ID: 957220859

View in Genome Browser
Species Human (GRCh38)
Location 3:77380721-77380743
Sequence CTGTGATGATGGAAGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 556
Summary {0: 1, 1: 0, 2: 4, 3: 46, 4: 505}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957220859_957220864 7 Left 957220859 3:77380721-77380743 CCTCCTTCCTTCCATCATCACAG 0: 1
1: 0
2: 4
3: 46
4: 505
Right 957220864 3:77380751-77380773 TGTTACAGAGATTATCTCAATGG 0: 1
1: 0
2: 2
3: 29
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957220859 Original CRISPR CTGTGATGATGGAAGGAAGG AGG (reversed) Intronic
900204830 1:1427400-1427422 GCGGGATGATGGAGGGAAGGGGG - Intronic
900320759 1:2082534-2082556 CTGTGAGGAAGGAACGATGGTGG + Intronic
900726932 1:4222669-4222691 CTGTGACGATGGAGTGCAGGAGG + Intergenic
900816641 1:4852271-4852293 AAGTCAGGATGGAAGGAAGGAGG + Intergenic
900895521 1:5480368-5480390 CTGGGGTGAAGGAAGGCAGGGGG + Intergenic
900914840 1:5629558-5629580 CTGTGATGATGGAGTGGAGCTGG + Intergenic
900993365 1:6107920-6107942 ATGGAAGGATGGAAGGAAGGTGG + Intronic
901001799 1:6152583-6152605 GTGAGATGATGGCAGGAAGCAGG - Intronic
902045926 1:13524306-13524328 CTGTGAGGATGGGTGGAATGAGG - Intergenic
902657482 1:17879294-17879316 CTGAGATGATGGAGAGAATGGGG - Intergenic
903048035 1:20579076-20579098 AAGTCATGATGGAAAGAAGGAGG + Intergenic
903550755 1:24156208-24156230 CAGTGAGGGTAGAAGGAAGGAGG + Exonic
904012964 1:27400433-27400455 CTGTGATGACGCAAGGAGAGAGG - Intergenic
904170049 1:28585365-28585387 GCGTGATGAGGGCAGGAAGGAGG - Intergenic
905573042 1:39021223-39021245 CAGAGAGAATGGAAGGAAGGAGG - Intergenic
906043567 1:42809085-42809107 CAGTGGTGATGGAAAGAAGATGG + Intronic
906065599 1:42978255-42978277 TTGGGAAGAAGGAAGGAAGGAGG - Intergenic
907115882 1:51968063-51968085 CTTTGAAGATGGATGGAAGAAGG + Intronic
907317340 1:53580752-53580774 GTGTGAGGAAGGAAGGAAAGCGG - Intronic
907336082 1:53700448-53700470 CTGTCAGGAAGGAAGGATGGAGG + Intronic
909275423 1:73679084-73679106 CTAAGATGATGGAAAGTAGGAGG + Intergenic
909368830 1:74860658-74860680 ATGTGATTATGTAGGGAAGGGGG + Intergenic
909431040 1:75588205-75588227 AAGGGATGAAGGAAGGAAGGAGG + Intronic
909487093 1:76186432-76186454 CTATGAGAATGGAATGAAGGAGG - Intronic
909725834 1:78833811-78833833 CTTTGAGGAGGGAAAGAAGGCGG - Intergenic
910121932 1:83799628-83799650 GTGTGATGGGAGAAGGAAGGGGG + Intergenic
910273000 1:85417398-85417420 CTGGCATGATGGAAGGGATGAGG - Intronic
911811188 1:102284272-102284294 CAGTCATGATGGAAGGAAAGGGG + Intergenic
912703908 1:111897954-111897976 CCGTGTTTATGGAAGGAAGGTGG - Intronic
913301009 1:117368244-117368266 CTGTGATGTGGGAAGGAAGGCGG - Exonic
913567265 1:120084998-120085020 CAGTGTTGATGGAAGATAGGAGG + Intergenic
913630867 1:120708548-120708570 CAGTGTTGATGGAAGATAGGAGG - Intergenic
914288016 1:146245704-146245726 CAGTGTTGATGGAAGATAGGAGG + Intergenic
914549051 1:148696450-148696472 CAGTGTTGATGGAAGATAGGAGG + Intergenic
914617631 1:149375269-149375291 CAGTGTTGATGGAAGATAGGAGG - Intergenic
915564820 1:156707451-156707473 CAGAGATGGTGGAAGGAAGCGGG + Intergenic
916429511 1:164713552-164713574 AGGAGAGGATGGAAGGAAGGGGG - Intronic
916561140 1:165934918-165934940 CTGGGGTGCTGGAAGAAAGGAGG + Intergenic
917278699 1:173358138-173358160 ACGTGATGATGGAAGGAAGTTGG + Intergenic
917587807 1:176445721-176445743 CTGTCATCATGGAAAGAGGGTGG - Intergenic
918481813 1:184986184-184986206 CTGTGGTTAGGGAAGAAAGGAGG + Intergenic
919660621 1:200241332-200241354 ATGTGATTATGCAAGGAAGGAGG + Intergenic
921018849 1:211217691-211217713 ATGATATGATGGAAGGAAGTGGG + Intergenic
921095788 1:211886274-211886296 CTGTGCTGTGGGGAGGAAGGTGG - Intergenic
921129771 1:212209672-212209694 CTGTGATGATGTAAGAAATAAGG + Intergenic
921315236 1:213884265-213884287 CTTTGCAGATTGAAGGAAGGGGG - Intergenic
921328357 1:214010523-214010545 CTGTGATGACAAAAGGCAGGGGG + Intronic
921466236 1:215491739-215491761 CAATCATAATGGAAGGAAGGAGG - Intergenic
923762391 1:236858662-236858684 CTGTGAAAATGGAAGCAGGGTGG + Intronic
1064307538 10:14181456-14181478 CTGTGACGACGGGAAGAAGGAGG - Intronic
1064340518 10:14481429-14481451 TTGTGAGGAAGGAAGGAAGGAGG - Intergenic
1065281809 10:24146747-24146769 CTGTGCTGATGGAAGGAGACAGG + Intronic
1066200264 10:33137496-33137518 CTGGCTTGAGGGAAGGAAGGGGG - Intergenic
1067218505 10:44323709-44323731 CAGTGGTGGTGGAAGGAAAGAGG + Intergenic
1068288968 10:54976940-54976962 CTGTGAGGCTGGAAGAAAGGTGG + Intronic
1069800847 10:71080602-71080624 ATGTGATGATGGAAAGCAGATGG - Intergenic
1069824458 10:71246563-71246585 CTGGGTTGAGGGAAGGAAGAAGG + Intronic
1070256390 10:74816256-74816278 TTGTGATGAAGAAAGGATGGAGG - Intergenic
1071766655 10:88673899-88673921 CTGGGGTGATGGAAGGATGCTGG - Intronic
1073305777 10:102502445-102502467 ATGTGATAAGGGGAGGAAGGAGG + Intronic
1073904822 10:108265915-108265937 CAGTGATGATGAGAAGAAGGAGG - Intergenic
1074744128 10:116514642-116514664 CTGTGATGGGGGAGGGAAGTGGG + Intergenic
