ID: 957216366

View in Genome Browser
Species Human (GRCh38)
Location 3:77324994-77325016
Sequence CAGAGTAAGTGCCAAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 353}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957216361_957216366 22 Left 957216361 3:77324949-77324971 CCATAGCCAAGATGCTGTAGGTA 0: 1
1: 0
2: 0
3: 10
4: 90
Right 957216366 3:77324994-77325016 CAGAGTAAGTGCCAAGTGGAAGG 0: 1
1: 0
2: 2
3: 29
4: 353
957216363_957216366 16 Left 957216363 3:77324955-77324977 CCAAGATGCTGTAGGTAGGAATG 0: 1
1: 0
2: 0
3: 21
4: 190
Right 957216366 3:77324994-77325016 CAGAGTAAGTGCCAAGTGGAAGG 0: 1
1: 0
2: 2
3: 29
4: 353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957216366 Original CRISPR CAGAGTAAGTGCCAAGTGGA AGG Intronic
901922623 1:12547853-12547875 CAGGGCAAATGCCAGGTGGATGG - Intergenic
902153183 1:14461404-14461426 CAGAATGAGAGCCAAGTGAAAGG - Intergenic
902688540 1:18095185-18095207 AAGAGCAGGTGCCAAGTTGAAGG - Intergenic
903287174 1:22284566-22284588 CAGAGTCAGTGCTAGATGGATGG - Intergenic
903337593 1:22635383-22635405 CAGAGTGGGCGCCAAGAGGAGGG + Intergenic
904025338 1:27499308-27499330 CAGAGGAAGGGCCATTTGGAAGG + Intergenic
904616282 1:31751922-31751944 GAGAGTAAGTGCCCAGTGCCTGG - Intronic
904616544 1:31753142-31753164 CAGAGTTAGTGCCAGCTGCAGGG - Intronic
905925077 1:41743855-41743877 CAGAGTAATTGGGAAATGGAAGG + Intronic
906138043 1:43514254-43514276 CAGAGAAAGTGCTAGGTGGTTGG - Intergenic
906633232 1:47389940-47389962 GAGAATAAGTGCAAAGTGCAGGG + Intergenic
906707028 1:47902350-47902372 CAGGGTGACTGCCAAGTAGATGG + Intronic
906877438 1:49554599-49554621 CAGAGAAAGAGCAAAGTAGAAGG + Intronic
908338891 1:63155866-63155888 CAGAGTAAGTGGCTATGGGAAGG - Intergenic
909592725 1:77370087-77370109 CAGAATAAGTCCAAAGTGGCAGG + Intronic
910503857 1:87926318-87926340 CAAAGTAAGTGCCAAATAGAAGG - Intergenic
910577236 1:88778681-88778703 CAGAGAAACAGCTAAGTGGAGGG - Intronic
910740476 1:90510247-90510269 CATGGTAAGGGCCCAGTGGAAGG + Intergenic
911032367 1:93503227-93503249 AAGAATAAGTGCCAAGCGAAGGG + Intronic
911663377 1:100528054-100528076 CAGAGTAATGGCCAAATGAATGG + Intergenic
911669118 1:100588120-100588142 GAGAATGAGAGCCAAGTGGAAGG - Intergenic
912018731 1:105075829-105075851 CAGAGTAAGTGCCAACGTCATGG + Intergenic
912184341 1:107256763-107256785 CAGGGTAAATGCCAAATGAATGG - Intronic
912963426 1:114216162-114216184 AAGAGTAATTGCCCAGTGGTAGG + Intergenic
915520421 1:156439297-156439319 CAGAGAAAGCGCCAAGTAGGGGG - Intergenic
916881011 1:169019485-169019507 CAGAGTAAGTGCTCAGGAGAAGG + Intergenic
917159121 1:172037690-172037712 CAGTGGAAATGCCAAGTAGATGG + Intronic
919003475 1:191865102-191865124 CAGAATGAGAGCCAAGTGAAAGG + Intergenic
919593465 1:199532751-199532773 CAGAATGAGAGCCAAGTGAAAGG - Intergenic
920118663 1:203639102-203639124 CAGAGGAAGTGCAGAGGGGAAGG + Intronic
920186198 1:204160944-204160966 CAGAGTAAGTGCCTAGTAAGAGG + Intronic
920706610 1:208255847-208255869 GAGAGTAAGTGCCTTGTGCAAGG + Intergenic
920954815 1:210608956-210608978 AAGAGGAAGTGCCAAGCGAAGGG + Intronic
923295203 1:232587877-232587899 AAGAGTGAGAGCCAAGTGGAAGG - Intergenic
923334777 1:232958637-232958659 GAGGGTAAGTTCCAAGAGGAAGG - Intronic
923411365 1:233713226-233713248 CAGAATGAGAGCCAAGTGAAAGG - Intergenic
924193337 1:241578906-241578928 AAGAGTGAGAGCCAAGTGAAAGG + Intronic
1063785340 10:9377429-9377451 CTTAGAAAGGGCCAAGTGGAAGG - Intergenic
