ID: 957214236

View in Genome Browser
Species Human (GRCh38)
Location 3:77298571-77298593
Sequence GTCATGGGAAACCACCATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 2, 3: 3, 4: 106}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957214230_957214236 25 Left 957214230 3:77298523-77298545 CCAGGGCAAAATATGAGACTGAA 0: 1
1: 0
2: 1
3: 20
4: 210
Right 957214236 3:77298571-77298593 GTCATGGGAAACCACCATTAAGG 0: 1
1: 0
2: 2
3: 3
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957214236 Original CRISPR GTCATGGGAAACCACCATTA AGG Intronic
900520357 1:3102385-3102407 GTCATGGGAAGCCACCTCTGGGG + Intronic
907814399 1:57903953-57903975 GTCTTGTTAAACCACTATTATGG + Intronic
908721898 1:67134631-67134653 TTCATGGGAAAGCAAAATTAAGG + Intronic
919084781 1:192909151-192909173 GTCATAGGAATCCAGCAGTATGG - Intergenic
919460537 1:197871972-197871994 CTCATGGAAAACCTCCACTAGGG - Intergenic
919764166 1:201115514-201115536 GTCATTGGAAGCCACCCTAAAGG - Exonic
1063796388 10:9517799-9517821 CCCCTGGGAAACCACCAATAGGG + Intergenic
1069808619 10:71142090-71142112 GTCTTCCGAAACCTCCATTATGG - Intergenic
1080762490 11:35265272-35265294 GTGATGTGAAACAACCATTCGGG - Intronic
1082107765 11:48239029-48239051 GAGATGGGAAACCACAATGAAGG - Intergenic
1084457224 11:69274888-69274910 CCCATGGGAAAGCAGCATTAGGG + Intergenic
1086144453 11:83536351-83536373 GTGATGGGAATGCACTATTAGGG - Intronic
1091312406 11:134584127-134584149 GTCACGGGAAATCCCCATAATGG - Intergenic
1091903785 12:4166038-4166060 GTGATGGGGAACCACCAGTTTGG - Intergenic
1092942217 12:13420524-13420546 CCCAGGGGAGACCACCATTAAGG - Intergenic
1099023651 12:77438130-77438152 ATCATGGTAAACCACAAATAAGG - Intergenic
1099108590 12:78527265-78527287 CTAATGGGAAATTACCATTAAGG - Intergenic
1099495710 12:83343442-83343464 CTCATGGAGAACCACTATTAGGG + Intergenic
1099681731 12:85837324-85837346 CTCATGGGAAAGCACTATTTAGG + Intergenic
1101930061 12:109006558-109006580 TTCCTGGGAAACCACAATAAAGG - Intronic
1105257872 13:18756673-18756695 CTCATGGAAAACCTCCACTAGGG - Intergenic
1105260529 13:18775982-18776004 CTCATGGAAAACCTCCACTAGGG - Intergenic
1105338115 13:19493881-19493903 GGCATGAGAAACCACCATGCTGG - Intronic
1106406459 13:29479086-29479108 GTCATCAGTAACCACCACTAGGG + Intronic
1109502470 13:63255685-63255707 CTCATGGAGAACCACCACTAGGG - Intergenic
1110096368 13:71527992-71528014 GTTATGGGAAACAATGATTAAGG + Intronic
1110299109 13:73904825-73904847 TTACTAGGAAACCACCATTATGG - Intronic
1111247227 13:85555299-85555321 GCCATGGGAAACCACTATAAAGG - Intergenic
1112402818 13:99090235-99090257 GTCCTGGGAAACCAACATGCTGG + Intergenic
1114321000 14:21547067-21547089 CTCATGGGAAACCTCTGTTAGGG - Intergenic
1120533168 14:85658507-85658529 GTCATTGGAGACCATTATTAAGG - Intergenic
1121611542 14:95284309-95284331 CTCATGGAAAACCTCCACTAGGG + Intronic