1075072009 10:119325954-119325976 CTCCGAGGCTGGAAGGAAGGAGG - Intronic
1075686173 10:124366861-124366883 CTGGGATGGTGGTGGGAAGGGGG - Intergenic
1075696111 10:124436725-124436747 ATGAGATGAAGGAAGGAGGGAGG - Intergenic
1075789892 10:125076505-125076527 CTGTGATGAAAGAAGGGAGGTGG - Intronic
1076586207 10:131549319-131549341 GTGTGAGGATGGAGGGAACGGGG + Intergenic
1077279541 11:1736230-1736252 CTGGGCTGAAAGAAGGAAGGTGG + Intronic
1078013413 11:7591899-7591921 GTGGGATGAGGGGAGGAAGGAGG + Intronic
1078151088 11:8760194-8760216 CTGAGAAGATAGAAGGAAAGGGG - Intronic
1079750011 11:24185359-24185381 GAGGGATGAAGGAAGGAAGGAGG + Intergenic
1080405512 11:31975320-31975342 CTGTGAAGATGGGAGTCAGGTGG + Intronic
1081237122 11:40659274-40659296 CCCTGATGAGGGCAGGAAGGAGG + Intronic
1081657628 11:44867975-44867997 CTGAGAAGATGGCAGGGAGGTGG + Intronic
1081963372 11:47154524-47154546 CTGTGAACATGGATGCAAGGAGG + Intronic
1083553326 11:63607087-63607109 CTGTGCTGATGGAATGAGGTGGG + Intronic
1083713106 11:64560650-64560672 CTGTGATGAGGGAAGCAAGGAGG - Intronic
1084404684 11:68964415-68964437 TTGTGATGCTGGCGGGAAGGTGG + Intergenic
1084515133 11:69633911-69633933 CTGTGAAGATGCAGGGCAGGTGG + Intergenic
1084545694 11:69813968-69813990 GTGAAAGGATGGAAGGAAGGAGG + Intronic
1085113337 11:73908023-73908045 TTGGAATGATGGAAAGAAGGTGG - Intronic
1087826562 11:102771137-102771159 CTGTAAGGAAGGAAGGAGGGAGG + Intronic
1088675502 11:112188613-112188635 CAGAGATGATGGAAGGAGGAAGG - Intronic
1088725381 11:112629837-112629859 CTGTGATGAGGAAAGGGAGCAGG + Intergenic
1088882922 11:113985935-113985957 CTGTGATGATGGGACACAGGTGG - Intronic
1089182578 11:116593268-116593290 CCGTGAGGATGGTAGAAAGGAGG + Intergenic
1089387765 11:118079316-118079338 CTGTGGGGATGGAAGGAGGTAGG - Intronic
1089643629 11:119863990-119864012 CTGTGATGAGGGCAGGAGGAAGG - Intergenic
1090248571 11:125235577-125235599 CTGGGCTGATGGAAGGGAAGCGG - Intronic
1090512512 11:127390860-127390882 ATTTGATGATGGAAGAAAGGTGG + Intergenic
1090698950 11:129278380-129278402 ACTTGAAGATGGAAGGAAGGAGG - Intronic
1090800370 11:130167608-130167630 CTGTGATAGGGGAGGGAAGGGGG - Intronic
1091303527 11:134523105-134523127 GAGTGGGGATGGAAGGAAGGTGG + Intergenic
1091568387 12:1663644-1663666 ATTTGATGAAGGAAGGAAGGAGG + Intergenic
1092037766 12:5353799-5353821 CAGAGAGGAAGGAAGGAAGGAGG + Intergenic
1092073618 12:5654613-5654635 TTGTGATGATGGCAGGATTGGGG - Intronic
1093502581 12:19828942-19828964 CTGTGATGATGTAATGGATGAGG + Intergenic
1094599796 12:31898492-31898514 CTGGAAAGAAGGAAGGAAGGAGG + Intergenic
1094628133 12:32145508-32145530 CTTGGAAGAGGGAAGGAAGGAGG + Intronic
1094665646 12:32517999-32518021 CTATGATGATGGCAGAAAGTAGG - Intronic
1095174471 12:39074934-39074956 CAGTCATGAGGGAAGGAAGGGGG + Intergenic
1096213066 12:49781198-49781220 CTGAAAAGAAGGAAGGAAGGAGG - Intergenic
1097963967 12:65559375-65559397 CAGTGATGTTGGAAGTAAAGGGG + Intergenic
1098049117 12:66434716-66434738 CTTTGAAGGTAGAAGGAAGGTGG - Intronic
1098290441 12:68952598-68952620 CTGGGATGAGGGGAGGGAGGTGG - Intronic
1098493732 12:71111555-71111577 CTGTGATCATGGGAGGAACCTGG - Intronic
1099120782 12:78686810-78686832 CTAGCATGATGGAAGGGAGGAGG + Intergenic
1099809944 12:87568133-87568155 CTGTGAGGCTAGAAGCAAGGTGG + Intergenic
1100381966 12:94070756-94070778 ATGAGATCAAGGAAGGAAGGAGG + Intergenic
1100481483 12:94983805-94983827 CTGTGAAGAATAAAGGAAGGAGG - Intronic
1101725609 12:107385851-107385873 CGGTGAGGATGGCAGGAGGGTGG - Intronic
1101831095 12:108257250-108257272 CTGTGGTGGTGGAAGCGAGGAGG - Intergenic
1102524802 12:113504741-113504763 CCAGGATGAAGGAAGGAAGGTGG - Intergenic
1102756675 12:115347237-115347259 CTTGGAAGATGCAAGGAAGGAGG - Intergenic
1103254776 12:119531679-119531701 CAGTGAGTATGGAAGGAAGCAGG + Intronic
1103947109 12:124532776-124532798 CTTTGAAGTTGGAAGGAAAGCGG - Intronic
1104165527 12:126225556-126225578 CTTCCATGTTGGAAGGAAGGAGG + Intergenic
1104300614 12:127561832-127561854 GAGTGAAGATGGAAGGAAGTGGG + Intergenic
1104322858 12:127768304-127768326 GCTTGATGATGGAAGAAAGGGGG - Intergenic
1104353955 12:128068735-128068757 ATGTGATGGTGGTAGGAAGTGGG - Intergenic
1104463183 12:128971301-128971323 GGGAGATGAAGGAAGGAAGGAGG - Intronic
1104675259 12:130708109-130708131 CTGTGCTGAGGGAAAGAAGCCGG + Intronic
1106738915 13:32618035-32618057 CTCATATGGTGGAAGGAAGGCGG + Intronic
1107101058 13:36593022-36593044 CTGTGATCTTGGAAGAAAAGAGG - Intergenic
1108758480 13:53532774-53532796 CTTTGAAGATGGGGGGAAGGGGG + Intergenic
1108774907 13:53753900-53753922 CTGTCATGCTGGAGGGAAGAGGG + Intergenic
1109039511 13:57314725-57314747 CTGTCATGTTGAAAGGAAAGGGG - Intergenic
1109437557 13:62325913-62325935 ATATGATGGTGGAGGGAAGGAGG - Intergenic
1111028499 13:82566900-82566922 CTGTGAAGCTGGAAGTAAGATGG + Intergenic
1112386076 13:98940834-98940856 GAGGGATGATGGAGGGAAGGTGG - Intronic
1112386559 13:98945590-98945612 CTGTGATGGTGGCAGGATGTAGG - Intronic