1067677883 10:48401160-48401182 CTCATTTAGTGCCAAGTGGAGGG - Intronic
1069636313 10:69927030-69927052 CAAACCAAGAGCCAAGTGGAAGG - Intronic
1070280781 10:75046658-75046680 CACACTAAGAGCCAAGTGGAGGG - Intronic
1070437336 10:76406126-76406148 CAGGGGAAGTGCTGAGTGGATGG + Intronic
1070604326 10:77888204-77888226 CAGAGCAAATGCAAAGTGCAGGG + Intronic
1071702328 10:87953296-87953318 CAGTGTAAGAGCCAAGAGAAAGG + Intronic
1071778934 10:88820607-88820629 CGGATTTAGTGCCAAGTGCAGGG - Intergenic
1072265886 10:93727485-93727507 CAGAATGAGAGCCAAGTGAAAGG - Intergenic
1072395653 10:95037718-95037740 CAGATTATGTGAAAAGTGGAAGG - Intronic
1072538891 10:96383489-96383511 CAGAATGAGAGCCAAGTGAAGGG - Intronic
1073528236 10:104206385-104206407 GACAGTAAGTGCCAAGGGAATGG + Intronic
1074174334 10:110980932-110980954 CAGTGTAAGTTTCATGTGGATGG + Intronic
1074221035 10:111438204-111438226 CAGAGGAAATGTCAAGTGCAAGG - Intergenic
1075641540 10:124068145-124068167 CAGAGGCAGAGCCAAGGGGATGG + Intronic
1076251524 10:128987721-128987743 TAGAGTGACTGCCAAGTGAAGGG + Intergenic
1076460292 10:130639257-130639279 TGGAGGAAGTGCCTAGTGGAAGG - Intergenic
1077238175 11:1493861-1493883 CATATTAAATGCAAAGTGGAAGG + Intronic
1078623619 11:12932786-12932808 CTGAGTAAGTGACGAGTGAATGG - Intronic
1079863956 11:25711751-25711773 GAGAATAAGAGCCAAGTGAAGGG + Intergenic
1080098669 11:28434196-28434218 AAGAATAAGAGCCAAGTGAAGGG - Intergenic
1081691557 11:45081675-45081697 GAGAATGAGAGCCAAGTGGAAGG + Intergenic
1082037838 11:47660019-47660041 CAGTGTAAGTACAAAGTGTAAGG + Exonic
1083066820 11:59932193-59932215 CAGACAGAGTTCCAAGTGGAAGG - Intergenic
1083818430 11:65151196-65151218 CACAGTATGTGCCAGGTGCAGGG + Intergenic
1083841046 11:65304483-65304505 CAGAGTGTGTGCCATGTGGTAGG - Intronic
1084373463 11:68760237-68760259 CAGAGTACGTGTCCAGCGGAGGG - Exonic
1086085021 11:82945223-82945245 CAGAATGAGAGCCAAGTGAAAGG + Intronic
1088038543 11:105348965-105348987 CAGAATGAGAGCCAAGTGAAAGG + Intergenic
1089030041 11:115316491-115316513 AAGAGGAGGTGCCAAATGGAAGG - Intronic
1090352123 11:126114461-126114483 CCCAGTAACTGCCAAGTGTAGGG + Intergenic
1091089297 11:132754680-132754702 CAGAGTAAGTGACTAAGGGAGGG + Intronic
1092051290 12:5472533-5472555 GAGAGTAAGTGACCACTGGAGGG - Intronic
1092761961 12:11818727-11818749 CAGCATGAGTGCCAAGTGGAGGG - Intronic
1094174957 12:27531776-27531798 CGGAATAAATGCCAAGTAGATGG - Intronic
1095206856 12:39448072-39448094 GAGAATGAGTGCCAAGTGAAGGG - Intergenic
1096509550 12:52120101-52120123 CAGAGTAACTGGCCAGTGCAGGG + Intergenic
1097811570 12:64024791-64024813 GAGAATGAGTGCCAAGTGAAGGG + Intronic
1098641915 12:72849216-72849238 CTGATTAAGTGCCATGTCGATGG + Intergenic
1099029740 12:77511173-77511195 CAGAGTCAGTGCCACATAGAAGG + Intergenic
1099212416 12:79808248-79808270 CAGAGTAAGGGGAAAGTGGGAGG - Intronic
1099698896 12:86059771-86059793 CAGAGAAAGGGGCAAGTGAAAGG - Intronic
1099816276 12:87652718-87652740 AAGAGTAAGAGCCGAGTGAAAGG - Intergenic
1101382405 12:104225599-104225621 GAGAATGAGTGCCAAGTGAAGGG - Intronic
1101816600 12:108150707-108150729 CAGAGAGAGTGCCAAAGGGAAGG - Intronic
1102810164 12:115817345-115817367 CATATTAAGTGCTAAGTAGAAGG - Intergenic
1103039274 12:117681505-117681527 CAGAGTAAGTGACGAGGAGAGGG + Intronic
1103478903 12:121238255-121238277 CAGAGGAAATGGGAAGTGGATGG + Exonic
1106171647 13:27293712-27293734 CAGATGAAATTCCAAGTGGAAGG - Intergenic
