ID: 957217053

View in Genome Browser
Species Human (GRCh38)
Location 3:77334205-77334227
Sequence CAGGGTGGCCAGAGATTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 269}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957217053 Original CRISPR CAGGGTGGCCAGAGATTTTG AGG Intronic
900490576 1:2946929-2946951 CAGGGTGGGCCCAGGTTTTGTGG - Intergenic
900596228 1:3481374-3481396 CAGGCTGGCCAGTGGTTTAGAGG + Intergenic
901776811 1:11565708-11565730 CTGGGTGGCCACATCTTTTGGGG - Intergenic
904355789 1:29938704-29938726 CAGTTTGGCTAGAGATTCTGCGG + Intergenic
905248768 1:36633545-36633567 CAGGGTGGCCAGATCACTTGAGG - Intergenic
906003290 1:42445816-42445838 GAGGGAGGCCAGAGATGATGTGG + Intronic
907271325 1:53293138-53293160 CAGGGAGGGCAGGGTTTTTGGGG - Intronic
907841840 1:58165720-58165742 CAGAGTGGGCAGAGGTTTTGGGG + Intronic
912452894 1:109778193-109778215 CAGTCTGGCCAGAGATGCTGGGG - Intergenic
912634013 1:111274256-111274278 CAGGGTAACCTGAGATTTTGGGG + Intergenic
913347665 1:117824731-117824753 CAGGGAAGCCAGGGATTTGGTGG + Intergenic
914814165 1:151051180-151051202 CACGGTGACCAGAGATTTCTAGG + Exonic
915830407 1:159124075-159124097 AAGGGAGGACAGAGATTATGAGG - Intronic
918286558 1:183061146-183061168 CTGGTTTGCCAGAGTTTTTGTGG - Intronic
919901377 1:202046450-202046472 CAGGTTGGGCAGAGCTCTTGGGG + Intergenic
920114246 1:203608813-203608835 CAGGGAGGCCTGAGCTTTAGAGG - Intergenic
920543733 1:206798596-206798618 GAGGGTGGCCAGATTTTATGGGG - Intergenic
920899579 1:210093960-210093982 TAGGGTGGCCACAGATCATGGGG + Intronic
924164095 1:241264263-241264285 CAAGGTGGGCAGATAATTTGAGG + Intronic
1064083961 10:12331126-12331148 CAGGGTGGGCAGATCATTTGAGG - Intergenic
1064193648 10:13228318-13228340 CAGGGAGGCCAGGAGTTTTGAGG - Intronic
1067017179 10:42766718-42766740 AGGGGTTGCCAGAAATTTTGGGG + Intergenic
1069738059 10:70670465-70670487 CAAGGTGGCCCCAGATTTGGAGG - Intergenic
1072090825 10:92125559-92125581 CAGGGTGGACAGGCATTTTTTGG + Intronic
1072692015 10:97578191-97578213 CAGGCCGGGCAGAGAGTTTGGGG - Intronic
1073540190 10:104311569-104311591 CAGAGGGGCTAGAGCTTTTGAGG + Exonic
1073906509 10:108287074-108287096 TAGCCTGGCCAGAGATTCTGGGG + Intergenic
1074687773 10:115975729-115975751 CAGGGAGGCCAGAGCATTTGTGG + Intergenic
1075523844 10:123165628-123165650 CAGGATGGGCAGAGACTATGTGG + Exonic
1076131438 10:128016707-128016729 CTGGGTGGGCAGTGATTTGGTGG - Intronic
1078930745 11:15910604-15910626 CAGTGTGTCCACAGACTTTGGGG - Intergenic
1079140032 11:17802430-17802452 CAAGGGGGCTAGAGACTTTGAGG + Intronic
1079204259 11:18400283-18400305 CAAGGTGGCCAGTGATTTTCAGG - Intronic
