ID: 957217694

View in Genome Browser
Species Human (GRCh38)
Location 3:77342965-77342987
Sequence AGGCACGGTCAGGTTCTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 105}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957217685_957217694 12 Left 957217685 3:77342930-77342952 CCGTCCTGGAGGCCGCAAGCCTG 0: 1
1: 0
2: 1
3: 28
4: 270
Right 957217694 3:77342965-77342987 AGGCACGGTCAGGTTCTGGTAGG 0: 1
1: 0
2: 0
3: 14
4: 105
957217684_957217694 17 Left 957217684 3:77342925-77342947 CCTCACCGTCCTGGAGGCCGCAA 0: 1
1: 1
2: 4
3: 22
4: 321
Right 957217694 3:77342965-77342987 AGGCACGGTCAGGTTCTGGTAGG 0: 1
1: 0
2: 0
3: 14
4: 105
957217686_957217694 8 Left 957217686 3:77342934-77342956 CCTGGAGGCCGCAAGCCTGAGAT 0: 1
1: 0
2: 15
3: 80
4: 312
Right 957217694 3:77342965-77342987 AGGCACGGTCAGGTTCTGGTAGG 0: 1
1: 0
2: 0
3: 14
4: 105
957217690_957217694 -7 Left 957217690 3:77342949-77342971 CCTGAGATTGAGGTACAGGCACG 0: 1
1: 0
2: 0
3: 2
4: 61
Right 957217694 3:77342965-77342987 AGGCACGGTCAGGTTCTGGTAGG 0: 1
1: 0
2: 0
3: 14
4: 105
957217688_957217694 0 Left 957217688 3:77342942-77342964 CCGCAAGCCTGAGATTGAGGTAC 0: 1
1: 0
2: 1
3: 12
4: 93
Right 957217694 3:77342965-77342987 AGGCACGGTCAGGTTCTGGTAGG 0: 1
1: 0
2: 0
3: 14
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957217694 Original CRISPR AGGCACGGTCAGGTTCTGGT AGG Intronic
903260744 1:22130429-22130451 AGGGATGGTCAGGTTATGGGTGG + Intronic
904917620 1:33981821-33981843 GGGCACAGTGAGGTTCTGCTGGG + Intronic
905938097 1:41840720-41840742 TGGCACGGCCAGGATCTGATGGG - Intronic
906035662 1:42748901-42748923 AGGCACCGTCACGTCGTGGTGGG + Intronic
910329906 1:86059909-86059931 CAGCCCGGTTAGGTTCTGGTGGG - Intronic
916658864 1:166902331-166902353 AGGCAAATTCAGGTTCTGTTGGG - Intergenic
920204972 1:204284565-204284587 AGGCACAGTCATTTTCTGGCTGG - Intronic
920710390 1:208289059-208289081 AGGCATGGTCAGTTTTTGTTTGG + Intergenic
923049140 1:230378469-230378491 AGGCATGCTCAGGTGCTTGTAGG - Intronic
1062863176 10:826313-826335 AGGCCCTGTCAGGCTGTGGTTGG - Intronic
1067368761 10:45662017-45662039 CAGCATGGGCAGGTTCTGGTGGG - Intronic
1070422854 10:76254520-76254542 AGGCACGGTCACTTTCTCCTAGG + Intronic
1072032769 10:91537224-91537246 AGGCCCTGTGAGGTTCAGGTGGG - Intergenic
1072201781 10:93166573-93166595 AGGCACGCTTGGGTCCTGGTGGG - Intergenic
1073923162 10:108481952-108481974 CAGCAGGGTCAGGTTCTGGGAGG + Intergenic
1075575248 10:123572940-123572962 AGGCACAGTCAGGGCCTGCTTGG - Intergenic
1077488002 11:2847954-2847976 GGGCACGGTCAGCTGCTCGTAGG - Exonic
1083228588 11:61300499-61300521 AGGCAGGGTCAGGATCCCGTAGG - Intronic
1084433800 11:69126406-69126428 AGGCACCGTCTGGTGCTGCTAGG - Intergenic
1085738945 11:79063178-79063200 ACGCACGGTCAGGGTCAGGTGGG - Intronic
1103706804 12:122879323-122879345 ACTCACCCTCAGGTTCTGGTTGG + Intronic
1103739973 12:123084443-123084465 ATGCACGGTGTGGTTCTGGTCGG - Intronic
1116826431 14:49677516-49677538 CGGCAGGGTCAGGGCCTGGTGGG - Intronic
1121177847 14:91904624-91904646 CAGCACAGTCAGGTTCTGGTGGG + Intronic
1129060674 15:72858110-72858132 CGGCATGGTCAGGTTCTGTGAGG - Intergenic
1131261147 15:90888560-90888582 AGGCGCGGTCAGGTCCTGGAAGG + Intronic
1131346463 15:91653872-91653894 ATGCACGGTCAGGTCGTGGCGGG - Intergenic
