ID: 957216538

View in Genome Browser
Species Human (GRCh38)
Location 3:77327512-77327534
Sequence CCGGACCCATTATTGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 42}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957216530_957216538 10 Left 957216530 3:77327479-77327501 CCATTTTACAATTTAAGACCATG 0: 1
1: 0
2: 2
3: 22
4: 379
Right 957216538 3:77327512-77327534 CCGGACCCATTATTGGAGAAGGG 0: 1
1: 0
2: 0
3: 2
4: 42
957216532_957216538 -8 Left 957216532 3:77327497-77327519 CCATGCCCTTGAAAACCGGACCC 0: 1
1: 0
2: 0
3: 6
4: 109
Right 957216538 3:77327512-77327534 CCGGACCCATTATTGGAGAAGGG 0: 1
1: 0
2: 0
3: 2
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957216538 Original CRISPR CCGGACCCATTATTGGAGAA GGG Intronic
908021236 1:59901006-59901028 CCGGACCATTTTCTGGAGAATGG - Exonic
909764198 1:79334341-79334363 CTGGCCCCATTACTGGAGCAAGG + Intergenic
1069239897 10:66126536-66126558 CTGGCCCCTTTATTGGTGAATGG - Intronic
1070686661 10:78489798-78489820 CAGGCCCCTTTAATGGAGAAGGG - Intergenic
1081678861 11:44987864-44987886 CTGAACCCATTTTTGGAGATTGG - Intergenic
1083031194 11:59594032-59594054 CTGGACCGATTAGAGGAGAATGG - Exonic
1084752106 11:71210807-71210829 CCGGGCTCATTCTTGGAGCAGGG - Intronic
1106973583 13:35177022-35177044 CCGGATCCTTAATAGGAGAAAGG - Exonic
1107417569 13:40215701-40215723 CAGGACCCACTTTGGGAGAAGGG - Intergenic
1109271643 13:60262150-60262172 CTGGACCCATCATCGGAGACAGG - Intergenic
1120093964 14:80366675-80366697 CCAGTTCCATTGTTGGAGAATGG - Intronic
1124858358 15:33412637-33412659 CCAGGCCCAGTATTGGAGATGGG + Intronic
1128830655 15:70765132-70765154 CATGACCCATGTTTGGAGAATGG - Intergenic
1131655744 15:94456776-94456798 CAGCACCCTTTACTGGAGAAGGG + Intronic
1139346642 16:66307997-66308019 CCTGACCTAAGATTGGAGAAGGG + Intergenic
1139560551 16:67738964-67738986 CCAGATCCTTTTTTGGAGAAGGG + Intronic
1145099869 17:20065794-20065816 CCTGACCCATAATTAGAGAAGGG + Intronic
1152009287 17:77701044-77701066 CCGGACCCAGGCTTAGAGAAAGG - Intergenic
1156821675 18:41380345-41380367 CCGGATACAATATTGGAGGAGGG + Intergenic
1158163025 18:54507489-54507511 CTTGACAAATTATTGGAGAAGGG + Intergenic
1159751885 18:72312965-72312987 CAGCACCCATTATTGAATAATGG + Intergenic
1162718540 19:12648341-12648363 TCGGAGCCACTAATGGAGAACGG - Exonic
926129558 2:10293431-10293453 CAAGACCCATCATTGAAGAATGG - Intergenic
930283644 2:49401367-49401389 CTGGAGCCATTATTGCTGAAAGG - Intergenic
948605105 2:239129950-239129972 CCGGACCCAGTTTTGAAGAGCGG + Intronic
1180985352 22:19901017-19901039 CAGGGCCCATTCCTGGAGAAGGG - Intronic
1183612200 22:38916745-38916767 TTGGACCCATCAGTGGAGAAAGG - Intergenic
954613813 3:51959532-51959554 TGGGACACATTACTGGAGAAGGG - Intronic
957216538 3:77327512-77327534 CCGGACCCATTATTGGAGAAGGG + Intronic
966189609 3:177260124-177260146 TGGGGCCCATTATTGGTGAAAGG + Intergenic
993820323 5:92606828-92606850 ACGCACCCATTACTAGAGAAGGG + Intergenic
994427163 5:99605771-99605793 CAGGAACCATTATTTGAGTAAGG - Intergenic
994796806 5:104313257-104313279 CTGAACCAATTATTTGAGAATGG - Intergenic
1002272013 5:178078762-178078784 ACTGACGCATGATTGGAGAAGGG - Intergenic
1003130311 6:3389857-3389879 CCACACCCGTTAGTGGAGAACGG + Intronic
1009884619 6:69610962-69610984 CAGGACCTTTTATTAGAGAATGG - Intergenic
1023763480 7:43488720-43488742 CTGGGCCCCTTGTTGGAGAAGGG + Intronic
1033793094 7:144816274-144816296 CTTGGCCCCTTATTGGAGAATGG - Intronic
1048853257 8:138664176-138664198 GCGCACCCCTTGTTGGAGAAGGG - Intronic
1051114363 9:13677064-13677086 CCAGATCCAGTATTGGAGAGGGG - Intergenic
1059125407 9:111680006-111680028 TAGTACCCTTTATTGGAGAATGG - Intergenic
1059466634 9:114472880-114472902 CCGCATCCATGATTGGAGGATGG - Intronic
1185672896 X:1826092-1826114 CGGTACCCATTATTGGAGATGGG - Intergenic
1192000082 X:67140509-67140531 CTGGACCCAACAATGGAGAATGG - Intergenic
1197314961 X:124954395-124954417 TGGAACCCAGTATTGGAGAAGGG - Intronic