1081004177 11:37713316-37713338 CAGGTTGGCCAGATATATAGAGG - Intergenic
1083018280 11:59479058-59479080 TAGGGTGGCCAGTGAGCTTGGGG - Intergenic
1086436525 11:86786513-86786535 CAAGGCGGGCAGATATTTTGAGG - Intergenic
1089590463 11:119537145-119537167 CAGGGAGGCCAGGGGTTTTAAGG - Intergenic
1090566066 11:127993408-127993430 GAGGGTGGGCAGAGATTTCAAGG + Intergenic
1090662981 11:128895056-128895078 TAGGGTGGCCAGATAGTATGGGG + Intronic
1090711161 11:129386958-129386980 CAGGGTGGCCAGATTTTCTTTGG + Intronic
1091238001 11:134034420-134034442 CAGGGAGCCCTGAGGTTTTGCGG + Intergenic
1092090567 12:5800294-5800316 CAGGATGGCCAGATCTCTTGGGG + Intronic
1092455363 12:8637923-8637945 CAGGGTGGCCAGGGGTGGTGAGG + Intronic
1093136537 12:15458993-15459015 CAGCCTGACCAGAGATTCTGGGG + Intronic
1094487713 12:30938281-30938303 GAGGGTGGACAGACATTTGGGGG - Intronic
1095158661 12:38889690-38889712 AAGGTTGGCCAGAGATTGTGAGG + Intronic
1095892701 12:47249676-47249698 GAGGGTGGCCAGAGATGCAGGGG + Intergenic
1097440626 12:59603438-59603460 CAGCATGGCCAAAGATTTGGCGG - Intronic
1098506054 12:71251743-71251765 CATCTTGGCCAGAGATTCTGGGG - Intronic
1100627854 12:96354929-96354951 CAGGGAGGGCAGAGGTGTTGCGG - Intronic
1101829697 12:108247988-108248010 CAGAGTGGCCAGAGTTCGTGAGG + Exonic
1103576475 12:121881308-121881330 CAGGGAGGGAAGAGATTTGGAGG - Intergenic
1104621783 12:130319299-130319321 CGGGGTGGCCATGGATTTTGGGG - Intergenic
1112272086 13:97977084-97977106 CGGGGTGGCCAGCGAAGTTGGGG - Intronic
1113083041 13:106536453-106536475 CAAAGTGACCAGAGATTTAGAGG + Intergenic
1114375350 14:22140419-22140441 CAGGCTTGCAAAAGATTTTGGGG + Intergenic
1115784661 14:36811144-36811166 CATGGTGTGCAGAGCTTTTGTGG - Intronic
1116439804 14:44938754-44938776 CAGGGCTGCCAGAGGTCTTGGGG - Intronic
1116712954 14:48392207-48392229 CAGGATTGCTGGAGATTTTGAGG + Intergenic
1117108165 14:52420220-52420242 AAGGGTGGCCCGGGATTGTGGGG - Intergenic
1117222543 14:53620314-53620336 CAGGGTGCCGAGAGACTTAGAGG + Intergenic
1119002956 14:70899527-70899549 CAAGGTGGCCAGATCATTTGAGG + Intergenic
1119117647 14:72041249-72041271 CAGCCTGGCTAGAGATTCTGAGG + Intronic
1119154189 14:72393374-72393396 CAAGCTGCCCAGAGATTTTTAGG + Intronic
1119645575 14:76346167-76346189 CAGAGTGGACATGGATTTTGAGG + Intronic
1120939715 14:89935640-89935662 CAAGGTGGGCAGAGAGGTTGAGG + Intronic
1121002764 14:90464126-90464148 CAGGGTGGTGAGAGATTAGGAGG - Intergenic
1125121218 15:36160937-36160959 CAGGGAGACTAGAAATTTTGTGG + Intergenic
1126692158 15:51296065-51296087 CAGGGAGGCCAGAGAGGCTGGGG + Intronic
1126777350 15:52111750-52111772 CAGCCTGGCCAGAGAGGTTGTGG - Intronic
1127718792 15:61679312-61679334 CAGGGTGGCCAGAGTATGAGGGG - Intergenic