1132575831 16:663589-663611 AGGTCTGTTCAGGTTCTGGTTGG + Intronic
1133261547 16:4554115-4554137 AGGTATGGTCAGGCTCTGCTTGG - Intergenic
1134473447 16:14549067-14549089 GGGCATAGTCAGGTTCTGGTGGG + Intronic
1137293354 16:47067310-47067332 AGCCACGGTCAGGTGCAGGCTGG + Intergenic
1137677846 16:50312683-50312705 AGGGAGGGTCAGGCTCAGGTTGG - Intronic
1139628835 16:68214526-68214548 ATGCACGGGCATTTTCTGGTAGG + Intronic
1141717076 16:85733000-85733022 AGGCACTGTCAGGATCTGCAGGG + Intronic
1141944591 16:87300671-87300693 AGGAAGGGTCTGGGTCTGGTGGG - Intronic
1141964464 16:87432542-87432564 GGGCACCCTCAGGTTCTGATGGG + Intronic
1143253921 17:5541946-5541968 CAGCTCGGTCAGGGTCTGGTTGG + Exonic
1144684115 17:17215029-17215051 ATCCACAGACAGGTTCTGGTTGG + Exonic
1147348487 17:39821656-39821678 AACCACGCTCAGATTCTGGTGGG + Intronic
1148093311 17:45035547-45035569 GGGCAAGGTCAGGTGCTGTTAGG + Intronic
1152351627 17:79786812-79786834 TGGCACGGTGAGGTACTGGGGGG - Exonic
1157134896 18:45044636-45044658 AGGCAGGGTCAGATTCTGGAAGG - Intronic
1160749467 19:727183-727205 AGGCAGGGTCAGGGTCAGGTTGG - Intronic
1160821781 19:1062353-1062375 AGGCACGGCCTGGGTCGGGTGGG - Intronic
1161061103 19:2215377-2215399 AGGCAGAGGCAGGTGCTGGTGGG + Intronic
1161061399 19:2216984-2217006 AGGCACGCTGGGGCTCTGGTAGG - Exonic
1168585391 19:57587574-57587596 CAGCATGGTCAGGTTCTGGTAGG - Intronic
928125731 2:28614501-28614523 AGGCACGTTCATGTTCCTGTGGG + Intronic
932728437 2:74199346-74199368 CGGCACTGACAGGCTCTGGTGGG - Intronic
936527912 2:113254671-113254693 AGTCAGGGTCAGGTAGTGGTAGG - Intronic
939016032 2:136904464-136904486 AGACAGGGGCATGTTCTGGTAGG + Intronic
940767875 2:157809537-157809559 AGGCAGGGAGAGGTTCTGGATGG + Intronic
946433691 2:219638695-219638717 AGGCACTGTCAGCTTCTGCATGG - Exonic
948722260 2:239908484-239908506 CGGCACTGTCAGGCTGTGGTGGG - Intronic
1172477939 20:35252845-35252867 AGGCATGGGCAGGCTCAGGTGGG + Intronic
1172477953 20:35252883-35252905 AGGCATGGGCAGGCTCAGGTGGG + Intronic
1172477982 20:35252959-35252981 AGGCATGGGCAGGCTCAGGTGGG + Intronic
1172477996 20:35252997-35253019 AGGCATGGGCAGGCTCAGGTGGG + Intronic
1172478010 20:35253035-35253057 AGGCATGGGCAGGCTCAGGTGGG + Intronic
1172478024 20:35253073-35253095 AGGCATGGGCAGGCTCAGGTGGG + Intronic
1172478039 20:35253111-35253133 AGGCATGGGCAGGCTCGGGTGGG + Intronic
1173957560 20:47046089-47046111 CAGCATGGTCAGGTTCAGGTGGG + Intronic
1174128685 20:48326839-48326861 ATGCACGCTGAGGTTCTGGATGG - Intergenic
1175269102 20:57721269-57721291 GGGCAAGGACAGGTTCTGGCTGG + Intergenic
1175793851 20:61758864-61758886 TAGCACAGTCAGGTTCTGCTTGG + Intronic
1178319543 21:31594901-31594923 CAGCATGGTCAGGTTCTGGTGGG - Intergenic
1179262218 21:39767779-39767801 AGGCAAGCTCAGGTTCCAGTCGG + Intronic
1179358430 21:40683065-40683087 CAGCATGGTCAGGTTCTGATGGG - Intronic
1179557173 21:42187131-42187153 TGGCAGGGTCAGGGTCTGGTGGG + Intergenic
1179594522 21:42433462-42433484 GGGCAAGGTCAGGTCCTGATGGG - Intronic
1180009780 21:45041635-45041657 AGGCACGGTCAGGTCTCGGCAGG - Intergenic
1181622993 22:24103556-24103578 AGGGGAGGTCAGTTTCTGGTTGG + Intronic
1182450642 22:30418588-30418610 AGGCAGGTAAAGGTTCTGGTTGG - Intronic
1182872116 22:33657100-33657122 AGGCAGGGCCAGGGTCTGGATGG + Intronic