1107916617 13:45158278-45158300 CAGAATGAGAGCCAAGTGAAAGG - Intronic
1108232240 13:48358381-48358403 CAGATTAAGTGCAGAGTGAAGGG - Intronic
1108853739 13:54767694-54767716 AAGAATAAGTGCCAAGCAGAAGG - Intergenic
1109077028 13:57848810-57848832 CAGGGTAAGTGCCAAATAAAAGG + Intergenic
1109686003 13:65820072-65820094 AAGAATAAGAGCCAAGTGAAGGG - Intergenic
1111376054 13:87380137-87380159 CAGAGTAAGCTGCACGTGGAGGG - Intergenic
1111770205 13:92586668-92586690 CAGGGTAGGTGCCAAATAGATGG + Intronic
1111791435 13:92861188-92861210 CAAATTAAGTGCCAATTGGTAGG - Intronic
1112858962 13:103807389-103807411 CAGAATGAGTGCCCAGTGAAGGG - Intergenic
1113006250 13:105705828-105705850 TAGAGTAAGTGCCAACTGTGAGG - Intergenic
1113218734 13:108073679-108073701 CTGAGTAAGTGCCAGGGGGTAGG + Intergenic
1113681775 13:112249520-112249542 CTCAGTAAGTGCCAACTGAATGG - Intergenic
1113693599 13:112329106-112329128 CAGAGTAAGTCCCAGCAGGATGG - Intergenic
1115085904 14:29514282-29514304 CAGAGTGAGAGCCAAGTGAAAGG + Intergenic
1117455883 14:55896500-55896522 GAGAATGAGAGCCAAGTGGAAGG - Intergenic
1118260111 14:64238565-64238587 CAGAGTACTTGCTAAGTGGCAGG + Intronic
1118287903 14:64493740-64493762 CAGAGTAACTGCCATGTGCTAGG + Intronic
1118402625 14:65393920-65393942 CAGAGTGAGAGCCAAGTGAAAGG + Intergenic
1119253364 14:73177050-73177072 CAGAATCAGTGTCAAGTGGGAGG - Intronic
1119743578 14:77028779-77028801 CAGAGGAAGTGTAAAGGGGAGGG - Intergenic
1120083190 14:80238178-80238200 GAGAATAAGAGCCAAGTGAAAGG + Intronic
1120205272 14:81581011-81581033 GAGAATGAGTGCCAAGTGAAGGG + Intergenic
1120316334 14:82898270-82898292 CTGACTCAGTGCCAAGTTGATGG - Intergenic
1122114250 14:99520034-99520056 CAGGGCAGGTGCCCAGTGGAGGG - Intronic
1122516436 14:102312179-102312201 CAGAGCAGGTGACAAGTGGCAGG - Intergenic
1124550021 15:30671815-30671837 GAGAATGAGTGCCGAGTGGAGGG + Intronic
1125749501 15:42019148-42019170 CATAGTGAGAGCCAGGTGGATGG - Intronic
1126465122 15:48954809-48954831 CACAGTAGGTCCCAAGTGGAGGG - Intronic
1127096674 15:55517980-55518002 CAGAGGCAGTGAAAAGTGGATGG - Intergenic
1127683787 15:61322214-61322236 CAGAGTTTGTGCCAACTGAAGGG + Intergenic
1128749033 15:70135336-70135358 GAGAATAAGAGCCAAGTGAAAGG + Intergenic
1128874927 15:71194041-71194063 GAGAGTGAGAGCCAAGTGAAAGG - Intronic
1128929787 15:71693784-71693806 GAGAGTAGGAGCCAAGTGAAAGG - Intronic
1129139145 15:73581377-73581399 CAGACTAAGTGGCAAGAGCAAGG + Intronic
1129295028 15:74595558-74595580 CAGAGGAAGAGCGAAGGGGAGGG - Intronic
1130047825 15:80459963-80459985 CACAGTCACTGCAAAGTGGAGGG - Intronic
1130147670 15:81286919-81286941 GAGAATAAGAGCCAAGTGAAAGG + Intronic
1130210802 15:81919797-81919819 CAGAGTGAGTGCCAAGTGAAGGG - Intergenic
1130802017 15:87274520-87274542 CAAAGTACATGCCAAGGGGAAGG + Intergenic
1130965610 15:88695500-88695522 CGGAATAAGTGTCAAGAGGAAGG - Intergenic
1131251949 15:90836796-90836818 CAGAGTGAGGGCACAGTGGACGG - Intergenic
1132309798 15:100849202-100849224 GAGAGTGAGAGCTAAGTGGATGG - Intergenic
1133141266 16:3746439-3746461 CAGAGCAGCTGCCACGTGGAAGG - Intronic
1134839699 16:17391867-17391889 GAGAATAAGAGCCAAGTGAAAGG - Intronic
1135657142 16:24260341-24260363 CATAGTAAGTGCTAAATGTAAGG - Intronic
1135828756 16:25754649-25754671 GAGAATAAGTGCCCAGTGAAGGG + Intronic
1136063955 16:27746470-27746492 CAGAGGAACTGACAGGTGGAGGG + Intronic
1136597579 16:31262196-31262218 AACAGTAAGAGACAAGTGGACGG - Intronic
1137272930 16:46914663-46914685 CAGAATAAATGCTAAGTGAATGG - Intronic