1128844937 15:70884038-70884060 CAGGGTACCTAGAGATTATGTGG + Intronic
1129272100 15:74424468-74424490 CAGGGTGGCTGGAGGTTTGGTGG - Intronic
1129333192 15:74838220-74838242 CAGGGTGGCCAGAGGCCCTGTGG + Intronic
1129921228 15:79320819-79320841 CAGGTTGGCCAGATTCTTTGGGG + Intronic
1132404564 15:101534652-101534674 CAGGGTGGGCAGAGCTGCTGGGG - Intergenic
1132467960 16:86313-86335 CAGGGTGGCCACAGACTGGGGGG + Exonic
1133562561 16:6963629-6963651 CAGGGGTGCCAGAGATTATGTGG + Intronic
1134024453 16:10943221-10943243 CAGTGTGGCCTGAGATTTAAAGG - Intergenic
1134466178 16:14479956-14479978 TAGGGTAGACAAAGATTTTGGGG + Intronic
1135114651 16:19714492-19714514 CAGGGAGGCCAGGGATGTTGGGG - Exonic
1135546716 16:23371602-23371624 CAGGGTGGCCCAAGCTTTAGGGG + Intronic
1136611666 16:31370286-31370308 CAGGGTGCACAGAGATTTAAAGG + Intronic
1137054380 16:35736295-35736317 AAGGGTGGCCAGAGAGTCAGGGG - Intergenic
1137668506 16:50265952-50265974 CATGGTGCCCAGGGATGTTGGGG + Intronic
1137721745 16:50631598-50631620 CAGGCTGGCTAGAGATCCTGGGG + Intronic
1138013835 16:53411830-53411852 CATTGTTGCCAGAGATTTGGAGG + Intergenic
1138682198 16:58693219-58693241 CAAGGTGGGCAGATAATTTGAGG - Intergenic
1138832754 16:60395031-60395053 CAGGGTGGGCAGAGAGATGGTGG - Intergenic
1138950437 16:61906373-61906395 GTGGGTGGCCAGAGGGTTTGAGG - Intronic
1142048596 16:87942766-87942788 CATGGTGCCCAGATATTTGGTGG + Intergenic
1203139325 16_KI270728v1_random:1749820-1749842 CAGGAGTGCCAGAGAATTTGTGG + Intergenic
1142469815 17:157053-157075 CATGGTGGCCACAGATTGCGAGG + Intronic
1143495215 17:7308420-7308442 CGAGGGGGCCTGAGATTTTGAGG + Intronic
1144024269 17:11263648-11263670 CAGGCTGGCAAAAGATTTTTGGG + Intronic
1144213397 17:13034071-13034093 CGGGGTGGCCAGAGCTTTGTGGG + Intergenic
1145265973 17:21379754-21379776 CAGGTTGGCCAGAGCTTCAGAGG + Intronic
1145999542 17:29122973-29122995 CAGTGCGGCCAGAGATATGGGGG + Intronic
1148414436 17:47495322-47495344 GAGGGTGGGCAGAGATGATGTGG - Intergenic
1148584840 17:48770023-48770045 CAGGGTTGGCGGAGACTTTGGGG + Exonic
1148747360 17:49926159-49926181 CAGGGTGGCCAGTGGGGTTGTGG + Intergenic
1151073170 17:71240684-71240706 CAGGGTGGGCAGAGAGGATGGGG + Intergenic
1151640263 17:75387223-75387245 CAAGGTGGGTAGATATTTTGAGG + Intronic
1151671354 17:75573332-75573354 AAGGGTGGCCAGGGGTGTTGTGG + Intronic
1152887502 17:82860938-82860960 CAGGGTGGCCAGGGACTTGGCGG + Intronic
1153612653 18:6902107-6902129 CAGGGTGGGCATGAATTTTGGGG + Intronic
1155822829 18:30399550-30399572 CAGGGTGCCCAGATATTTTAAGG + Intergenic
1156289529 18:35734102-35734124 CAGTGTGGCCAGGCATTGTGAGG + Intergenic
