ID: 957221396

View in Genome Browser
Species Human (GRCh38)
Location 3:77387462-77387484
Sequence GACCTACACCCTGGATTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 4, 3: 14, 4: 124}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957221388_957221396 27 Left 957221388 3:77387412-77387434 CCTAGGTCGAATCAAGCACCATG 0: 1
1: 1
2: 15
3: 27
4: 115
Right 957221396 3:77387462-77387484 GACCTACACCCTGGATTTTCAGG 0: 1
1: 0
2: 4
3: 14
4: 124
957221392_957221396 9 Left 957221392 3:77387430-77387452 CCATGTTGGGTCCAGTTGGTCTT 0: 7
1: 25
2: 40
3: 65
4: 235
Right 957221396 3:77387462-77387484 GACCTACACCCTGGATTTTCAGG 0: 1
1: 0
2: 4
3: 14
4: 124
957221394_957221396 -2 Left 957221394 3:77387441-77387463 CCAGTTGGTCTTAGGTCGCTTGA 0: 1
1: 0
2: 0
3: 5
4: 57
Right 957221396 3:77387462-77387484 GACCTACACCCTGGATTTTCAGG 0: 1
1: 0
2: 4
3: 14
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957221396 Original CRISPR GACCTACACCCTGGATTTTC AGG Intronic
901731831 1:11285615-11285637 CACCAACTCTCTGGATTTTCTGG + Intronic
901939744 1:12652873-12652895 GGTCCACACCCTGGCTTTTCAGG + Intronic
901940463 1:12657878-12657900 GGCCAACACCCTGGCTTTTCAGG + Intronic
902939121 1:19787131-19787153 GACCCACAGGCTGGTTTTTCTGG - Intronic
904111866 1:28132389-28132411 GGCCCACACCCTGGTTTTTCAGG + Intergenic
912542010 1:110423888-110423910 TACCCACACCCAGGATTTTGTGG - Intergenic
912585738 1:110763204-110763226 GACCTCCACCCTGGACATCCAGG + Intergenic
913973646 1:143436477-143436499 TACCTACATCCTGGATTTGTTGG + Intergenic
914068034 1:144262084-144262106 TACCTACATCCTGGATTTGTTGG + Intergenic
914111121 1:144704270-144704292 TACCTACATCCTGGATTTGTTGG - Intergenic
924032472 1:239900268-239900290 GACCTACAGTCTTGATTCTCAGG + Intronic
1072020529 10:91395002-91395024 GACCTTCAGCCTGGCTTTTCTGG + Intergenic
1072129606 10:92481210-92481232 GACCCAAAACTTGGATTTTCTGG - Intronic
1072719637 10:97772423-97772445 ACCCCACACCCTGGATCTTCTGG + Intergenic
1078531227 11:12138449-12138471 GACTTACTCACTGGATTCTCAGG - Exonic
1079186004 11:18237304-18237326 GGCCTTCACCCTTGATCTTCTGG - Intergenic
1080208931 11:29762692-29762714 GACCTACTCCCAGGATCTTTGGG - Intergenic
1081651311 11:44825900-44825922 GACCCACACCCTGGTTTTCGAGG - Intronic
1084121313 11:67070640-67070662 GACCTACACCCTGAGCGTTCTGG - Intronic
1086126232 11:83351303-83351325 GGCCTACAGCCTGAACTTTCGGG + Intergenic
1089973200 11:122710903-122710925 GGCATATACCCTGGATTTTCAGG + Intronic
1095746654 12:45666860-45666882 GGCCCACACCCTGGTTTTTCAGG + Intergenic
1099253098 12:80282817-80282839 TACCTCCACCCTTGACTTTCTGG + Intronic
1100363630 12:93899675-93899697 GGCCCACACCCTGGTTTTCCAGG - Intergenic
1104681178 12:130752922-130752944 CTCCTACACGCTGGATTTCCAGG + Intergenic