1137583478 16:49649410-49649432 CAGAGTAAGTCTCAGGTGGTAGG + Intronic
1138522136 16:57577170-57577192 CAGAGTAAGTGCTCAGTAAATGG + Exonic
1138963907 16:62060456-62060478 CCCAGTAAATGCCAAGTTGATGG - Intergenic
1139209438 16:65062627-65062649 CAGAGTAAGTGCCTAGGAAAAGG - Intronic
1139579339 16:67863037-67863059 CATAGCAAGTACCAGGTGGACGG + Intronic
1141021412 16:80500303-80500325 AAGAGTGAGAGCCAAGTGAAAGG + Intergenic
1141031302 16:80591430-80591452 CACAGTATGTGCCATGAGGATGG + Intergenic
1141525682 16:84609772-84609794 CAGACTGAGAGCCAAGTGAAGGG - Intronic
1142994048 17:3750635-3750657 CAGAGGAAGTGGCATTTGGATGG + Intronic
1143670930 17:8395459-8395481 CAGAGTAAGTGCTCAGTAAATGG + Intronic
1145889117 17:28402592-28402614 CCTACTAAGTGCCAAGTGGGTGG - Exonic
1146093469 17:29905655-29905677 CAGACAGAGTGCCAGGTGGAAGG + Intronic
1146263127 17:31434383-31434405 CAGGGAAAGTGGCAAGTGGAGGG + Intronic
1147462309 17:40581160-40581182 CAGAGTAGGTGCTCAGTGAATGG - Intergenic
1147565378 17:41533197-41533219 CAGAGTAAGACCCAGCTGGAAGG + Intergenic
1148674931 17:49439588-49439610 GTGAGTAAATACCAAGTGGATGG - Intronic
1149369223 17:55976792-55976814 GAGAATTAGTGCCAAGTGAAGGG + Intergenic
1149993436 17:61395330-61395352 CAGAGCAAGAGCCCAGGGGAGGG + Intergenic
1150317981 17:64185976-64185998 AAGGGTAAGTGCCAGGTGGCTGG + Intronic
1151002841 17:70398870-70398892 AAGAGTGAGAGCCAAGTGAAAGG + Intergenic
1152937206 17:83146183-83146205 CAGAATCAGTGCCAAGGGGATGG - Intergenic
1153845601 18:9046969-9046991 CAGAGTAAGTCCTCAGTGAATGG + Intergenic
1156445188 18:37231484-37231506 CAGAGGGAGTGCCAAGAGGGAGG + Intronic
1156866825 18:41898127-41898149 TAGAATAAGTTCTAAGTGGATGG + Intergenic
1157227718 18:45882398-45882420 GGCAGTAAGTGCCAAGTGAATGG + Exonic
1157989072 18:52473590-52473612 CAGATTGAGTGCCCAGTGAAGGG + Intronic
1158169611 18:54582636-54582658 CAGAACATGTGCCAAGTAGACGG - Intergenic
1158854767 18:61531813-61531835 GAGAATAAGTGCCAAGGGAAGGG - Intronic
1160081323 18:75730260-75730282 TAAAGTAATTGACAAGTGGAAGG - Intergenic
1161319427 19:3634125-3634147 CAGAGTGAGGGCCAAGTTCAGGG + Intronic
1163346380 19:16745154-16745176 CAGAGTGAGAGCCAAGCGAAAGG + Intronic
1163431266 19:17269081-17269103 CAGAGAAAGTGGTAAGTAGAGGG + Exonic
1166582759 19:43916814-43916836 CAGATTCAGGGCTAAGTGGATGG + Intronic
1167260233 19:48454092-48454114 CAGAGTGAGTTCCAGATGGAAGG - Exonic
925345258 2:3167617-3167639 CACAGTAAGTCCCAACTCGATGG - Intergenic
925669931 2:6300656-6300678 CAGAGTAAGAGCCAAGCAAAAGG - Intergenic
926352192 2:12006108-12006130 CAGGGAAAGTGCCAAATGGCAGG + Intergenic
927935989 2:27077087-27077109 CAGAAAAAGTGCCAAGGGGCAGG - Intergenic
928023223 2:27720339-27720361 CAGAGGATGTGCCCAGAGGATGG - Intergenic
928199679 2:29239661-29239683 CAGTGTAAGTGCCCAGAGCAGGG - Exonic
928403920 2:30999703-30999725 CATAGTAAGTGCCCAGTGAATGG - Intronic
928823118 2:35387186-35387208 CAGAGTGAGAGCCAAGTGAAGGG + Intergenic
928856854 2:35812998-35813020 CAGAGTTAGGGCCTGGTGGAAGG + Intergenic
929087680 2:38184405-38184427 CAGAATAAGAGCCAAGTGAAAGG + Intergenic
930819349 2:55629847-55629869 GGGAGTGAGTGGCAAGTGGAGGG - Intergenic
930957185 2:57217159-57217181 CAGAGCAGGTGCCAGGAGGAGGG - Intergenic
932575782 2:72961674-72961696 CAGAGTAGGTGCCAAGTTCAGGG + Intronic
932588338 2:73046068-73046090 TAGAGTAAATTCCAAGAGGAGGG - Intronic
932711704 2:74070314-74070336 GAGAATGAGAGCCAAGTGGAAGG + Intronic