1156343143 18:36230463-36230485 CAGATTGGCCAGAGATTCAGGGG + Intronic
1159772085 18:72558260-72558282 CAGAGTGTCCAGAGATGTTATGG - Intronic
1161849916 19:6732906-6732928 CAGGGTCTGCAGAGATTTGGGGG + Intronic
1163182581 19:15614964-15614986 CAGGGTGGCTGCACATTTTGGGG + Intergenic
1164554196 19:29237812-29237834 CAGGCTGGTCTGACATTTTGGGG - Intergenic
1164699381 19:30272581-30272603 CAGGGTTGCCAGAGGTTCAGGGG - Intronic
1164960897 19:32428577-32428599 CAGAGTGACCAGACATTATGTGG + Intronic
1165194371 19:34090152-34090174 CAGGGTGGGCAGAGCACTTGAGG + Intergenic
1166859246 19:45800346-45800368 CAGGGTGGGCAGAGATGGGGAGG - Intronic
1167371596 19:49085778-49085800 GTGGGTGCCCAGAGATTTCGGGG - Intronic
1168663830 19:58187310-58187332 CAGGGTTACCAGTGATTATGAGG - Intronic
925275459 2:2645139-2645161 CAGGGTGGCCAGAGGTGGAGGGG - Intergenic
926150835 2:10424845-10424867 CAGGGTGGCCAGGGAAGTTGGGG - Intronic
927802255 2:26111924-26111946 CAAGCTGGCTATAGATTTTGGGG + Intronic
927813051 2:26190924-26190946 CAGGGTGGCCAGGGGTGGTGAGG - Exonic
928497185 2:31845434-31845456 CAAGGTGGCGAGGAATTTTGGGG - Intergenic
930860655 2:56069740-56069762 CTGTCTGGCCAGAGATTTTAAGG + Intergenic
931715918 2:65028493-65028515 CAGGGTGCCCACAGATGCTGAGG - Intergenic
933144587 2:78836072-78836094 AAGGATAGCCAGAGAGTTTGTGG - Intergenic
935455798 2:103266415-103266437 AAGAGTGGACACAGATTTTGAGG - Intergenic
938748009 2:134299131-134299153 CAGAATTGACAGAGATTTTGTGG - Intronic
939465380 2:142547687-142547709 CAGCCTGCCCAGAGATTCTGGGG - Intergenic
941535468 2:166718069-166718091 TAGCCTGGCCAGAGATTCTGGGG + Intergenic
943122357 2:183752522-183752544 TAGGGTGGCCAAAAACTTTGAGG - Intergenic
943903970 2:193474601-193474623 CAGGTTGGCCAGTGCTTCTGCGG + Intergenic
944648405 2:201803855-201803877 CTGGGAAGCCAGAGATGTTGTGG - Intronic
945150022 2:206781260-206781282 CAGCTTAGCCAGAGATTCTGGGG + Intronic
947915758 2:233830769-233830791 CAGGGTGGCCAGGGATGGTGTGG - Intronic
948880096 2:240852300-240852322 CAGGGTGGCCAAAGGGTGTGTGG - Intergenic
1169011011 20:2250385-2250407 CAGGATGGCCAGAGAACTTAAGG - Intergenic
1169322178 20:4642031-4642053 CAGTCTGCCCAGAGATTTTGGGG - Intergenic
1170762744 20:19265181-19265203 CAGGCTAGCCAGGTATTTTGGGG + Intronic
1170793533 20:19527074-19527096 CAGGGAGACCAAAGGTTTTGGGG - Intronic
1172628658 20:36363663-36363685 CAGGGTAGCCAGGGATTCAGAGG - Intronic
1173379167 20:42522691-42522713 CAAGGTGGGCAGATAATTTGAGG - Intronic
1173602736 20:44307656-44307678 CAAGGTGGCCGGAGCATTTGAGG - Intronic
1174264892 20:49324217-49324239 CAGGCAGGTGAGAGATTTTGCGG - Intergenic
1174836443 20:53860041-53860063 CAGGAGTGCCAGAGAATTTGTGG + Intergenic