1112994789 13:105560429-105560451 ATGTGATGATGTGAGGAAGTGGG - Intergenic
1113007701 13:105725922-105725944 CCGTGAAGAAGGAAGGAAGTCGG - Intergenic
1113009263 13:105744818-105744840 CAATGATGATGGAAGAAAAGTGG - Intergenic
1113311175 13:109134760-109134782 CTGAGGTGATGGAAGGAACGTGG - Intronic
1113444053 13:110352116-110352138 CGATGATGATGGCATGAAGGTGG + Intronic
1114315013 14:21501780-21501802 CTGTGACTATGGAACCAAGGAGG - Exonic
1116311532 14:43333245-43333267 TTTATATGATGGAAGGAAGGTGG + Intergenic
1116387649 14:44351195-44351217 GGATGATAATGGAAGGAAGGTGG - Intergenic
1117870373 14:60194464-60194486 CTCTGAGGAGGGAAGGAAAGAGG + Intergenic
1119206615 14:72799175-72799197 ATGGGTTGATGGAAGGATGGAGG - Intronic
1119265405 14:73261064-73261086 CGGGGAGGATGGCAGGAAGGAGG - Intronic
1119371640 14:74150525-74150547 CTATGATGATGGCTGGGAGGGGG + Intronic
1120372339 14:83652002-83652024 ATGTGATAATGGATGTAAGGTGG + Intergenic
1120523492 14:85551315-85551337 CTGATATGATGTAAGGAATGGGG + Intronic
1120830103 14:88990290-88990312 CTGTGATGAGGAAAGGCAAGAGG - Intergenic
1120962595 14:90139226-90139248 CTGTGATGATTGAATGCAGCTGG + Intronic
1121234138 14:92380001-92380023 CTGTGCTGGTGGGAGGGAGGGGG - Intronic
1121843866 14:97156274-97156296 CTGAGAGGAAGAAAGGAAGGAGG - Intergenic
1121941798 14:98077823-98077845 GTGTGATGATTTTAGGAAGGGGG - Intergenic
1122092876 14:99351753-99351775 GTGTGAAGAGGGAAGGGAGGTGG - Intergenic
1122612250 14:102993524-102993546 ATGAGAGGATGGAAGGATGGAGG + Intronic
1123038360 14:105480410-105480432 CTGTGGGGAGGTAAGGAAGGTGG + Intergenic
1125277472 15:38008380-38008402 CAGGGATGATAGAGGGAAGGGGG + Intergenic
1126860020 15:52874267-52874289 TTGGGATAATGGAAGGATGGGGG + Intergenic
1126957010 15:53944403-53944425 CCTTGAGGATGGAAGGCAGGAGG - Intergenic
1127233316 15:57020023-57020045 CTGTGAGGCTAGAAGCAAGGTGG + Intronic
1129291175 15:74569021-74569043 CTGTAATGGTGGAAGAAAGCAGG - Intronic
1130145957 15:81273791-81273813 GTGGGTTGATGGAAGAAAGGTGG - Intronic
1130539494 15:84811941-84811963 CTGTGGGGAAGGAGGGAAGGAGG + Intergenic
1130850109 15:87784582-87784604 CTGTGCCCATGGAAGGAAAGTGG - Intergenic
1131311069 15:91290274-91290296 ATGTGAAGAGGTAAGGAAGGTGG + Intronic
1131434499 15:92412265-92412287 ATGAGAGGAGGGAAGGAAGGGGG + Intronic
1132005441 15:98222374-98222396 CTGTGCTGAATGAAGCAAGGAGG - Intergenic
1132871355 16:2117093-2117115 CTGTGAGGGTGGGAGGATGGAGG - Intronic
1133301286 16:4784216-4784238 CTCTGATGATGCAGGGAAGTGGG - Intronic
1134206120 16:12239152-12239174 CTGTGATGAAGGAAGAAGGAGGG + Intronic
1134475243 16:14568001-14568023 CTGTGTTGATAGAAGCAAAGTGG - Intronic
1134521172 16:14919801-14919823 CTGTGAGGGTGGGAGGATGGAGG + Intronic
1134550399 16:15136171-15136193 CTGTGAGGGTGGGAGGATGGAGG - Intronic
1134708848 16:16318452-16318474 CTGTGAGGGTGGGAGGATGGAGG + Intergenic
1134716059 16:16358486-16358508 CTGTGAGGGTGGGAGGATGGAGG + Intergenic
1134950757 16:18350193-18350215 CTGTGAGGGTGGGAGGATGGAGG - Intergenic
1134958697 16:18393673-18393695 CTGTGAGGGTGGGAGGATGGAGG - Intergenic
1135205998 16:20484480-20484502 CTGTGCTGAGGAAAGGCAGGTGG - Intronic
1135212914 16:20539304-20539326 CTGTGCTGAGGAAAGGCAGGTGG + Intronic
1136173457 16:28502285-28502307 CAGTGGAGATGGAAGGAATGGGG - Intronic
1136568560 16:31083810-31083832 CTGTGGGGAAGGAAGGAGGGTGG + Exonic
1137560021 16:49496492-49496514 CAATGATGATGGAAGGCAAGGGG - Intronic
1137708573 16:50551112-50551134 CTGGGAGGATGGGAGGGAGGAGG + Intronic
1137784288 16:51125166-51125188 ATTTGATGAGGGAAGGAAGCAGG + Intergenic
1138059318 16:53873130-53873152 CTTTGATTATGGAGGGAAAGAGG + Intronic
1138494797 16:57401668-57401690 CTGTGATTAGGGGAGGAAAGCGG + Intergenic
1138988195 16:62357460-62357482 CTTTGATGAAGGCAGGCAGGGGG + Intergenic
1139299860 16:65935722-65935744 CTGGGATGATAATAGGAAGGTGG - Intergenic
1139823725 16:69740719-69740741 CAGTGGAGATGGTAGGAAGGAGG - Intergenic
1139829463 16:69785261-69785283 TAGAGATGATGGAAGGAGGGAGG + Intronic
1140415572 16:74771778-74771800 CTGTGACCATGGGGGGAAGGGGG - Intronic
1141321005 16:83008753-83008775 CTGTGAAGATGAAAGGAAGGAGG - Intronic
1141531726 16:84650863-84650885 CTTTAATGATGGAGGGAAGCAGG + Exonic
1141732788 16:85833997-85834019 CTGTGTCAAAGGAAGGAAGGAGG + Intergenic
1141747759 16:85937459-85937481 CTGTGAACAAGGAAGAAAGGAGG + Intergenic
1142158186 16:88542507-88542529 GTTTGATTGTGGAAGGAAGGAGG - Intergenic
1142676117 17:1514411-1514433 CTGTGCTGGTGGAGGGAATGGGG + Intronic
1144157267 17:12517983-12518005 TTGTGATGATGGGTGGAACGTGG + Intergenic
1144256723 17:13475740-13475762 CTGTGAGGCTGGAAGCAAGATGG - Intergenic
1144513212 17:15895448-15895470 AGGTGATGATGGCAGGCAGGCGG + Intergenic
1144579543 17:16450666-16450688 CTGTGTGGAGGGAAGCAAGGCGG + Intronic
1145764100 17:27446154-27446176 ATGGGAGGAAGGAAGGAAGGAGG + Intergenic
1146534481 17:33638379-33638401 CTGTGAGGATAGAAGCAAGATGG + Intronic
1146596416 17:34173000-34173022 CTGTGAGGCTAGAAGGAAGATGG + Intronic