932900136 2:75688253-75688275 CAGAGTACTTGCCATGTGGTAGG - Intronic
933748342 2:85586697-85586719 CAGAGTATGTGCCCATTGGATGG + Intronic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935029035 2:99304309-99304331 AAGAGTGAGAGCCAAGTGAAAGG - Intronic
935308296 2:101759326-101759348 CAGAGGAAATGCCAAGGAGATGG - Intronic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
938105233 2:128525712-128525734 CAGAGTATGTGTCAAGTGCCAGG - Intergenic
939188145 2:138884314-138884336 AAGAGAAAGGGCCAAGTGGCTGG - Intergenic
939667407 2:144968653-144968675 CAGGATGAGTGCCAAGTGAAAGG + Intergenic
939667688 2:144970600-144970622 GAGAATGAGTGCCAAGTGAAAGG + Intergenic
939748584 2:146010881-146010903 CAGAGACAGCGCCAAGAGGAAGG - Intergenic
940102642 2:150059515-150059537 CAGAGTAAGTGCCCAGTAAATGG + Intergenic
940307479 2:152241921-152241943 TAGAGTAAGTGAAGAGTGGAAGG + Intergenic
941180474 2:162253611-162253633 CAGAGTTTGTGCCAATTGGAGGG - Intergenic
941424188 2:165321633-165321655 GAGAGTGAGAGCCAAGTGAAAGG + Intronic
941666409 2:168247480-168247502 CAAAGGAAGTTTCAAGTGGAAGG - Exonic
942547372 2:177079066-177079088 CAGAGGAAAAGCCAAGGGGAGGG - Intergenic
943443734 2:187955945-187955967 CAGAGTAGGGGACAAGGGGAGGG + Intergenic
944011600 2:194980553-194980575 GAGAATGAGTGCCAAGTGAAGGG + Intergenic
945141915 2:206696052-206696074 GTGATTAAGTGCCAAGTGAAAGG + Intronic
946845042 2:223851409-223851431 CAGAATGAGAGCCAAGTGAAAGG - Intergenic
947063820 2:226197569-226197591 CTGATTAAGTGCAAAGTAGATGG + Intergenic
947371980 2:229456281-229456303 CAGAGTGAGAACCAAGGGGATGG + Intronic
1170553214 20:17494767-17494789 CAGAGGATGTGCCAGATGGAGGG - Exonic
1171979459 20:31617363-31617385 CAGGGTAATGGCCAAGGGGAAGG - Intergenic
1172215183 20:33230625-33230647 CAGAGTCAGTGCCCAGTAGTGGG - Intergenic
1175638137 20:60602653-60602675 CAGGGTAAATGCCCAGTGCACGG - Intergenic
1177606154 21:23379878-23379900 GAGAATGAGTGCCAAGTGAAGGG - Intergenic
1177627352 21:23680031-23680053 CAGAGTGAGTGCCCTGAGGAAGG - Intergenic
1177685778 21:24435416-24435438 CAGAATGAGAGCCAAGTGAAAGG - Intergenic
1178214652 21:30580634-30580656 AATAGTAAGTGCCATGTGGCAGG + Intergenic
1178461542 21:32806967-32806989 AAGAGTGAGAGCCAAGTGAAAGG + Intronic
1178775563 21:35547090-35547112 GAGAATAAGTGCCCAGTGAAGGG - Intronic
1179381442 21:40903023-40903045 GAGAATGAGTGCCAAGTGAAGGG + Intergenic
1179510033 21:41866510-41866532 CAGGCTTAGTGTCAAGTGGAGGG - Intronic
1181877193 22:25948863-25948885 CAGAGTAGGTGTCATTTGGATGG + Intronic
1182024788 22:27109612-27109634 AAGAGTGAGAGCCAAGTGAAAGG + Intergenic
1182852693 22:33489588-33489610 CAGAATGAGAGCCAAGTGAAAGG - Intronic
1184994703 22:48197000-48197022 CAGAATGAGAGCCAAGTGAAAGG - Intergenic
1185080398 22:48706434-48706456 CACTCTACGTGCCAAGTGGATGG - Intronic
949733719 3:7145859-7145881 TAGAGTAAATGCCAAGGGGGTGG + Intronic
950564400 3:13758480-13758502 CAGAGTAAGTGCCCATTAAATGG - Intergenic
951481982 3:23170787-23170809 AAGAGTGAGAGCCAAGTGAAAGG + Intergenic
951735049 3:25854116-25854138 CATAATAAGTACCAAGTGGGGGG + Intergenic
952298343 3:32081506-32081528 GAGAGTGAGAGCCAAGTGAAAGG + Intergenic
952577578 3:34793789-34793811 CAGAGTAAGTCCCACATTGAGGG - Intergenic
953060513 3:39424977-39424999 CAGAGTAAGTTCCTGGAGGATGG - Intergenic
953233953 3:41089632-41089654 AAGAGAAGGTTCCAAGTGGATGG - Intergenic
953682314 3:45048962-45048984 TAGAGAAAGTTCCAGGTGGAGGG - Intergenic