1174905568 20:54546868-54546890 CAGGGAGACCAGACATTTGGTGG + Intronic
1175394398 20:58649113-58649135 GAGGGAGGTCAGAGAGTTTGGGG + Intergenic
1176723901 21:10414386-10414408 GAGGGTGCACAGAGTTTTTGTGG + Intergenic
1179720967 21:43315835-43315857 CAGGCTGCCCAGAGACTGTGGGG + Intergenic
1180305149 22:11067560-11067582 GAGGGTGCACAGAGTTTTTGTGG + Intergenic
1181148502 22:20865881-20865903 CTGGGTGTCCAGAGTTTTTTGGG + Intronic
1181597261 22:23924216-23924238 CAGTGTGGCCAGAAGTTTTGTGG - Intergenic
1182332917 22:29563595-29563617 CTGGGTGGGCATAAATTTTGAGG - Intronic
1182661773 22:31930075-31930097 CAGGGTGGGCAGATCATTTGAGG + Intergenic
1182710369 22:32318903-32318925 CAGGGTGCCCTGATATTTGGTGG + Intergenic
1182799801 22:33022686-33022708 CAGGGTGTCAGGAAATTTTGTGG + Intronic
1183956334 22:41382411-41382433 GAGGGTGGGGAGAGGTTTTGAGG + Intronic
1183980580 22:41537526-41537548 CAGGGTGAACTGTGATTTTGTGG - Intronic
1184255514 22:43284585-43284607 CAGGGTTGCCAGTGGCTTTGGGG - Intronic
1184669324 22:46004511-46004533 CAGGGTGGCCAGAGACCCTTTGG - Intergenic
1185316918 22:50183291-50183313 CTGGGGTGCCAGAGCTTTTGAGG - Intergenic
949146927 3:712331-712353 CAGTGTGGCAATATATTTTGTGG - Intergenic
949421307 3:3868986-3869008 CATGGTGTCTAGAGGTTTTGGGG - Intronic
951638361 3:24805545-24805567 CAGGCTGGCAAGAGGTGTTGGGG - Intergenic
951750251 3:26027310-26027332 CTGTCTGGCCAGAGATTTTAAGG + Intergenic
953974992 3:47375673-47375695 CAGGGAGGCCAGAGTGTCTGCGG - Intergenic
957217053 3:77334205-77334227 CAGGGTGGCCAGAGATTTTGAGG + Intronic
958736474 3:98015426-98015448 CAAGGTGGCCAGATCATTTGAGG - Intronic
960413775 3:117359246-117359268 AGGGGTGGCCACAGAATTTGTGG + Intergenic
962842081 3:139243232-139243254 CAGGGTGTCCATAGATTCAGTGG + Intronic
962858098 3:139368433-139368455 GAGGGTGGCCAGCTATTATGTGG + Intronic
965532882 3:169792477-169792499 CAGGGTAGACAGAGTCTTTGTGG + Intergenic
966908838 3:184546639-184546661 CAGAGTATCCAGAGATTGTGAGG + Intronic
966978887 3:185111686-185111708 CAGTGTGGCCAGAGATCCTGGGG - Intronic
967632461 3:191761241-191761263 CAGTGAGGCGAGAGTTTTTGAGG + Intergenic
968073374 3:195801997-195802019 CAGGGTGGCCAGAGAGGGAGGGG - Intronic
968300315 3:197608038-197608060 CAGCATGCCCAGAGTTTTTGTGG - Intergenic
968688265 4:1975925-1975947 CAGGAAGGACAGAGATTTGGGGG + Intronic
968880167 4:3294507-3294529 CATCGTGGCCAGTGCTTTTGGGG + Intronic
969079434 4:4607054-4607076 CTGAGTGGACATAGATTTTGGGG + Intergenic
969418316 4:7075316-7075338 CAGGGTGGACAGATCATTTGAGG - Intergenic
969489978 4:7493650-7493672 CAGGGTGACCTGAGCTCTTGTGG + Intronic
969495534 4:7524113-7524135 CCTGGTGGACAGAGATTTTGGGG - Intronic
