ID: 957221570

View in Genome Browser
Species Human (GRCh38)
Location 3:77389401-77389423
Sequence AAGTAGCCACAAGCCCGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 50}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957221570_957221575 30 Left 957221570 3:77389401-77389423 CCCATGCGGGCTTGTGGCTACTT 0: 1
1: 0
2: 0
3: 5
4: 50
Right 957221575 3:77389454-77389476 ATGATCATGCAGTGTTCTATTGG 0: 1
1: 0
2: 0
3: 10
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957221570 Original CRISPR AAGTAGCCACAAGCCCGCAT GGG (reversed) Intronic
916525045 1:165601792-165601814 AAGTGGCCACAAGGTGGCATAGG + Intergenic
920132343 1:203742002-203742024 AAGTAGACACAAGCCCTCAAGGG - Exonic
920858205 1:209681123-209681145 AAGTTGCCAAGAGCCCACATTGG - Intergenic
921559497 1:216640164-216640186 TAGTAGCCACAAAGCCGCACTGG + Intronic
1063018965 10:2106966-2106988 AAGTAGCTACAAGCCTACATAGG + Intergenic
1076947014 10:133658411-133658433 AAGTAGACACAAATCCCCATGGG + Intergenic
1085053876 11:73393062-73393084 AGGTAGCCACAGGCTCCCATGGG - Intronic
1106804235 13:33289792-33289814 TAGAAGCCACAAGCCCTCTTAGG + Intronic
1133144528 16:3774633-3774655 CAGTTGCCACAAGCACCCATGGG - Exonic
1141628149 16:85272301-85272323 AAGGAGCCTCAGGCCCGCAGAGG + Intergenic
1142352787 16:89587485-89587507 AAGCAGCCCCAAGCCCGCCTTGG + Intronic
1145197584 17:20908421-20908443 AAGGAGCCTCCAGCCCGCAGCGG + Intergenic
1152631744 17:81413634-81413656 AAGCAGCCACAAGGCCGCGGGGG + Intronic
1203170920 17_GL000205v2_random:147370-147392 AAGTAGACACAAATCCCCATGGG + Intergenic
1166491868 19:43267321-43267343 AAGAAGCCACAACCCAGCACTGG + Intronic
924965230 2:70422-70444 AAGTAGCCACATGGATGCATTGG + Intergenic
930984868 2:57573175-57573197 AAGCAGCCTGAAGCCCTCATCGG + Intergenic
935539064 2:104327910-104327932 ATGTAGCCACAACCTCGCACTGG + Intergenic
935880916 2:107564374-107564396 AAGTAGCCATGAGACCGCACTGG - Intergenic
1172705382 20:36878793-36878815 AACTAGCCCAAAGCTCGCATGGG - Intronic
1175055739 20:56196208-56196230 ATGTGGCCACAGGCCCGCAGTGG - Intergenic
1176326904 21:5509201-5509223 AAGTAGACACAAATCCCCATGGG + Intergenic
1176330801 21:5547010-5547032 AAGTAGACACAAATCCCCATGGG - Intergenic
1176396956 21:6273941-6273963 AAGTAGACACAAATCCCCATGGG + Intergenic
1176400853 21:6311750-6311772 AAGTAGACACAAATCCCCATGGG - Intergenic
1176436304 21:6677354-6677376 AAGTAGACACAAATCCCCATGGG + Intergenic
1176440201 21:6715163-6715185 AAGTAGACACAAATCCCCATGGG - Intergenic
1176460566 21:7004424-7004446 AAGTAGACACAAATCCCCATGGG + Intergenic
1176464463 21:7042232-7042254 AAGTAGACACAAATCCCCATGGG - Intergenic
1176484127 21:7386202-7386224 AAGTAGACACAAATCCCCATGGG + Intergenic
1176488024 21:7424011-7424033 AAGTAGACACAAATCCCCATGGG - Intergenic
1183688155 22:39373954-39373976 AAGGAGCCACAGGCCCTCCTGGG - Intronic
950439556 3:13001292-13001314 AAGTGCCCACAAGCCAGCACAGG - Intronic
950507067 3:13401583-13401605 AAGCAGGCACAAGCCCACACAGG + Intronic
954272161 3:49518409-49518431 AAGTAACCAGAAGCCCACACAGG - Intronic
957221570 3:77389401-77389423 AAGTAGCCACAAGCCCGCATGGG - Intronic
960280716 3:115778784-115778806 AATTGGCCACAAGCCCTCAATGG - Intergenic
962451441 3:135520693-135520715 AATTAGCCACAATCCCCAATAGG - Intergenic
965458805 3:168935181-168935203 AAGAAGCCTGAAGCCCACATGGG - Intergenic
970483220 4:16498706-16498728 AAGCAGCCACAAGCCAGCCCAGG - Intergenic
976696873 4:87926377-87926399 AAGTAGCCACAAACCCCACTGGG - Intergenic
998498103 5:142608406-142608428 ATGTAGCCACAAGCCGGGATTGG + Intronic
1001684695 5:173584646-173584668 AAGTAGTCACAAGCCTGCCCAGG - Intergenic
1001688914 5:173617578-173617600 AAGTAGCCACAATTCACCATTGG + Intergenic
1005395808 6:25380888-25380910 AAGTAGCAAGAAACCTGCATTGG + Intronic
1009828628 6:68900412-68900434 AAGTAGCCACAAGGAGGCCTGGG + Intronic
1015870607 6:137772734-137772756 AAGGAGCCACAGACCCGCATTGG + Intergenic
1019055778 6:169222288-169222310 GAGTAGCCATAGGCCCGCGTGGG + Exonic
1027428074 7:78082066-78082088 AAGTAACCACAAGGCGGCAGTGG - Intronic
1027816839 7:82984778-82984800 AAGTAGCAAGAAGCAGGCATAGG - Intronic
1036454870 8:8897711-8897733 AAATAGCCTCAAGCCTGGATGGG + Intergenic
1048983711 8:139717740-139717762 ATGTAGCCATAAGCCTGTATGGG + Intergenic
1050131753 9:2420156-2420178 TACTAGCAACAAGCCCACATTGG - Intergenic
1203431294 Un_GL000195v1:93316-93338 AAGTAGACACAAATCCCCATGGG + Intergenic
1203435213 Un_GL000195v1:131307-131329 AAGTAGACACAAATCCCCATGGG - Intergenic
1200278647 X:154757899-154757921 AAGCAGCCACAAGCCTGCTCAGG - Intergenic