954409984 3:50366328-50366350 CAGAGTAAGTCCTAGGAGGAAGG + Exonic
956145054 3:66183795-66183817 CAGGGTAAGAGCCAAGTTCAGGG - Intronic
957216366 3:77324994-77325016 CAGAGTAAGTGCCAAGTGGAAGG + Intronic
958052558 3:88366915-88366937 CAGAATGAGAGCCAAGTGAAAGG + Intergenic
961179402 3:124864860-124864882 CATAGCAAGTTCCAAGGGGAAGG + Intronic
961430819 3:126881634-126881656 CAGAGTTAGTGCTGAGGGGATGG + Intronic
961607964 3:128111524-128111546 CAGTGGAAGTGCAAAGTGGTTGG - Intronic
961937994 3:130605853-130605875 CAGAATGAGAGCCAAGTGAAAGG + Intronic
963675068 3:148300368-148300390 AAGAAGAAGTGCCAAGTGAAAGG + Intergenic
964338364 3:155681783-155681805 CAGGGAAACTCCCAAGTGGATGG + Intronic
964851129 3:161097289-161097311 CACAGTAAGGGCTAAGTAGATGG + Intronic
965120414 3:164547481-164547503 AAGTGTATGTGGCAAGTGGAAGG + Intergenic
965688529 3:171330883-171330905 AAGAGTAAATGCCAAGTGAGTGG + Intronic
966183060 3:177204208-177204230 CAGCGTGAGTTCCAAGTGGGCGG - Intergenic
966675059 3:182576410-182576432 GAGAATAAGAGCCAAGTGAAAGG - Intergenic
967622688 3:191651943-191651965 GAGAGTGAGAGCCAAGTGAAAGG + Intergenic
969049023 4:4359501-4359523 GAGAATAAGAGCCAAGTGAAAGG - Intronic
969158714 4:5236244-5236266 CTGAGTGAGTGCCAGGTGGAAGG - Intronic
970275454 4:14394880-14394902 AAGAGTAGTTGGCAAGTGGAAGG + Intergenic
970471628 4:16384988-16385010 CAGACTCACTGCCAACTGGAAGG + Intergenic
972011071 4:34182860-34182882 CAGAATGAGAGCCAAGTGAATGG + Intergenic
973134159 4:46685583-46685605 CAGATTGAGTCACAAGTGGAAGG + Intergenic
973952341 4:56029097-56029119 CAGATTAACAGGCAAGTGGAAGG + Intronic
974679166 4:65138271-65138293 CAGAATGAGTGCTAAGTGAAGGG + Intergenic
976241871 4:82966567-82966589 CAGAGTAGGTGACAACTGCAAGG + Intronic
977729596 4:100334782-100334804 TAGAGTAAGTGCCATGAGTATGG - Intergenic
977835836 4:101645612-101645634 CAGAGAAAATGCTCAGTGGAAGG + Intronic
978160192 4:105537624-105537646 CTGAGTAAGTGCAATTTGGATGG - Intergenic
978456482 4:108898179-108898201 CAGAGTAATTGCAAAGTGAAGGG + Intronic
978514030 4:109552463-109552485 CAGAGTAAGGGCTAACTGGCAGG + Intergenic
978774592 4:112492880-112492902 AAGGGTGAGAGCCAAGTGGACGG - Intergenic
979405778 4:120309547-120309569 AAGAGTGAGAGCCAAGTGAAAGG + Intergenic
979462027 4:120994768-120994790 CAGAGGTAGGACCAAGTGGAAGG - Intergenic
980425941 4:132628188-132628210 GAGAATGAGTGCCAAGTGAAGGG - Intergenic
981204107 4:142018452-142018474 CAGACTCAGTTCCACGTGGATGG + Intergenic
981276516 4:142904564-142904586 GAGAATTAGTGCCAAGTGAAAGG + Intergenic
981755457 4:148137453-148137475 CAGAGTAAATGGCACGTGGTAGG + Intronic
982114816 4:152089598-152089620 CAGAATAAGTGTCCAGTGGGTGG + Intergenic
983245130 4:165279198-165279220 TGAAGTAAGTGCTAAGTGGAAGG + Intronic
984127900 4:175834923-175834945 AAGAGTAGGTGCCATGTGGCTGG - Intronic
985809006 5:2069446-2069468 CAGAGTGAGTGTCAGCTGGAAGG - Intergenic
986533081 5:8759482-8759504 CAGAGTGAGAGCCAAGTGAAAGG - Intergenic
987835480 5:23155296-23155318 GAGAATAAGAGCCAAGTGAAGGG - Intergenic
987847893 5:23311360-23311382 GAGAATAAGAGCCAAGTGAAAGG + Intergenic
989304705 5:39940104-39940126 CAGAATGAGTGCCCAGTGAAGGG + Intergenic
989673544 5:43947417-43947439 AAGAGTGAGAGCCAAGTGAAAGG + Intergenic
990978579 5:61580844-61580866 CAAAGGAAGGGCCAAGTGGCAGG - Intergenic
991417765 5:66409416-66409438 GAGAGTGAGAGCCAAGTGAAAGG + Intergenic
993517409 5:88855697-88855719 GAGAATGAGTGCCAAGTGAATGG - Intronic