973047171 4:45549174-45549196 CAGAGTGGCCAGAGGCTTTGGGG + Intergenic
977588849 4:98804567-98804589 CAGGCTCGCAAGACATTTTGTGG - Intergenic
979876635 4:125899565-125899587 CAGGGTGGCCAGAGAGATAATGG - Intergenic
980620006 4:135288748-135288770 CAAGGTGGGCAGATATCTTGAGG + Intergenic
981215110 4:142155824-142155846 CAGAATGGCCACAGATTTTTAGG + Intronic
982584017 4:157214743-157214765 CAGCCTGGCCAGAGATTCTGTGG + Intronic
983256196 4:165403735-165403757 CAGGGTGGCCAGGGGTGGTGAGG - Intronic
984107297 4:175564276-175564298 CTGGGTGGACATATATTTTGGGG - Intergenic
984189812 4:176592140-176592162 CAGGGGGGCTTGAGATTTTGGGG + Intergenic
984749803 4:183261239-183261261 CAGGGAGGCCACAGACTTCGGGG - Exonic
986464290 5:8005986-8006008 CATAGTGGCCTGAGACTTTGGGG + Intergenic
986748346 5:10762842-10762864 CAGGGTGGCCAGAGAACTGGAGG - Intergenic
986883049 5:12198982-12199004 CTGGGTGGCAAGAAACTTTGTGG - Intergenic
987274734 5:16350449-16350471 CCGGGTATCCTGAGATTTTGTGG + Intergenic
987544606 5:19297179-19297201 CAGGGTAGTCAGGGATATTGGGG - Intergenic
988253711 5:28795611-28795633 CTGGGTGGACATAAATTTTGAGG + Intergenic
989378009 5:40785666-40785688 CTGGGTTGACATAGATTTTGTGG - Intronic
995332911 5:110965577-110965599 CAGTGTGGACAGAGATTTGCAGG + Intergenic
996453952 5:123658496-123658518 CTGGGTGGACATATATTTTGGGG + Intergenic
996560322 5:124821217-124821239 CAGGATGGACAAGGATTTTGGGG + Intergenic
996690169 5:126331918-126331940 CAGGGTGGGCAGATCTTTTGAGG - Intergenic
997581873 5:135023023-135023045 CAGGGTGGGCAGATCATTTGAGG - Intergenic
997626965 5:135337702-135337724 CAGGGTGGACCCAGATGTTGAGG + Intronic
998281769 5:140816695-140816717 CAGGCTGGCTAGAGATTCTAGGG + Intronic
998543695 5:143007281-143007303 CAGGGTTGCCAAAGACTCTGTGG - Intronic
1001059082 5:168472919-168472941 CAGGGTGGAGAGGGATCTTGAGG - Intergenic
1001473960 5:172036115-172036137 CAGGGAGGCCAGAAATGTAGAGG + Intergenic
1001924561 5:175626898-175626920 CATGGTGGCCAGACACATTGCGG + Intergenic
1002101660 5:176860916-176860938 CAGGGAGGCCAGAGAGTGAGAGG + Intronic
1002337126 5:178487567-178487589 CAGGATGGCCAGACATTTATGGG + Intronic
1002351227 5:178585108-178585130 CAGGGGAGGCAGAAATTTTGTGG + Intronic
1002855094 6:1029199-1029221 CAGAGAAGACAGAGATTTTGTGG + Intergenic
1003896070 6:10608945-10608967 CAGGGTGGCCAGAGAGCTCCTGG + Intronic
1004624046 6:17358119-17358141 CTGGGTTGCAAGAGATTTAGGGG + Intergenic
1004760145 6:18656897-18656919 CAGGGTGGCCACAGTCTCTGCGG + Intergenic
1006250278 6:32777814-32777836 CAGGGTTGCCTGAGGTCTTGGGG - Intergenic
1008467416 6:51846348-51846370 CAAGGTGGCCATGGATTTAGAGG - Intronic