1107045290 13:35986808-35986830 GAGCTACACCTTAGTTTTTCAGG + Intronic
1108181779 13:47847305-47847327 GCTGTACACCCTGGATTTGCTGG - Intergenic
1108605120 13:52029910-52029932 GACCGAATCCCTGGATGTTCAGG + Exonic
1109885728 13:68541584-68541606 CACCTACACTCTGGTTTTTAAGG + Intergenic
1110964077 13:81669289-81669311 GAATTCAACCCTGGATTTTCAGG - Intergenic
1111825575 13:93263225-93263247 GGCCCACACCGTGGGTTTTCAGG + Intronic
1119754738 14:77108053-77108075 GTCTCACACTCTGGATTTTCTGG + Intronic
1119866730 14:77980776-77980798 GACCTGCAGCCTGGGGTTTCAGG + Intergenic
1121009815 14:90513294-90513316 CACCTCCACCCAGAATTTTCTGG - Intergenic
1121633252 14:95436817-95436839 GACCTGCAGCTTCGATTTTCTGG + Exonic
1121835715 14:97090292-97090314 GAACCACACACTGAATTTTCTGG - Intergenic
1128434889 15:67637069-67637091 GACCTACACCAGTGATTTGCCGG + Intronic
1135601565 16:23788191-23788213 GGTCCACACCCTGGTTTTTCAGG + Intergenic
1136871143 16:33808921-33808943 GTCCTACAGCCTGCATTTTGGGG + Intergenic
1139777022 16:69322742-69322764 GACCCAAACCCTCAATTTTCTGG - Intronic
1141086216 16:81097077-81097099 GACCCACACCCTGGTTTTTCAGG + Intergenic
1203101029 16_KI270728v1_random:1307137-1307159 GTCCTACAGCCTGCATTTTGGGG - Intergenic
1142977048 17:3651473-3651495 GACTGACACCATGGATTTGCTGG - Intronic
1144365226 17:14537376-14537398 GCCATACACCCTTGATGTTCAGG - Intergenic
1145018041 17:19411558-19411580 TATCTTCACCCTGGATTTCCAGG - Intronic
1148443915 17:47726361-47726383 GAGCTTCACCCTGGCATTTCAGG + Intergenic
1148718445 17:49732675-49732697 GGCCTACACACTGACTTTTCTGG + Exonic
1149093162 17:52808616-52808638 GACCGAATCCCTGGTTTTTCTGG - Intergenic
1150166580 17:62949877-62949899 CACCTACTCCCTGGTTTTTTAGG - Intergenic
1152277076 17:79364077-79364099 CACCCACCCCATGGATTTTCGGG + Intronic
1156015674 18:32544472-32544494 GACTCACACCCAGTATTTTCTGG - Intergenic
1156820770 18:41370482-41370504 GACCTAAGACCAGGATTTTCCGG - Intergenic
1157359021 18:46961936-46961958 GAGCTACACACTTGAATTTCAGG + Intronic
1157937096 18:51884740-51884762 GACAAATACCCTGGATTATCAGG - Intergenic
1158028033 18:52926406-52926428 GACTTAAACCCTGGATTTAGAGG + Intronic
1160734843 19:657815-657837 AACCTCCACCCTGGATATCCGGG - Intronic
1162070327 19:8149018-8149040 GAGCCACACCCTGGAGTTTGTGG + Intronic
1163444277 19:17337717-17337739 GACCCACTCCCTGGGTTTTAGGG + Intronic
1164523455 19:28996353-28996375 GAACTACACCCTAGTTTTCCTGG + Intergenic
1165549660 19:36573418-36573440 GCCCCAGACCCTGGAGTTTCCGG + Intronic
1167334885 19:48878775-48878797 GGCCCACGCCCTGGTTTTTCAGG + Intergenic
1167645913 19:50704724-50704746 GAACTACACACTGGATTTCAAGG + Intronic
1167742029 19:51329522-51329544 CCTCCACACCCTGGATTTTCTGG + Exonic
932475311 2:72002381-72002403 GGCCTGCAGTCTGGATTTTCTGG - Intergenic