1146749772 17:35368148-35368170 GTGGGAGGATGGAAGGAAAGGGG - Intronic
1146931506 17:36781269-36781291 CTGGGAAGAGGGAAGGCAGGAGG + Intergenic
1147343833 17:39773286-39773308 CTTTTACCATGGAAGGAAGGAGG - Intronic
1147444138 17:40464488-40464510 TTGGGAGGAAGGAAGGAAGGGGG + Intergenic
1148712090 17:49689365-49689387 CAGTGGAGATGGAAGGAAGTAGG - Intergenic
1148712441 17:49691642-49691664 CTTGGATGATGGAAGGAAGGAGG + Intergenic
1149632460 17:58137770-58137792 CTCTCATGATGGAAGGCAGAAGG - Intergenic
1150220610 17:63493838-63493860 CTGTGATGGTGGAGGGGTGGGGG - Intronic
1150505858 17:65698527-65698549 CTTTGATGATCTAAGGAAGCCGG + Intronic
1151069338 17:71190421-71190443 CTCTGATTATTGAAGGAGGGAGG + Intergenic
1153282207 18:3425229-3425251 CTGTGAGGATAGAAGCAAGATGG - Intronic
1155650601 18:28136303-28136325 GTTTAATGAAGGAAGGAAGGAGG + Intronic
1156971884 18:43166781-43166803 ATGTAAAGATGGAAGGAAAGAGG + Intergenic
1156991479 18:43413977-43413999 ATGTGATGATGGGAGGAAGCAGG - Intergenic
1157871692 18:51235366-51235388 CTGTGAAAATGGAGGGAAGATGG - Intergenic
1157912173 18:51626560-51626582 TTGTGAGGATAGAAGGATGGAGG - Intergenic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1158442619 18:57490456-57490478 CTATAATGAGGGAAGAAAGGAGG + Exonic
1158857220 18:61554687-61554709 CTGTGGTGACGGAAGCCAGGAGG + Exonic
1159869028 18:73739907-73739929 CTCTGCTCATGGAAGGATGGAGG - Intergenic
1160468871 18:79108187-79108209 CAGGGATGCTGGAGGGAAGGAGG + Intronic
1160802212 19:975278-975300 CTGAGATGTTGGGAGAAAGGCGG + Exonic
1161398840 19:4058875-4058897 CTGGAAGGAGGGAAGGAAGGCGG - Intronic
1161934511 19:7363381-7363403 ATGGACTGATGGAAGGAAGGAGG + Intronic
1161934597 19:7363896-7363918 ATGGGTTGATGGAAGGAAGGAGG + Intronic
1161934655 19:7364241-7364263 ATGGGTTGATGGAAGGAAGGAGG + Intronic
1162084507 19:8240471-8240493 GTGACATGCTGGAAGGAAGGGGG - Intronic
1163876013 19:19868486-19868508 ATCTGATGATGGTAGGAGGGTGG + Intronic
1164286525 19:23822189-23822211 CTGCAATGATTGAGGGAAGGTGG - Intronic
1164518777 19:28960752-28960774 CTGTGAGGCTGGAAGCAAGATGG - Intergenic
1165280063 19:34788633-34788655 CTGTGATGAGAGAAGAAATGTGG + Intergenic
1165731858 19:38151050-38151072 CTCTGATGGTGGAAGAGAGGAGG - Intronic
1165833743 19:38742550-38742572 AGGTGAGGATGGAAGGAGGGAGG + Intronic
1166140378 19:40802200-40802222 CTGGGCTGAGGGAAGGAAAGGGG + Intronic
1166458408 19:42964438-42964460 CTTTCATGAGGGAAGGAAGGAGG - Intronic
1166475355 19:43119695-43119717 CTTTCATGAGGGAAGGAAGGAGG - Intronic
1166756510 19:45195598-45195620 CTCTGAGGAAGGAAGGAAGGAGG - Intronic
1167158807 19:47754932-47754954 GTGGGAGGAAGGAAGGAAGGGGG - Intronic
1167410820 19:49342703-49342725 GTGGGGTGATGAAAGGAAGGTGG - Intronic
1167902647 19:52633515-52633537 CAGTGAGGCTGGAAGGAGGGTGG + Intronic
1167918144 19:52759227-52759249 CAGTGAGGTTGGAAGGAGGGTGG + Intergenic
1167925231 19:52816082-52816104 CAGTGAGGCTGGAAGGAGGGTGG + Intronic
1167929565 19:52853248-52853270 CAGTGAGGCTGGAAGGAGGGTGG + Intronic
1167992647 19:53373531-53373553 CAGTGAGGCTGGAAGGAGGGTGG - Intronic
1168001318 19:53448439-53448461 CAGTGAGGCTGGAAGGAGGGTGG - Intronic
1168005704 19:53485002-53485024 CAGTGAGGCTGGAAGGAGGGTGG - Intronic
1168182776 19:54673679-54673701 TTGTGATGAAGGAAGAAGGGAGG - Intronic
1168556727 19:57349254-57349276 CTGTGATGATAGAAGAAATGAGG - Intergenic
925222879 2:2156670-2156692 CAGAGGTGAAGGAAGGAAGGAGG + Intronic
925410544 2:3637425-3637447 CTGTGATGTAGGAAGGAGGGCGG + Intronic
925429349 2:3777903-3777925 CTGTCATCAGGGAAGGCAGGTGG - Intronic
925942712 2:8836256-8836278 CTGGGGTGGTGGAAGGGAGGAGG - Intronic
926777848 2:16439837-16439859 GTGTGGTGATGGAATGATGGGGG + Intergenic
928389627 2:30899198-30899220 CTGGGATGAAGGAAGGAAAATGG - Intergenic
928622768 2:33107914-33107936 CTGAGAGGAGGGAAGGGAGGAGG + Intronic
928695016 2:33840672-33840694 CTGTCATGTTGAAAGGAAAGAGG + Intergenic
928695219 2:33842133-33842155 CTGTGATGATGCAAAGTAGGAGG - Intergenic
929483207 2:42332362-42332384 CTGTGATAATGGTTGGAAGTGGG + Exonic
929565984 2:42985178-42985200 CTGTCCTGATGGCTGGAAGGTGG + Intergenic
929677187 2:43948200-43948222 CTGTGAGAAGGGAAGGGAGGGGG + Intronic
930086377 2:47500430-47500452 CTGAGTCGATGGAAGGAAGGAGG + Intronic
930806073 2:55492058-55492080 CTGTGAGGAAGTAAGGAAGGTGG + Intergenic
932044829 2:68337961-68337983 ATGTGATGATGGAAGCAGAGAGG - Intergenic
932090706 2:68803810-68803832 ATTTGATAATGGAAGGAAAGAGG + Intronic
933676613 2:85063204-85063226 CAGTGAAGATGGTGGGAAGGGGG - Intergenic
933717939 2:85375857-85375879 CTTTGAAGATGGAAGAATGGAGG - Intronic
933810192 2:86028251-86028273 CTGTGCTGCTGGAAGGAAGCGGG - Intronic
934600725 2:95655950-95655972 CTGTGAGAAAGGAAGGAATGGGG - Intergenic
934880308 2:97971351-97971373 CTGTGATAAGTGGAGGAAGGGGG + Intronic
935965053 2:108464732-108464754 ATGGAAGGATGGAAGGAAGGAGG + Intronic
936053009 2:109239806-109239828 CTGTGGGGATGAAAGGCAGGTGG - Intronic
936267855 2:111023867-111023889 CTGCGATGGTGGAAGGTGGGTGG + Intronic