995150745 5:108841743-108841765 GAGAGTGAGAGCCAAGTGGGAGG + Intronic
995220242 5:109640325-109640347 GAGAGTGAGAGCCAAGTGAAAGG - Intergenic
995630644 5:114128344-114128366 AAGAATGAGTGCCCAGTGGAAGG + Intergenic
995954347 5:117757255-117757277 CACAGTGAGTGCCTAGTGAAAGG + Intergenic
996356374 5:122600396-122600418 GAGAATGAGAGCCAAGTGGAAGG + Intergenic
996861507 5:128072168-128072190 GAGAATAAGAGCCAAGTGAAAGG - Intergenic
997136200 5:131329039-131329061 AAGAGTGAATGCCAAGAGGATGG + Intronic
998974011 5:147624380-147624402 AAGAGGAAGTTCCAAGTGGAAGG + Intronic
999028613 5:148263969-148263991 AAGAGTGAGAGCCAAGTGAAAGG + Intergenic
999176737 5:149637073-149637095 GAGAGGAAGGGCCAAGTGAAAGG + Intergenic
999693698 5:154170157-154170179 CAGAGTAAGAGCTCAGTGGATGG - Intronic
999694244 5:154174461-154174483 CAGAGTAAGTACAAAAGGGATGG - Intronic
999697194 5:154197743-154197765 CAGAGTAAGTGCTAAATAAATGG - Intronic
1000778263 5:165445998-165446020 AAGAAAAATTGCCAAGTGGATGG + Intergenic
1003091604 6:3108614-3108636 CAGAGTAAGTGCTCAGTAAACGG + Intronic
1003095397 6:3139215-3139237 CAGAGTAAGTGTCTAGTGAAAGG + Intronic
1004509386 6:16272655-16272677 CAGAGTAAGTGCCAAAGGACAGG - Intronic
1004641125 6:17516310-17516332 CAGAGTAAGTGCTCAGTAAATGG + Intronic
1004670805 6:17794775-17794797 CATAGTAAGTGCTCAGTGAATGG - Intronic
1006430584 6:33993324-33993346 CTGAGTGAGTGGGAAGTGGAAGG + Intergenic
1007449138 6:41930105-41930127 GAGGGGAAGTGCCAAGAGGAGGG - Intronic
1008451709 6:51659425-51659447 CACAGTGAGGGCCAAGTGAATGG + Exonic
1010899970 6:81414959-81414981 CAGGGTAAGTGCCAAATAAAAGG + Intergenic
1011382870 6:86760978-86761000 AAGAATGAGTGCCAAGTGAAGGG - Intergenic
1011592870 6:88987350-88987372 CAAAGTAAGTGCCCAATGAATGG - Intergenic
1011778487 6:90759809-90759831 ATGAGAAAGTGCTAAGTGGAGGG + Intergenic
1012652962 6:101780639-101780661 CAGAGGAAGAGAGAAGTGGAGGG - Intronic
1014977704 6:127909441-127909463 GAGAATGAGTGCCAAGTGAAGGG - Intronic
1016688540 6:146908907-146908929 GAGAGTTGGTGCCAAGAGGATGG - Intergenic
1018291389 6:162295514-162295536 CAGAATAAGTTCCATTTGGAGGG - Intronic
1018748258 6:166779641-166779663 CAGAGCAAGTGCTCTGTGGACGG - Intronic
1020273775 7:6612902-6612924 CAGAGAAGGGGCCAAGAGGAAGG + Intergenic
1020427475 7:8085581-8085603 CAGTGCAGGTGCCTAGTGGAGGG + Intronic
1022285695 7:28955395-28955417 CAGAGTAGGGGACAAATGGATGG - Exonic
1022964145 7:35457235-35457257 AAGAGTGAGTGCCAAGTGAAAGG + Intergenic
1026372220 7:69712097-69712119 CACAGTAAGTGCCATGATGAGGG - Intronic
1026686651 7:72515781-72515803 GAGAATGAGAGCCAAGTGGAAGG - Intergenic
1027233438 7:76284662-76284684 CTGAGTGGGTGCCAGGTGGAAGG - Intronic
1028044947 7:86106723-86106745 GAGAATGAGTGCCAAGTGAAGGG - Intergenic
1028689662 7:93637394-93637416 GAGAATTAGTGCCAAGTGAAGGG + Intronic
1029841739 7:103371649-103371671 CATAGTATCTGCTAAGTGGAAGG + Intronic
1030324575 7:108205580-108205602 CAGTGAAACTGACAAGTGGAAGG - Intronic
1030411514 7:109186497-109186519 CAAAATAAGTACAAAGTGGAAGG + Intergenic
1030773830 7:113508608-113508630 CAGAGTAATTGCCAAAAGCAAGG - Intergenic
1031193772 7:118587691-118587713 CAGAATAAGAACCAAGTGAAAGG - Intergenic
1031512726 7:122669707-122669729 CAGAGTATGTGTGATGTGGAAGG - Intronic
1032161637 7:129515419-129515441 CAGAATGAGAGCCAAGTGAAAGG - Intergenic
1032670212 7:134075499-134075521 CAGAATGAGAGCCAAGTGAAAGG + Intergenic
1032757054 7:134901130-134901152 CAGATTCAGTGCCAAGAGGGAGG + Intronic