933980150 2:87542813-87542835 GATCTACACCCTGGTTCTCCGGG - Intergenic
934178341 2:89597443-89597465 TACCTACATCCTGGATTTGTTGG + Intergenic
934288634 2:91671735-91671757 TACCTACATCCTGGATTTGTTGG + Intergenic
934568240 2:95352462-95352484 GACCTGGAGCCTGGATATTCGGG - Intronic
935028113 2:99296635-99296657 GACATACACCCTGGAGTGGCAGG - Intronic
935139003 2:100334501-100334523 TACCTTCATCCTGTATTTTCTGG + Intergenic
936077834 2:109413009-109413031 GCCCCACACCCTGGAACTTCAGG + Intronic
936313677 2:111407978-111408000 GATCTACACCCTGGTTCTCCGGG + Intergenic
939980722 2:148777470-148777492 GAAATACACTCTGGATCTTCTGG - Intronic
940074254 2:149722840-149722862 CACCCACACCTTGAATTTTCAGG + Intergenic
946479098 2:220036637-220036659 GATCTACCCCCTGGAGTTTTGGG + Intergenic
948014320 2:234675501-234675523 GGTCCACACCCTGGTTTTTCAGG + Intergenic
1170522949 20:17207148-17207170 GGCCTACACCCTGGTTTTTCAGG - Intergenic
1171323167 20:24264992-24265014 GAGCTGCTCCCTGGATTTTAGGG - Intergenic
1174269012 20:49353426-49353448 GACCAACACCCTGGACTTACTGG + Intergenic
1175027197 20:55914867-55914889 TACCTACTACCTGGTTTTTCCGG + Intergenic
1178093207 21:29186126-29186148 GAACTACACCATGGCTCTTCTGG + Intergenic
950925860 3:16741339-16741361 AAGCTATACCCTGGACTTTCGGG - Intergenic
951467650 3:23019873-23019895 GATCTAAAATCTGGATTTTCAGG - Intergenic
952145373 3:30526310-30526332 GTCCCACACCCTTGATTATCAGG - Intergenic
957221396 3:77387462-77387484 GACCTACACCCTGGATTTTCAGG + Intronic
958491402 3:94778570-94778592 GACCTACAAAATGTATTTTCTGG - Intergenic
958864755 3:99486852-99486874 GACCTAGAGCCTGAATCTTCAGG - Intergenic
960533096 3:118787276-118787298 AGCTTACACCCAGGATTTTCTGG + Intergenic
961982997 3:131101396-131101418 GAGCTACACCCTGGAGATTTTGG + Intronic
964780336 3:160330229-160330251 GACCTACCCCCAGGAGATTCTGG - Intronic
965785502 3:172330682-172330704 CACCTACACCTTGGAAATTCAGG + Exonic
966556561 3:181268056-181268078 AAACTAAATCCTGGATTTTCTGG - Intergenic
967929709 3:194682072-194682094 GAACTACACACTGGATTTTCAGG - Intergenic
969830914 4:9795955-9795977 TACCTACAACCTGGATTTGTTGG - Intronic
970213418 4:13733814-13733836 GACTCACAACCTGGATTTTTTGG - Intergenic
970740206 4:19228762-19228784 GACCCACATTCTGGTTTTTCAGG - Intergenic
971231810 4:24806339-24806361 GCCCTGCACCCTAGATTCTCTGG + Exonic
976829625 4:89299795-89299817 GAGATACACTCTGGACTTTCAGG + Intronic
979523637 4:121696248-121696270 GAGCTACTCTCTGGATTTTGGGG + Intronic
981020332 4:140021009-140021031 GACCTACACCTTTGTTTCTCTGG - Intronic
983500391 4:168493178-168493200 GATCTACAGCCTGGAAATTCTGG + Intronic
983866125 4:172768784-172768806 GACCTACACCTTGGTTTTTTAGG + Intronic
983969138 4:173849565-173849587 GACCTACACCAGTGATTTGCGGG - Intergenic
984875908 4:184367257-184367279 GGCCCACACCCTAGTTTTTCAGG + Intergenic