937515974 2:122655893-122655915 CTGTGAGGTTAGAAGCAAGGTGG - Intergenic
937683419 2:124668842-124668864 CTGGAATGAGGGAAGGAATGAGG + Intronic
937821599 2:126316681-126316703 TTGTGGGGAAGGAAGGAAGGAGG - Intergenic
938273681 2:129997307-129997329 ATGTGAGAAAGGAAGGAAGGGGG + Intergenic
938541311 2:132286244-132286266 GTGTGAGGATGGAATGCAGGAGG + Intergenic
938566583 2:132524202-132524224 CTGTGAAGAGGGAACGAAGAGGG + Intronic
938755117 2:134372320-134372342 CTGTTATCATGGAAACAAGGGGG - Intronic
938936094 2:136128818-136128840 ATAGGAGGATGGAAGGAAGGGGG - Intergenic
941026518 2:160461989-160462011 CTATGATAATGGAAGGCAAGTGG + Intronic
941099725 2:161282397-161282419 GTGTGAGGATGGAATGCAGGAGG - Intergenic
942249388 2:174034517-174034539 CTGGGATGCCGGAAGGAGGGTGG + Intergenic
942877388 2:180817490-180817512 TTGGGATGGTAGAAGGAAGGAGG + Intergenic
943206084 2:184897782-184897804 CTATAATGATGGAAGTATGGGGG - Intronic
943651417 2:190461734-190461756 ATGTGATGATAGTATGAAGGAGG - Intronic
944047648 2:195431373-195431395 CGGTCATGATGGAAGGCAAGGGG - Intergenic
944931666 2:204526487-204526509 CTGTGAGGTTGGAGGTAAGGTGG - Intergenic
945022024 2:205583302-205583324 CAATGATGATGGAAGGAATTAGG + Intronic
945821498 2:214671220-214671242 CTTTGATTACTGAAGGAAGGAGG - Intergenic
946016325 2:216606858-216606880 CTGTGAGGAAGGAAGGCAGGTGG - Intergenic
946034602 2:216731778-216731800 AGGAGATGATGGAAGGGAGGAGG - Intergenic
946086563 2:217179351-217179373 CTTTGAAGATGGAAGGAAGATGG + Intergenic
946320649 2:218952307-218952329 CTGTGATGGTGGAAGGTGGAGGG + Intergenic
947022730 2:225699375-225699397 CTGTGACAATGGAAGGAACAAGG + Intergenic
947126107 2:226869945-226869967 TTCTGTTGATGGGAGGAAGGGGG + Intronic
947529325 2:230898786-230898808 CTGGGATGATGTGGGGAAGGGGG + Intergenic
947903980 2:233746267-233746289 CTGTGGGGATTCAAGGAAGGTGG + Intronic
948032428 2:234829898-234829920 CAGAAATGAAGGAAGGAAGGAGG - Intergenic
948282759 2:236760454-236760476 ATGGGAAGAAGGAAGGAAGGAGG + Intergenic
948301168 2:236908613-236908635 CTGTGTGGCTGGAGGGAAGGCGG - Intergenic
1169681349 20:8217434-8217456 CCCTGAGGATGGAAGGAGGGAGG + Intronic
1170154643 20:13258281-13258303 CTGTGGGGTTGGAAGTAAGGTGG - Intronic
1170914142 20:20606149-20606171 CTGTGAAAATGGAAGGAAAAGGG - Intronic
1171542918 20:25978227-25978249 CTGGGATGAAGGAAGGCAGGGGG + Intergenic
1171856545 20:30349566-30349588 CTCAGATGACGGAAGGCAGGAGG + Intergenic
1171870218 20:30519266-30519288 GTGTGAGGATGGAATGCAGGAGG + Intergenic
1172780315 20:37432918-37432940 TTCTGATGATGGAAGGAGAGAGG - Intergenic
1173746875 20:45444427-45444449 CCATGAAGATGGAAGGAGGGAGG - Intergenic
1174975528 20:55328853-55328875 CTGAGAAGATGGAGGGAGGGAGG - Intergenic
1175167121 20:57052319-57052341 CTGTGATGATGGAAGTGAAGAGG - Intergenic
1175539258 20:59738049-59738071 CAGTGATGGTGGTAGGGAGGGGG + Intronic
1175860875 20:62149358-62149380 CATGGATGATGGTAGGAAGGGGG + Intronic
1175962788 20:62645590-62645612 GTGTGATGCTGGTGGGAAGGAGG - Intronic
1176003138 20:62843143-62843165 CGGTGAGGAAGAAAGGAAGGGGG + Intronic
1179173798 21:38992611-38992633 CCCTGATGATGGAAGGAAAGAGG - Intergenic
1179244923 21:39624629-39624651 AGGTGCTGATGGAAGGATGGTGG + Intronic
1179442770 21:41407076-41407098 CTTTGCTGAGGGAAGGAGGGAGG + Intronic
1179524092 21:41964425-41964447 CTGAGATGAAGGAGGGAAAGTGG + Intergenic
1180725019 22:17940400-17940422 GTCTGAAGAAGGAAGGAAGGAGG + Intronic
1181713187 22:24704571-24704593 CTTTGCTGATGGAATTAAGGTGG - Intergenic
1181877645 22:25952567-25952589 ATGCTATGATGGAAGGAGGGAGG - Intronic
1181881339 22:25982688-25982710 CTTTGAAGATGGAGGCAAGGGGG - Intronic
1182096435 22:27629172-27629194 ATGTGACGATGGAAGGAGGAGGG - Intergenic
1182676562 22:32043657-32043679 CTGTGAGCAGAGAAGGAAGGTGG + Intronic
1182904256 22:33921871-33921893 GTGTGAGAATGGATGGAAGGAGG + Intronic
1183560733 22:38570444-38570466 CTGGGATGACGGAGGGAGGGAGG + Intergenic
1183645577 22:39124222-39124244 CTGTGAAGCTGGAGGGGAGGGGG - Intronic
949753354 3:7379909-7379931 GGGTGATGATGAAGGGAAGGCGG - Intronic
950259431 3:11533232-11533254 CGGTGATGATGAAAGGGAGCTGG - Intronic
951655337 3:25001105-25001127 GTGTGAGGATGGAGGGAGGGAGG + Intergenic
952119486 3:30225088-30225110 CTGTGATGATGAAGGTAATGTGG + Intergenic
952409064 3:33031214-33031236 CTTTGATGAAGGAAGGAGGCAGG + Intronic
952726505 3:36591998-36592020 ATGTGATGATGTTAGGAAGTGGG - Intergenic
952739206 3:36719572-36719594 CAGGGATGAGAGAAGGAAGGAGG - Intronic
953060214 3:39421728-39421750 CTGTTAGTATGGAAGAAAGGAGG - Intergenic
953276123 3:41500448-41500470 CTGTGATGATTAAAGGGAGGAGG + Intronic
953718178 3:45333535-45333557 CTGTGCAGATGGAAGGAAGTGGG + Intergenic
954673924 3:52305302-52305324 ATTTGATGAAGGAAGGAGGGTGG - Intergenic
954790028 3:53125477-53125499 CACTGAGGAGGGAAGGAAGGTGG + Intronic
956118279 3:65940572-65940594 ATGTGATGGTGTAAGGAAGTGGG - Intronic
956410447 3:68973322-68973344 ATGTAATGCAGGAAGGAAGGAGG - Intergenic