1122582673 14:102781064-102781086 GTGGTGGGAATCCACCATAAGGG + Intronic
1123032517 14:105458618-105458640 ATCCTGGGAAAGCCCCATTAGGG - Intronic
1123875243 15:24617539-24617561 CTCATGGAGAACCACCACTAGGG - Intergenic
1139362161 16:66406620-66406642 GTAATGGGAAATGACCACTAGGG + Intergenic
1139406422 16:66722445-66722467 GTCATGTTATACCACCATTCTGG - Exonic
1143276267 17:5713326-5713348 GTCTTAGAAAACCACCATTCAGG - Intergenic
1149319135 17:55467192-55467214 GTCATGGGAAACCATCCTTAGGG - Intergenic
1151746649 17:76015177-76015199 GTCAGGGGAACCCAGCATTCAGG - Intronic
1154425484 18:14268813-14268835 CTCATGGAAAACCTCCACTAAGG + Intergenic
1156122657 18:33863820-33863842 CTCATGGAGAACCTCCATTAGGG - Intronic
1157434609 18:47657877-47657899 GTTTTGGGAGACCACAATTAAGG + Intergenic
927487397 2:23497824-23497846 GTCAGGGGAAACCAACCGTATGG + Intronic
928749916 2:34459176-34459198 CTCATGGGGAACCTCTATTAGGG + Intergenic
930114751 2:47709025-47709047 GTCATGGGAAACCACCAAAGAGG - Intronic
930115241 2:47712540-47712562 GTCATGGGGAACAACTATTTGGG + Intronic
934493655 2:94779548-94779570 CTCATGGGAAACCTCTACTAGGG - Intergenic
937560528 2:123218826-123218848 GCCATGGGAAACCACTATCCAGG + Intergenic
938053888 2:128198982-128199004 TTCCTGGGAAACCACAATAAGGG + Intergenic
938554864 2:132415801-132415823 GTCATGTAAAAACAGCATTAAGG - Intergenic
1169721251 20:8679118-8679140 TTCATTGGTAACCACCAGTAAGG + Intronic
1170266527 20:14471757-14471779 GACATAGGAAACTACCTTTAGGG + Intronic
1172201563 20:33130555-33130577 GTCATGTGATACCACCAGAATGG + Intergenic
1175330958 20:58163532-58163554 GTCAAGGGAACCCACCTTTTGGG - Intergenic
1176735452 21:10541993-10542015 GACATGAGAAACCACCATGCTGG + Intronic
1178860969 21:36289294-36289316 TTTATGGGAAACCACCATCTGGG + Intronic
1183533684 22:38381370-38381392 GACATGAGAAACCACCATGCTGG - Intronic
1183615317 22:38941434-38941456 TTCATCAGAAAGCACCATTAAGG - Intergenic
953172177 3:40517125-40517147 TTCAAGGGAAACCTACATTAAGG + Exonic
953198732 3:40757392-40757414 CTCATGGGAACCCTCCATTGAGG - Intergenic
955826314 3:62951522-62951544 CTCATGGAAAACCTCTATTAGGG + Intergenic
956219762 3:66889720-66889742 ATGATGAGAAACCAACATTAAGG - Intergenic
956282298 3:67570477-67570499 GTCTTGGGAAAGAACAATTAAGG + Intronic
957214236 3:77298571-77298593 GTCATGGGAAACCACCATTAAGG + Intronic
959161044 3:102724774-102724796 GTCATGGAAAACCTCTACTAGGG + Intergenic
960460484 3:117928414-117928436 ATCATGGCAAAGAACCATTAGGG + Intergenic
961703613 3:128766374-128766396 GTCCTGGGTAACCACCGTCATGG + Intronic
962386205 3:134934530-134934552 CTCATAGGAAAGCACCATGAAGG - Intronic
963013335 3:140796874-140796896 ATTATGGAAAACAACCATTATGG - Intergenic
965404851 3:168255813-168255835 CTCATGGAGAACCTCCATTAGGG - Intergenic
968350520 3:198048536-198048558 CTCATGGGAAACCTCTACTAGGG - Intergenic