1033922647 7:146413322-146413344 CACAGCAAGTTGCAAGTGGAAGG - Intronic
1033958295 7:146879948-146879970 CAGAACAAGAGCCAAGTGAAAGG + Intronic
1034613897 7:152397785-152397807 GAGAGTGAGTACCAAGTGAAAGG - Intronic
1037272166 8:17142196-17142218 GAGAGTGAGAGCCAAGTGAAAGG + Intergenic
1037750408 8:21678561-21678583 CACATTAAGTGCCTAGTGCAGGG - Intergenic
1038376117 8:27042078-27042100 CAGAATGAGAGCCAAGTGAAAGG + Intergenic
1038951588 8:32420946-32420968 CAGAGTGAGTGCCAAGTGAAGGG - Intronic
1039022088 8:33218944-33218966 CAGAGTAAGTACCAAGAAAATGG - Intergenic
1039946814 8:42136888-42136910 CAGAGACAGTGACAAGAGGAGGG + Intergenic
1040576014 8:48652208-48652230 GAGAGAAAGGGCCAAGGGGATGG - Intergenic
1041775906 8:61522644-61522666 GAGAATAAGTACCAAGTGAAGGG - Intronic
1042219450 8:66459303-66459325 CAGAGAAAGTTCCCAGAGGAAGG - Intronic
1042417861 8:68545251-68545273 CAGAATGAGAGCCAAGTGAAAGG - Intronic
1042879759 8:73473942-73473964 TAGACTAAGTTCCAAGTGGGTGG + Intronic
1043267036 8:78279336-78279358 CAGAGGAAGTGCCAGCTGGAGGG + Intergenic
1043970761 8:86526058-86526080 CACAGCAAGTGCCAGATGGAGGG + Intronic
1044011743 8:87002551-87002573 AAGAGTAAGTGCAAAGGAGATGG - Intronic
1045702120 8:104879340-104879362 GAGAATCAGTGCCAAGTGAAGGG + Intronic
1047539761 8:125753447-125753469 CAGAGAGAGTGCCAAATGGGAGG + Intergenic
1047701264 8:127451678-127451700 GAGAATAAGAGCCAAGTGAAAGG - Intergenic
1047874552 8:129121546-129121568 CAGATTAAGTGCTAAGTGAATGG + Intergenic
1049432689 8:142572546-142572568 CAGAGGAAGTGCCAGGGGCAGGG - Intergenic
1049532641 8:143162137-143162159 CTGTGTGGGTGCCAAGTGGAGGG - Intergenic
1050134098 9:2443183-2443205 AAGAGTCAGAGCCAAGTGAAAGG - Intergenic
1050640460 9:7661866-7661888 CAGAGTTAATCCCAAGTGGCAGG - Intergenic
1052014499 9:23449189-23449211 CAGAATAGTTTCCAAGTGGATGG + Intergenic
1052115943 9:24648789-24648811 CAGAGTAGGTGCCAAGAGTGGGG - Intergenic
1052660510 9:31422977-31422999 CAAAGACAGTACCAAGTGGATGG + Intergenic
1053530480 9:38876462-38876484 CAGTTTAAGTGACAAGTGGTTGG - Intergenic
1054765990 9:69042867-69042889 CAGAGTCTGTGCACAGTGGAAGG - Intronic
1055235882 9:74122834-74122856 GAGAGTAGGAGCCAAGTGAAAGG + Intergenic
1056318884 9:85418177-85418199 GAGAGTAAAATCCAAGTGGATGG + Intergenic
1059487226 9:114636063-114636085 CAGAGGAGGTGGCCAGTGGATGG + Intronic
1059734820 9:117090654-117090676 CAGAGTAAGCACCCAGTGGAAGG - Intronic
1061653799 9:132072197-132072219 CATAGTAAGTGCTAAGTAAATGG - Intronic
1062146995 9:134995038-134995060 CAGGGACAGTGCCAAGTGAATGG + Intergenic
1186117600 X:6321318-6321340 GAGAATGAGAGCCAAGTGGAAGG + Intergenic
1186623609 X:11268108-11268130 CAGAATAAGAGCCAAGAAGAAGG - Intronic
1188487139 X:30694411-30694433 TGAAGTAAGTGCTAAGTGGAAGG - Exonic
1194239329 X:91424125-91424147 GAGAATGAGTGCCAAGTGGAGGG - Intergenic
1195123362 X:101780093-101780115 TGAAGTAAGTGCTAAGTGGAAGG + Intergenic
1195318840 X:103704842-103704864 CAGAGGCAATGCCAGGTGGAAGG - Intergenic
1196503205 X:116410232-116410254 GAGAATGAGGGCCAAGTGGAAGG - Intergenic
1197076306 X:122357664-122357686 AAGAAAAAGTGCCAAGTGAAGGG + Intergenic
1197484866 X:127036482-127036504 GAGAATAAGTGCCGAGTGAAGGG + Intergenic
1199259032 X:145749184-145749206 CAGAGTGAGTGCCAAGCGAAGGG + Intergenic
1200206094 X:154317455-154317477 CAGAGGAAGGGCCAAGTGGTAGG + Intronic
1201479740 Y:14426982-14427004 GAGAATGAGAGCCAAGTGGAAGG - Intergenic