1183343067 22:37292766-37292788 AGGCTGGGTCAGGAGCTGGTGGG - Intronic
1184461301 22:44639694-44639716 AGTCACTGTCAGGCTCTGGAGGG + Intergenic
949868924 3:8570461-8570483 AGGCAGGGGCAGGTGCTGGGTGG - Intergenic
951507903 3:23469117-23469139 TGGCATGGTTGGGTTCTGGTGGG + Intronic
953287908 3:41630714-41630736 GGGCAAGTTCAGGCTCTGGTAGG - Intronic
956956354 3:74345284-74345306 AGTCAAGCGCAGGTTCTGGTGGG + Intronic
957217694 3:77342965-77342987 AGGCACGGTCAGGTTCTGGTAGG + Intronic
958657548 3:97021587-97021609 TGGCAAGGTTAGTTTCTGGTGGG + Intronic
968516968 4:1019494-1019516 AGGCAGCGACAGGTGCTGGTGGG + Intronic
968577712 4:1375731-1375753 AGGCACGGGCAGTGTCTGGAAGG - Intronic
969662861 4:8540559-8540581 AGGCACAGAGAGGTTCCGGTGGG + Intergenic
978107646 4:104923658-104923680 AGGCACCTTCAGGTTATGTTAGG - Intergenic
980083173 4:128365543-128365565 AGTCACTCACAGGTTCTGGTTGG + Intergenic
981069034 4:140515649-140515671 AGGCAGTGTCAGATTCTGGAAGG - Intergenic
986792526 5:11176759-11176781 GAGCACAGTCAGGTTATGGTTGG - Intronic
991578711 5:68132070-68132092 AAGCAAGGTCATGCTCTGGTAGG + Intergenic
994202392 5:96992573-96992595 AGGCACGGTGAGGTCCTGAAAGG + Intronic
994773343 5:104011837-104011859 AGGACCTGTCAAGTTCTGGTTGG + Intergenic
996039923 5:118798102-118798124 AGTCAGGGTCAGGTCTTGGTAGG - Intergenic
998932729 5:147199301-147199323 CAGCATGGTCAGGTTCTTGTAGG + Intergenic
1000166442 5:158653695-158653717 TAGCATAGTCAGGTTCTGGTGGG + Intergenic
1002202764 5:177539714-177539736 AGGGAAGGTAAGGCTCTGGTTGG + Intronic
1004309884 6:14535747-14535769 CAACATGGTCAGGTTCTGGTGGG + Intergenic
1006889926 6:37418076-37418098 CAGCATGGTCAGGTTCTGGTGGG + Intergenic
1008664339 6:53701269-53701291 ATGTACAGTCAGGTCCTGGTAGG - Intergenic
1009874897 6:69493708-69493730 AGGCAGACACAGGTTCTGGTAGG - Intergenic
1014553537 6:122817473-122817495 CAGCAGGGTCAGTTTCTGGTGGG + Intergenic
1018176123 6:161180829-161180851 AGGCACAGAGAGGGTCTGGTGGG - Intronic
1022419727 7:30209243-30209265 AGGCAGGGTGAGGATCTGGATGG + Intergenic
1033221942 7:139532787-139532809 CAGCATGGTCAGGTTCTGGTAGG - Intronic
1033712501 7:143962730-143962752 AGACACGGTCAGATCCTGGAAGG + Intergenic
1035221207 7:157407517-157407539 TAGCACCGGCAGGTTCTGGTTGG + Intronic
1036937158 8:13014374-13014396 CAGCAGGGTAAGGTTCTGGTAGG + Intronic
1041023432 8:53660394-53660416 AGGCAGTGCCAGGGTCTGGTGGG - Intergenic
1042653132 8:71065417-71065439 AAGCACGGTCCAGATCTGGTAGG - Intergenic
1047962549 8:130021446-130021468 CGGCATGGTCAGATTCTGGTGGG + Intergenic
1057857391 9:98611971-98611993 AGGCCTGCTCAGTTTCTGGTTGG + Intronic
1059368716 9:113807740-113807762 AGGCAGGATCAGACTCTGGTTGG + Intergenic
1061009287 9:127945716-127945738 AGGGCTGGACAGGTTCTGGTCGG + Exonic
1190241003 X:48658192-48658214 CAGCATGGTCAGGTTCTGGTAGG + Intergenic
1190480842 X:50875203-50875225 AGGCACCTTCAGGATCTGCTAGG + Intergenic
1194807028 X:98342688-98342710 AGGTAAGGTGAGGTTCTTGTAGG + Intergenic
1195347673 X:103966758-103966780 CAGCAGGGTCAGATTCTGGTGGG - Intergenic
1195359769 X:104072083-104072105 CAGCAGGGTCAGATTCTGGTGGG + Intergenic
1195387607 X:104328029-104328051 CAACATGGTCAGGTTCTGGTGGG + Intergenic
1196732381 X:118953896-118953918 AGGGATTGTCAGGTTCTGGAAGG - Intergenic