973367329 4:49218388-49218410 CTCATGGAAAACCTCCACTAGGG - Intergenic
983367459 4:166812235-166812257 GTCATAGAAAATCATCATTATGG - Intronic
988879853 5:35489957-35489979 GTCAAGGAAAAACACCCTTATGG - Intergenic
991136267 5:63185854-63185876 CTCATGGGGAACCTCGATTAGGG + Intergenic
994953149 5:106491495-106491517 ATAATGGGGAACCACCATTTTGG - Intergenic
999823496 5:155251891-155251913 GACATGGGTAACAACCATTTTGG + Intergenic
1001910981 5:175517555-175517577 GTAATGGCTAACTACCATTAAGG + Intronic
1009389210 6:63125610-63125632 ATCATTAGAAACCACCCTTATGG - Intergenic
1011735092 6:90302561-90302583 GACATGGGAAATCAGCATGAAGG + Intergenic
1012934469 6:105351774-105351796 GTCAGGGCAAACCACCATCCAGG - Intronic
1016707841 6:147134022-147134044 GTTATGGAAAACCACCATTATGG + Intergenic
1017812865 6:157996661-157996683 TTCATGAGAAACCACCACCATGG - Intronic
1019136666 6:169912819-169912841 GTCATGGGGAAGCAGCATTTTGG - Intergenic
1023735350 7:43231329-43231351 GTCATGTGAAAACACCAACAGGG - Intronic
1033252541 7:139773576-139773598 GTCTTGGGGAACCACCTTTGAGG - Intronic
1035780827 8:2227111-2227133 GTTTTGGGATACCACCCTTAGGG - Intergenic
1038937300 8:32266504-32266526 GTTCTGGGAAAACACCATTGAGG + Intronic
1040102293 8:43516450-43516472 CTCATGGAAAACCTCTATTAGGG + Intergenic
1040102934 8:43521206-43521228 CTCATGGGAAACCTCTACTATGG + Intergenic
1045484923 8:102623390-102623412 ATCATTGGAAATAACCATTAGGG - Intergenic
1046363341 8:113190828-113190850 GTCATGGAAAACAAACATTTAGG - Intronic
1050617314 9:7415724-7415746 GGCAAGTGAAACCACCATTTTGG - Intergenic
1052878230 9:33583519-33583541 CTCATGGGAAACCTCTACTAGGG + Intergenic
1053497753 9:38560688-38560710 CTCATGGGAAACCTCTACTAGGG - Intronic
1053663665 9:40302063-40302085 CTCATGGGAAACCTCTACTAGGG + Intronic
1053914178 9:42932605-42932627 CTCATGGGAAACCTCTACTAGGG + Intergenic
1054375789 9:64448296-64448318 CTCATGGGAAACCTCTACTAGGG + Intergenic
1054520950 9:66074222-66074244 CTCATGGGAAACCTCTACTAGGG - Intergenic
1057677216 9:97145173-97145195 CTCATGGGAAACCTCTACTAGGG - Intergenic
1058132164 9:101265430-101265452 CTCATGTGACACCAACATTATGG + Intronic
1058804435 9:108577369-108577391 GAAATGGGAATCCACCATTAAGG + Intergenic
1185603124 X:1353318-1353340 GTCATGGGACCCCCCCATCATGG + Intronic
1186258290 X:7746729-7746751 GAGATGGGAAATCACCATTTTGG - Intergenic
1188502563 X:30844306-30844328 TGCAAGGGAAACCACTATTAAGG - Intronic
1189395222 X:40615599-40615621 TTCATGGGAAACCAGGAGTAAGG - Intergenic
1193153460 X:78148269-78148291 GTCATGGGGAACCACTGCTAGGG + Intergenic
1194413550 X:93582572-93582594 GTCATAGGAAACTAGCATTGAGG - Intergenic
1195804135 X:108743558-108743580 GTGATGATAAACCTCCATTAAGG + Intergenic
1198128073 X:133667432-133667454 GTCATAAGAAAGCACCTTTAAGG - Intronic
1199815509 X:151393646-151393668 GTGGTAGGAAACCACTATTATGG + Intergenic