956485070 3:69713751-69713773 TAGTGATGATGGAAGGGATGCGG - Intergenic
956714030 3:72062707-72062729 CAATCATGATGGAAGCAAGGAGG + Intergenic
957220859 3:77380721-77380743 CTGTGATGATGGAAGGAAGGAGG - Intronic
958440426 3:94149766-94149788 CTGTGATGATGATAATAAGGAGG - Intergenic
958775019 3:98471991-98472013 ATGTGATGAAGGAAGGATGTAGG - Intergenic
959007886 3:101041057-101041079 CTGCTCTGATGGAGGGAAGGAGG - Intergenic
960357251 3:116668804-116668826 CTGGGATGATGGAAAGTAGAAGG + Intronic
961456913 3:127028931-127028953 CTGTGATGGAGGAGGGAAAGAGG + Intronic
962739988 3:138356627-138356649 CAGAGATGATAGAAGGAGGGTGG + Intronic
963375058 3:144454214-144454236 ATGTGATCATGGTAGTAAGGTGG + Intergenic
963526911 3:146426314-146426336 CGATTTTGATGGAAGGAAGGAGG - Intronic
963717281 3:148818073-148818095 ATATGATGATGAAAAGAAGGAGG + Intronic
965187732 3:165487090-165487112 TTATGCTGATGGAAGAAAGGAGG + Intergenic
966861280 3:184232124-184232146 CTGTTATGGGGGATGGAAGGGGG + Intronic
967236005 3:187384260-187384282 GTGGGATGCTGGAAGGAAGAAGG - Intergenic
968043919 3:195612790-195612812 CTGTGCTGCTGGGAAGAAGGAGG - Intergenic
969094344 4:4720532-4720554 CTGTGCTGATAGAAGGGAGAGGG - Intergenic
969480832 4:7446057-7446079 CAGGGAGGAAGGAAGGAAGGGGG - Intronic
970381496 4:15512587-15512609 CTGGGAAGATGGATGGATGGTGG + Intronic
970672399 4:18411972-18411994 ATGAGAGGAGGGAAGGAAGGAGG - Intergenic
971490364 4:27205800-27205822 CAGTGAGGCTGAAAGGAAGGAGG + Intergenic
972388470 4:38590277-38590299 TTGAGAGGATGTAAGGAAGGAGG - Intergenic
972766889 4:42159466-42159488 CAGTGACGATGGAAGGAAGTGGG + Intergenic
973158323 4:46986201-46986223 TTGCGATGGTAGAAGGAAGGAGG - Intronic
974636885 4:64576435-64576457 CTGTGCTGATGGATGGATGCAGG + Intergenic
974761773 4:66285545-66285567 CAGTGCTGATGGAGGGCAGGAGG + Intergenic
975009800 4:69336071-69336093 CTGTGAGGAGGAAAGGAACGTGG + Intronic
975581630 4:75912004-75912026 CTGTGAGGCTAGAAGGAAGATGG + Intergenic
976940771 4:90699771-90699793 ATGTGATGATGGTAGGATGTGGG + Intronic
977600238 4:98928278-98928300 CTGTCATGGAGGAGGGAAGGGGG - Intronic
977639935 4:99345966-99345988 CTGTTATGGTGGAAGGAGGAGGG + Intronic
977645482 4:99407024-99407046 CTGCTCTGATGGAAAGAAGGAGG + Intergenic
977917806 4:102613402-102613424 CTGTGAGAAAGAAAGGAAGGAGG - Intronic
978225937 4:106335087-106335109 CTCTGTTGATGGGAGGAAGATGG + Intronic
978879792 4:113687842-113687864 CTGTGATGATTGAACCAAGAAGG - Intronic
981691644 4:147515359-147515381 CTGTGGTGGTGGGGGGAAGGGGG + Intronic
981750654 4:148090255-148090277 GTGTGACGAGGGAAGGGAGGAGG + Intronic
982235132 4:153244970-153244992 CTGTGATGAATGAAGAAAGCTGG - Intronic
982278815 4:153663386-153663408 TGGTGATGATGGAGGGAATGTGG + Intergenic
982852376 4:160335945-160335967 CTGTACTGATGGGAGGAAAGTGG + Intergenic
983711789 4:170726199-170726221 GTGAGGTGGTGGAAGGAAGGTGG + Intergenic
984613500 4:181868260-181868282 CTGGGGTGAGGGAAGGGAGGTGG - Intergenic
984688124 4:182694432-182694454 TCGTGATGATGAAAGAAAGGTGG + Intronic
985771308 5:1813409-1813431 CTGTGAGGTGGAAAGGAAGGAGG - Intronic
985815559 5:2125470-2125492 CTGTCCTGATGGAAGGTGGGTGG + Intergenic
985993693 5:3584582-3584604 ATGGGAGGAAGGAAGGAAGGAGG + Intergenic
985993850 5:3585191-3585213 ATGGGAGGATGGAAGGAGGGAGG + Intergenic
986240536 5:5955721-5955743 CCTGGATGATTGAAGGAAGGAGG - Intergenic
986283978 5:6346517-6346539 GTGAGAGGAGGGAAGGAAGGAGG + Intergenic
987287553 5:16472781-16472803 GTGTGAGGATGGGAGGAAGTTGG - Intergenic
988252626 5:28780087-28780109 CAGAGAAGAAGGAAGGAAGGAGG - Intergenic
988307967 5:29518314-29518336 CTGTAATGGTGGAATGAATGAGG - Intergenic
988602711 5:32654719-32654741 CTGTGCTGATGGCAGCCAGGAGG - Intergenic
988846639 5:35134319-35134341 CTGTGATAATCCAAGGAAAGAGG - Intronic
989212159 5:38866705-38866727 CTGTGCTGATGAGAGGGAGGGGG + Intronic
990374495 5:55155749-55155771 CCAGCATGATGGAAGGAAGGGGG - Intronic
990587162 5:57223620-57223642 GTGTGAGGAGGTAAGGAAGGTGG - Intronic
991472232 5:66981479-66981501 CTGCGGTGATGGAAGGATGGGGG + Intronic
991479710 5:67064252-67064274 CTGAGATGCAGGAGGGAAGGTGG + Intronic
991776126 5:70087641-70087663 CTGTGTTGGTGGAATGGAGGAGG + Intergenic
991855414 5:70963095-70963117 CTGTGTTGGTGGAATGGAGGAGG + Intergenic
991969574 5:72126116-72126138 CTGTGTTGAGGGAAGCAGGGAGG + Intronic
992172893 5:74121775-74121797 CTGTTATGATGGCATGAAGGTGG + Intergenic
992364123 5:76074357-76074379 CTGGTAAGATGCAAGGAAGGGGG - Intergenic
992467036 5:77016162-77016184 CTGGGGTGATGGTGGGAAGGTGG + Intergenic
992941001 5:81761379-81761401 CTGTGATGATAGAAAAGAGGAGG - Intergenic
994580928 5:101641027-101641049 CTGTGTTTATGGAAGGGAGAGGG - Intergenic
995580395 5:113594250-113594272 ATGTGACGAGGGAAGGAGGGAGG - Exonic
998820747 5:146055753-146055775 GTGTGCTGAGGGAAGGAAGGGGG - Intronic
998908746 5:146935260-146935282 CTCACATGATGGAAGGAATGAGG - Intronic
999622892 5:153490448-153490470 AGGTGAGGATGGGAGGAAGGGGG + Intronic
1000393670 5:160750588-160750610 CAGTGATGGTGGAGGGAAAGAGG - Intronic
