022491963 7:30827558-30827580 ATCCTGGTGGTGTTGGGCAGAGG + Intronic
1022961220 7:35428842-35428864 ACCTTGTTAAAGTAGGGTAGAGG - Intergenic
1025092872 7:56077923-56077945 ACCCTGGGGATGTAAGGTGATGG + Intronic
1027523886 7:79243631-79243653 ATTCTGGTGATAGAGGGTAGGGG + Intronic
1029175514 7:98661851-98661873 ACTCTGGTGAGGTAGCGTGGAGG + Intergenic
1029310655 7:99660464-99660486 CCCCTGGAGATGAAGGGAAGAGG - Intronic
1032685162 7:134225266-134225288 ACCCTGGTGATGATTGGTGGGGG + Intronic
1034142776 7:148837919-148837941 ACCCTTGTGTTGTAGGGTAGAGG - Intronic
1036614015 8:10374358-10374380 ACCTTGGTGCTGTACGGGAGAGG + Intronic
1037911339 8:22745378-22745400 GCCCTGGTGATTCAGGGCAGGGG + Intronic
1039337142 8:36603653-36603675 ATCCTGGTGATGAAGGATTGGGG + Intergenic
1043074027 8:75673386-75673408 ACCCTGCTGATGTAGTCTACAGG - Intergenic
1049332019 8:142059647-142059669 GCCCTGGTGTGGTGGGGTAGAGG - Intergenic
1049841745 8:144777641-144777663 ACCCTGGGGCTGCAGGGTAAGGG + Intronic
1053005280 9:34600234-34600256 GCCTAGGTGAGGTAGGGTAGGGG + Intergenic
1056018777 9:82420475-82420497 ACTCTGGGGATGTGGGGTGGGGG - Intergenic
1056299667 9:85227936-85227958 ACCCAGGTGATGTACGGAGGTGG + Intergenic
1062424009 9:136497792-136497814 GCCCCGCTGATCTAGGGTAGAGG - Intronic
1187949195 X:24455296-24455318 ACCCTGGTGGCCTAGGGAAGAGG + Intergenic
1191013624 X:55787216-55787238 ACTCTAATAATGTAGGGTAGGGG - Intergenic
1192429075 X:71100576-71100598 ACCCTGATGATCTAGGGTTTAGG - Intronic
1194821277 X:98510010-98510032 ATCTTGTTGATGCAGGGTAGAGG + Intergenic
1197153377 X:123244396-123244418 AGCCTGGGGATGTAGGAGAGGGG - Intronic
1198443344 X:136685985-136686007 AGCCTAGAGATTTAGGGTAGTGG - Intronic
1200061813 X:153487185-153487207 ACCCTGGTGAGGCAGGGTGGGGG - Intronic