987170188 5:15247383-15247405 TGCCTACTCCCTGGATTGTCTGG + Intergenic
992247518 5:74841561-74841583 GAAAAACACTCTGGATTTTCAGG + Exonic
995130305 5:108623064-108623086 GGCCTACACCTTGGTTTTTCAGG + Intergenic
995284834 5:110376284-110376306 GACCTATACCCATCATTTTCTGG + Intronic
998941382 5:147286468-147286490 GGCTTACACCCTGGTTTTTCAGG + Intronic
1000000859 5:157137362-157137384 GACCTACACCCAGAAGTTTCTGG + Intronic
1009899241 6:69791879-69791901 GGTCCACACCCTGGTTTTTCAGG - Intronic
1009967239 6:70590575-70590597 GACTCACACCCTGGTTTTTCAGG + Intergenic
1010082948 6:71885979-71886001 CTCCAACAGCCTGGATTTTCTGG - Intergenic
1018258990 6:161950708-161950730 GACCTACAGACTGGTTTATCAGG + Intronic
1018576637 6:165266543-165266565 GAACTACACCCTGGCTTTCCTGG + Intergenic
1020530304 7:9324856-9324878 GAACACCAGCCTGGATTTTCTGG - Intergenic
1023731479 7:43196026-43196048 GGTCCACACCCTGGTTTTTCAGG + Intronic
1024363939 7:48500020-48500042 GAACTACAACCCTGATTTTCTGG - Intronic
1024551261 7:50564316-50564338 GACCTACACACTGGATTGCTTGG + Intronic
1027578149 7:79957294-79957316 GAACTACACAATTGATTTTCTGG - Intergenic
1028629396 7:92918006-92918028 TACCCACACCCTAGATTTTTGGG - Intergenic
1033044283 7:137947358-137947380 CACCTACACCCTCGCTTCTCTGG + Intronic
1034875800 7:154723969-154723991 GTCCTACACAATGCATTTTCTGG - Intronic
1036001235 8:4607476-4607498 GGCACACACCCTGGGTTTTCTGG - Intronic
1038519477 8:28217777-28217799 GACTTACCCTCTGGATTTGCTGG + Intergenic
1039013735 8:33123662-33123684 GATCCACACCCTGGTTTTTCAGG + Intergenic
1041309697 8:56502846-56502868 TACCTACACCTGGGATTTCCAGG - Intergenic
1042168225 8:65967315-65967337 GACATACACCTTGGACATTCTGG + Intergenic
1042709728 8:71703637-71703659 GACTTACACCATGCATTTTCTGG + Intergenic
1045568744 8:103348484-103348506 CACTGACACACTGGATTTTCTGG - Intergenic
1047769914 8:128022281-128022303 GACCTTTACCCTGGATTTATGGG + Intergenic
1047984933 8:130222948-130222970 GAGCTAAGACCTGGATTTTCAGG - Intronic
1047999524 8:130366388-130366410 GACCTACACTCTGCATGTGCTGG - Intronic
1053039596 9:34858491-34858513 GACCTGGACCCTGGATCTGCTGG + Intergenic
1055420454 9:76135626-76135648 AAATTACATCCTGGATTTTCCGG - Intronic
1060142143 9:121219552-121219574 GACCCACACCCTGGTTTTTCAGG - Intronic
1186320435 X:8418214-8418236 TACCTAAACCCTGTATTTGCTGG - Intergenic
1188797495 X:34484017-34484039 GTCCTGGACCCTGGGTTTTCTGG + Intergenic
1188911452 X:35852922-35852944 GAGCTACACCTTGCATTTTAGGG - Intergenic
1190605674 X:52139623-52139645 GACCTAGACCTTGCATCTTCTGG - Intergenic
1191062937 X:56318561-56318583 GGCCTGGACTCTGGATTTTCTGG - Intergenic
1196785608 X:119419118-119419140 CAGCTGCTCCCTGGATTTTCAGG - Intronic
1198029247 X:132738909-132738931 AAACTAGACCCTGGATTTTGTGG + Intronic