1000631362 5:163594506-163594528 CTGTGATGATGGATGCCAGTTGG - Intergenic
1000704122 5:164489831-164489853 CTCTGATGATGGAACAGAGGTGG + Intergenic
1002190738 5:177476173-177476195 CTGTGAGGAGGGAGGGAGGGAGG - Intergenic
1003120826 6:3318009-3318031 CTCTGGTGATGCAAGGAAGATGG - Intronic
1003172036 6:3727458-3727480 CTGTTCTTATGGAAGGAAGTGGG - Intronic
1003775465 6:9356636-9356658 ATGTGCTGATGAAAGGAATGTGG - Intergenic
1004185166 6:13415341-13415363 CATTGATGTTGAAAGGAAGGGGG - Intronic
1005036296 6:21558136-21558158 ATGTGATGATGTTAGGAAGTGGG + Intergenic
1005103546 6:22199320-22199342 CTGTGATGTTAGAAGCAAGATGG + Intergenic
1005497282 6:26398806-26398828 CAGGGAAGATGGGAGGAAGGAGG - Intergenic
1006340376 6:33443409-33443431 TGGTGGTGATGGGAGGAAGGTGG - Exonic
1006639878 6:35484423-35484445 GTGTGATGAGGCAAGGAGGGTGG + Intronic
1007515813 6:42410633-42410655 ATGTGGTGATGGAGGGAGGGGGG - Intronic
1007551382 6:42732602-42732624 CTGTCATGTTGAAAGGAAAGGGG + Intergenic
1007553746 6:42748931-42748953 CTGTTTTGATGGAAGGAGAGTGG + Intronic
1007770245 6:44186321-44186343 TGGTGATAATGGAGGGAAGGCGG - Intergenic
1008102472 6:47406799-47406821 ATGTGCTGAGGGAAAGAAGGTGG + Intergenic
1008918612 6:56818283-56818305 CTGTTATCATGAAGGGAAGGAGG + Intronic
1008969586 6:57351494-57351516 CTGTGAGAATGGAAAGAAGTGGG + Intronic
1009158558 6:60253331-60253353 CTGTGAGAATGGAAAGAAGTGGG + Intergenic
1009694841 6:67088985-67089007 CTGCTGTGATGGAAGGAATGAGG + Intergenic
1010365008 6:75040726-75040748 CTGTGCTGATGCAGTGAAGGGGG - Intergenic
1010515271 6:76765538-76765560 CTATGAGGATGGAAGAAAGTCGG + Intergenic
1011315839 6:86030195-86030217 CTGGGATGTTCAAAGGAAGGAGG - Intergenic
1011558468 6:88592170-88592192 CTCTAATGATGGAAGGAGGGAGG - Intergenic
1011855722 6:91688404-91688426 CAGAGAGGAAGGAAGGAAGGAGG - Intergenic
1012247043 6:96937717-96937739 CTGTGAGGATGGAGGGTAGAGGG - Intronic
1012514057 6:100038464-100038486 CTGTCATGATGCCAGGATGGGGG - Intergenic
1012557758 6:100536603-100536625 GTGTGGTGATGGATGGTAGGGGG - Intronic
1012692829 6:102336399-102336421 CTTTGAAGATGGAAGGAAGAGGG - Intergenic
1012856276 6:104505977-104505999 CTGTGATCATGGAAGGAGCCTGG - Intergenic
1013420544 6:109962735-109962757 CATTGAGAATGGAAGGAAGGTGG + Intergenic
1013680709 6:112522411-112522433 CTGTGAGGCTAGAAGGAAGATGG - Intergenic
1014629405 6:123770797-123770819 CTGTGAGGCTAGAAGTAAGGTGG + Intergenic
1015789433 6:136951535-136951557 CTGTTAAGATGGAGTGAAGGAGG - Intergenic
1017046549 6:150352104-150352126 CTGTGAGGCTAGAAGTAAGGTGG - Intergenic
1017441973 6:154473000-154473022 TGGTGATGAAGGAAGGAAGAAGG + Intronic
1018095586 6:160384722-160384744 TTCTGAGGGTGGAAGGAAGGTGG - Intronic
1018509461 6:164509847-164509869 TTGTGGTGGGGGAAGGAAGGTGG + Intergenic
1019360547 7:602299-602321 CTGTCCTGCTGGAAGGACGGAGG + Intronic
1019549615 7:1595420-1595442 CTGGGAGGATGGATGGAGGGAGG - Intergenic
1019657650 7:2205053-2205075 CTGTGAGGTTAGAAGCAAGGTGG - Intronic
1022009632 7:26297625-26297647 ATGTGAGGAAAGAAGGAAGGAGG - Intronic
1022154122 7:27642100-27642122 GTGTGAAGAAGGAAAGAAGGTGG - Intronic
1022672727 7:32471497-32471519 CTGTCATGTTGAAAGGAAAGAGG - Intergenic
1022786801 7:33646127-33646149 CAGTGATGATGGAAAGGAGAAGG - Intergenic
1023487451 7:40702016-40702038 CTGTGATGATGTAACCCAGGTGG - Intronic
1024049768 7:45611041-45611063 AAGTGATGATGGAAGTGAGGAGG + Intronic
1024288345 7:47780250-47780272 CGGTGAGGAAGGAAGGAAGAAGG - Intronic
1024378598 7:48667880-48667902 CTGTGAGGCTAGAAGCAAGGGGG + Intergenic
1024908612 7:54419428-54419450 CTGTCATGTTGAAAGGAAAGAGG - Intergenic
1025663920 7:63572336-63572358 CTGTCAGGCTGGCAGGAAGGCGG + Intergenic
1026852648 7:73734878-73734900 TTGTGGTGAAGGGAGGAAGGGGG + Intergenic
1027634179 7:80648890-80648912 CAGTGAAGATGGAAGGAAGAAGG + Intronic
1028639850 7:93029834-93029856 CAGTGACAATGGCAGGAAGGTGG - Intergenic
1028984495 7:96998968-96998990 CTGGGATGAAGGAAGGGAGGAGG - Intergenic
1030627986 7:111864994-111865016 TTGTGATGAGGGGAGGAAGACGG + Intronic
1030684412 7:112469840-112469862 CTGAGATGAAGAAAAGAAGGTGG - Intronic
1032141865 7:129338596-129338618 CTGTTCTGATGGATGAAAGGTGG + Intronic
1032558431 7:132862106-132862128 ATGAAATGAAGGAAGGAAGGAGG + Intronic
1035825641 8:2641842-2641864 CTGAGAGGATGGAGTGAAGGAGG + Intergenic
1035893563 8:3372455-3372477 CAGTGGTGAAGGGAGGAAGGTGG + Intronic
1036588876 8:10149483-10149505 CTGTGCTGATTGAAGGGAGAAGG + Intronic
1036787032 8:11694749-11694771 CTGTGATCATGGAAGAAAAATGG - Intronic
1037144246 8:15554166-15554188 TTGTGATGATACAAGGAAGGTGG - Intronic
1038379588 8:27080066-27080088 CTGGAAAGAAGGAAGGAAGGAGG - Intergenic
1038512194 8:28149010-28149032 CTCATATGATGGAAGGAATGAGG - Intronic
1038722832 8:30053165-30053187 CTGAGAGGATGAAACGAAGGGGG + Intergenic
1039135373 8:34316762-34316784 CTTTGAAGATGGAGGGAATGTGG - Intergenic
1039317029 8:36385131-36385153 CTGTAATGTTGGGAGGAAAGTGG + Intergenic