1008714959 6:54277080-54277102 CATGTTGGCTAGAGATTTTGAGG - Intergenic
1010383395 6:75249660-75249682 CAGGGTGGCCAAATGTCTTGGGG + Intronic
1010504766 6:76643498-76643520 CAGTGTGGTCATAAATTTTGTGG + Intergenic
1011847586 6:91585643-91585665 CAGGGTGGGCAGATCTCTTGAGG - Intergenic
1012583896 6:100899361-100899383 CAGGCTGGTCAGAGATTCTCTGG - Intergenic
1013645043 6:112129056-112129078 CAGGGTGGATAGAGATGTGGAGG - Exonic
1014196670 6:118567997-118568019 CAGGGTGTACTGGGATTTTGAGG - Intronic
1015024195 6:128513809-128513831 CAAGGTGTCCTGGGATTTTGTGG - Intronic
1015827038 6:137325083-137325105 CAGTGGGGACAGAGAGTTTGTGG - Intergenic
1016307256 6:142697037-142697059 CAGGGGGACCAGCTATTTTGAGG + Intergenic
1017758945 6:157553191-157553213 CAGGGTGGTCAGAGATTCCCTGG + Intronic
1017982785 6:159416814-159416836 CAGAGTGGCCATAGATGTGGTGG - Intergenic
1018000630 6:159575674-159575696 CTGGGTGGACATAGCTTTTGGGG - Intergenic
1018606349 6:165601874-165601896 CAGGGTGGGATGAGATGTTGCGG - Intronic
1021485391 7:21162200-21162222 CAGGGCCCCCACAGATTTTGTGG + Intergenic
1021790008 7:24195395-24195417 CTGGATGCCCAGAGACTTTGGGG + Intergenic
1022088869 7:27095107-27095129 GAGGGTGCCCAGAGGTGTTGGGG - Intronic
1022462640 7:30625661-30625683 CATGGCAGCCAGTGATTTTGAGG + Intronic
1023113499 7:36838013-36838035 CAGGGTGGGCAGAGATGGGGTGG - Intergenic
1023828815 7:44027847-44027869 CAGGGTGGGCAGGGCTTTTGTGG - Intergenic
1024216674 7:47254431-47254453 CAGGGTGGCCGGACGTTCTGGGG - Intergenic
1026201296 7:68216839-68216861 CAGGGTGGGCAGATCTCTTGAGG - Intergenic
1026297049 7:69062196-69062218 CAGGCTGCCCAGATATTTGGTGG - Intergenic
1027854894 7:83498709-83498731 CAAGGTGGGCAGATAATTTGAGG - Intronic
1028993649 7:97076393-97076415 GAGGGTGGCCAGAGAAACTGGGG - Intergenic
1029739114 7:102482104-102482126 CAGGGTGGGCAGGGCTTTTGTGG - Intergenic
1029757115 7:102581283-102581305 CAGGGTGGGCAGGGCTTTTGTGG - Exonic
1029775056 7:102680344-102680366 CAAGGTGGGCAGGGCTTTTGTGG - Intergenic
1032065763 7:128769116-128769138 CAGCCAGGCCACAGATTTTGGGG + Exonic
1032203217 7:129838398-129838420 CAGAGAGGCCACACATTTTGAGG + Intronic
1033236620 7:139642849-139642871 CAGAGTGCACAGAGATCTTGGGG - Intronic
1033782485 7:144688912-144688934 CAGGGAAGCCATTGATTTTGGGG - Intronic
1033977961 7:147125427-147125449 CAGGGTGGCTTGAGACTGTGTGG + Intronic
1035064436 7:156094926-156094948 CAGGGTGGCCAGCAGTCTTGTGG + Intergenic
1039350505 8:36758990-36759012 CAGGGTTGCAAGACATTGTGGGG - Intergenic
1040862628 8:52015616-52015638 CAGACTGGGCAGAGATTCTGGGG + Intergenic
1041298374 8:56385957-56385979 CAGGGTGGCTAGAGAAAATGAGG + Intergenic
1043450838 8:80364869-80364891 CAGAGTGTACAGAGACTTTGAGG + Intergenic
1043546684 8:81323421-81323443 CAAGGTGGGCAGATAATTTGAGG - Intergenic
1044308957 8:90670621-90670643 CAGGGTTGGAAGAGAATTTGGGG - Intronic
1044350262 8:91156679-91156701 TAGTGTGGGCAAAGATTTTGTGG - Intronic
1044881990 8:96732696-96732718 CAATGTGGCCAGAAATTGTGTGG - Intronic
1047420645 8:124705236-124705258 CAAGGTGGGCAGACATCTTGAGG + Intronic
1050290255 9:4147019-4147041 CAGGGTGGCTAGAAAATTAGAGG - Intronic
1050350888 9:4740759-4740781 CACGGAGGCCGGAGGTTTTGGGG + Intronic
1052199238 9:25757672-25757694 CAGAGTGGCTAGGGATCTTGGGG + Intergenic
1053148745 9:35729809-35729831 CAGGTTGGGCAGAGAATGTGAGG + Intronic
1055717365 9:79132688-79132710 AAGGATTGTCAGAGATTTTGGGG - Intergenic
1057251148 9:93503556-93503578 AAGGGTTGCCAGAGGTTGTGGGG + Intronic
1058254297 9:102742187-102742209 CATGGTTGCCAGAGATTAGGAGG - Intergenic
1058600233 9:106660983-106661005 CAAGGTGGCAAGAAGTTTTGGGG - Intergenic
1060061395 9:120463413-120463435 CTGAGTGGCCAGAGCTGTTGGGG - Intronic
1060944431 9:127561608-127561630 CAGGGAGCCCAGAGGTTTTGGGG - Intronic
1061410063 9:130415731-130415753 CACGATGGCCAGGGATTGTGGGG + Intronic
1061879323 9:133560899-133560921 AGGGGTGGCCTGAGAATTTGGGG - Intronic
1187730275 X:22245549-22245571 CCGTGTGGCCAGATATTTTTTGG - Intronic
1188864083 X:35292967-35292989 CTGGGTTTCCAGAGCTTTTGAGG - Intergenic
1189905880 X:45759008-45759030 CAGGGGAGCCAGAGAATTTCTGG - Intergenic
1190982245 X:55466601-55466623 CAGGGTGGACATGTATTTTGGGG - Intergenic
1190986454 X:55506582-55506604 CAGGGTGGACATGTATTTTGGGG + Intergenic
1191638128 X:63400490-63400512 CAGGGAGGTCAGAGATTCTCTGG - Intergenic
1192006012 X:67213159-67213181 CTATCTGGCCAGAGATTTTGTGG - Intergenic
1192831471 X:74754996-74755018 AAGGAAGGCCAGAGATTTTATGG - Intronic
1195173842 X:102296009-102296031 CAGGGTGGACAGGAATTTGGCGG - Intergenic
1195185023 X:102391084-102391106 CAGGGTGGACAGGAATTTGGCGG + Intronic
1195842059 X:109184955-109184977 CATTGTCCCCAGAGATTTTGAGG - Intergenic
1197989563 X:132303272-132303294 CAGTATTGCCAGAGATTCTGGGG + Intergenic
1199950022 X:152699633-152699655 CAGGGTGACCAGAGAGTTGAGGG + Intronic
1199959652 X:152768828-152768850 CAGGGTGACCAGAGAGTTGAGGG - Intronic
1199970166 X:152853799-152853821 CAGGGTGGCTGGAGATTTACAGG - Intronic
1200090744 X:153634821-153634843 CCAGGTGGACAGATATTTTGGGG - Intergenic
1202160976 Y:21936544-21936566 CAGTAAGTCCAGAGATTTTGTGG - Intergenic
1202230380 Y:22649829-22649851 CAGTAAGTCCAGAGATTTTGTGG + Intergenic
1202312777 Y:23546336-23546358 CAGTAAGTCCAGAGATTTTGTGG - Intergenic
1202558025 Y:26124258-26124280 CAGTAAGTCCAGAGATTTTGTGG + Intergenic