1039783961 8:40816025-40816047 CTGTGATGCTGGAGGAAATGTGG - Intronic
1039845537 8:41323157-41323179 CTGTGATGGTGAGAGGAAGATGG - Intergenic
1039954526 8:42196852-42196874 ATGAGAAGAAGGAAGGAAGGGGG + Intronic
1040425248 8:47278851-47278873 CTGAAATGATAGAAGGAAGCAGG + Intronic
1040549819 8:48429295-48429317 CTGAGGTGATGGAAGTGAGGAGG + Intergenic
1041174596 8:55181445-55181467 CTGGAAGGATGAAAGGAAGGAGG - Intronic
1041607674 8:59802327-59802349 CTGTGAAAATGGAAGTTAGGAGG - Intergenic
1041875622 8:62683735-62683757 CTGAGAAGATGGAATGAAAGGGG + Intronic
1042296942 8:67230027-67230049 TTGTGATGGTGGAAGGTTGGGGG + Intronic
1042988058 8:74605151-74605173 CTTTGATGAGGGGAGGAAGGCGG - Intronic
1042992186 8:74654303-74654325 CTTAGATTATGGAGGGAAGGAGG + Intronic
1045063998 8:98429272-98429294 CTTTGGAGATGGAATGAAGGAGG + Exonic
1046097856 8:109581357-109581379 CTGTGAGGAAGGTAGGAAAGGGG - Intronic
1046133304 8:109994880-109994902 CTGAGAACATGGAACGAAGGTGG - Intergenic
1046680835 8:117168282-117168304 TTGTGATGATGTGAGGAAAGGGG - Intronic
1047063625 8:121255371-121255393 CTTTGAGGATGGAAGGATGGGGG + Intergenic
1047883639 8:129224005-129224027 CTCTAATGAAGGAAGGAAGAGGG + Intergenic
1047883653 8:129224151-129224173 CTCTGATGAAGGAAGAAAGAGGG + Intergenic
1048297762 8:133227284-133227306 CTGTGAAGCTGAAAGTAAGGTGG + Intronic
1048348314 8:133595286-133595308 CTGTGAAGGTGGGAGGAGGGAGG + Intergenic
1048859830 8:138716080-138716102 CAGTGTTGATGGAAGGGACGGGG - Intronic
1049350543 8:142162143-142162165 CTGTCAAGGTGGGAGGAAGGGGG - Intergenic
1049499631 8:142955022-142955044 CTGTGAGGGTGTAAGGAAGGGGG - Intergenic
1049797235 8:144502420-144502442 CTGTGCTGAGGGGCGGAAGGTGG + Intergenic
1050197414 9:3101255-3101277 CCATCATGATGGAAGGAAGTTGG + Intergenic
1051270593 9:15351558-15351580 CTGTGATGATGGAAATTAAGGGG + Intergenic
1051453730 9:17228568-17228590 AGGTGATGATAGAAGTAAGGTGG + Intronic
1052832541 9:33228117-33228139 CTGTGATGATGAAAGCAGAGTGG - Intronic
1053000711 9:34575921-34575943 CTGTGAGGAGGGGAGGAAAGGGG - Intronic
1053162145 9:35820521-35820543 CTCTGGTGCTGGAAGGTAGGAGG + Intronic
1053307658 9:36995548-36995570 CTGTGAGAATGGAGGAAAGGAGG + Intronic
1054077015 9:60546250-60546272 CTGCGCTGATGGAAGTGAGGTGG - Intergenic
1055497726 9:76872176-76872198 CTGTGACGATGCTTGGAAGGTGG - Intronic
1055567370 9:77582630-77582652 CTGGGATGAGGGAGTGAAGGGGG - Intronic
1056182849 9:84102389-84102411 CAGTGAGGAGGGAAAGAAGGAGG + Intergenic
1056554579 9:87677931-87677953 CTGTCAGGCTGGAAGGAATGGGG - Intronic
1056740223 9:89248083-89248105 CTGTGAGGTTGGAAGAAAGACGG + Intergenic
1057064487 9:92036108-92036130 CTGTGATGATGCACAGAAGCGGG + Intronic
1057268200 9:93632574-93632596 CTCATATGGTGGAAGGAAGGAGG + Intronic
1057400823 9:94721458-94721480 CTGTGAGGCTGGAAGCAAGATGG + Intergenic
1057962378 9:99469167-99469189 GTGTGATGATGGAAGCAGAGGGG + Intergenic
1059208964 9:112493423-112493445 CTGGGAAAATGGATGGAAGGTGG - Intronic
1059598684 9:115751967-115751989 CTGTGATGTTAGAAACAAGGTGG + Intergenic
1059915320 9:119093289-119093311 CTGTGGGGATGGAAGGATGGAGG + Intergenic
1060298264 9:122357611-122357633 CTTTGTTGTTGGAAGGAAGGAGG + Intergenic
1061294100 9:129667609-129667631 GGGTGAGGAGGGAAGGAAGGGGG + Intronic
1061298013 9:129687398-129687420 CTGAGATGATGCCTGGAAGGTGG - Intronic
1061512337 9:131068885-131068907 CTGTGATCAGGGAAGGAACTGGG - Intronic
1061850997 9:133415449-133415471 CTGTGAAGATCTCAGGAAGGTGG + Intronic
1203776435 EBV:75693-75715 CTGTGGTGAGGGATAGAAGGGGG + Intergenic
1185556923 X:1028895-1028917 CTGTGAGGTAGGTAGGAAGGTGG + Intergenic
1185719667 X:2371693-2371715 CTGTGATAATGGGAGGAGGAGGG - Intronic
1185719674 X:2371717-2371739 CTGTGATAATGGGAGGAGGAGGG - Intronic
1186096311 X:6106452-6106474 CTGTAATGGTGGATGCAAGGAGG - Intronic
1186184946 X:7011502-7011524 CTTTCATGAGGGAAGGAAGGAGG - Intergenic
1187482519 X:19670932-19670954 CCGTGCTGTTGGAAGGAAGTGGG - Intronic
1189288983 X:39871931-39871953 GTGGGCTGATGGAAGGAGGGAGG + Intergenic
1190417915 X:50199486-50199508 GGGTGATGGTGGAAGGAAGTTGG - Intronic
1191767841 X:64719817-64719839 CAGTCAGGATGGAAAGAAGGTGG - Intergenic
1192273860 X:69610399-69610421 CTAGGATGATGACAGGAAGGTGG + Intergenic
1193369136 X:80672376-80672398 AGGTGAGGAAGGAAGGAAGGAGG + Exonic
1194532040 X:95061706-95061728 CTGAAATGATGCAAGGAATGTGG + Intergenic
1195084366 X:101400366-101400388 TAGTGAAGATGGAAGGAAGTGGG + Intronic
1195468074 X:105203025-105203047 CTGTGAAACTGGAAGCAAGGGGG - Intronic
1197898923 X:131347387-131347409 CTGTGCTGATGGCTTGAAGGAGG + Intronic
1198275898 X:135096687-135096709 CTGGCATGATGGGAGGAGGGAGG - Intergenic
1198567235 X:137916842-137916864 CTGAACTGAAGGAAGGAAGGAGG - Intergenic
1198773927 X:140159579-140159601 CTGTAATGATGGAGGGAAGCTGG + Intergenic
1199679216 X:150214062-150214084 ATGTGAGGATGGGAGGGAGGAGG + Intergenic
1199864111 X:151827636-151827658 CTGTGGGCCTGGAAGGAAGGAGG - Intergenic
1200118318 X:153778850-153778872 CTGCGGTGATGGAAGCAGGGTGG + Intronic