ID: 957221575

View in Genome Browser
Species Human (GRCh38)
Location 3:77389454-77389476
Sequence ATGATCATGCAGTGTTCTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 113}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957221570_957221575 30 Left 957221570 3:77389401-77389423 CCCATGCGGGCTTGTGGCTACTT 0: 1
1: 0
2: 0
3: 5
4: 50
Right 957221575 3:77389454-77389476 ATGATCATGCAGTGTTCTATTGG 0: 1
1: 0
2: 0
3: 10
4: 113
957221571_957221575 29 Left 957221571 3:77389402-77389424 CCATGCGGGCTTGTGGCTACTTT 0: 1
1: 0
2: 1
3: 8
4: 65
Right 957221575 3:77389454-77389476 ATGATCATGCAGTGTTCTATTGG 0: 1
1: 0
2: 0
3: 10
4: 113
957221573_957221575 -2 Left 957221573 3:77389433-77389455 CCACAGACATAAAAGATTTCCAT 0: 1
1: 0
2: 1
3: 16
4: 370
Right 957221575 3:77389454-77389476 ATGATCATGCAGTGTTCTATTGG 0: 1
1: 0
2: 0
3: 10
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957221575 Original CRISPR ATGATCATGCAGTGTTCTAT TGG Intronic
908617007 1:65932698-65932720 ATGTTCATGCATTGTTCTCTTGG - Intronic
909631663 1:77774761-77774783 GTGATGATGCTGTGCTCTATGGG + Intergenic
921465314 1:215480127-215480149 ATCATCATGCAGTTTTATAATGG + Intergenic
1065246791 10:23767040-23767062 AGGAGCATCCAGAGTTCTATGGG + Intronic
1065752619 10:28901177-28901199 AAAGTCATGCAGTATTCTATTGG - Intergenic
1068908469 10:62352696-62352718 ATCAAAATCCAGTGTTCTATTGG + Intergenic
1070204773 10:74246592-74246614 ATGATAATGAAGTATTCAATGGG - Intronic
1071790373 10:88947280-88947302 GTGATGATGCCATGTTCTATCGG + Exonic
1073913710 10:108377482-108377504 ATGTTCATGCAATGTTGTTTAGG + Intergenic
1074893030 10:117750974-117750996 ATGAACATGCAGTGCTCTCAGGG - Intergenic
1075929204 10:126280522-126280544 ATCATCATGGAATGTTCTATTGG + Intronic
1079569032 11:21920009-21920031 ATAATCCTGCAGTGTTCTAGAGG + Intergenic
1079854671 11:25587095-25587117 ATGAACATGCAGTGCACTGTTGG - Intergenic
1082105967 11:48222195-48222217 ATTATCATGGAAAGTTCTATTGG - Intergenic
1088602689 11:111495607-111495629 ATGAACATGCAGTTTTGGATTGG - Intronic
1096309633 12:50509173-50509195 ATGGTCATGCACTGTTTTGTTGG - Intronic
1097322635 12:58243457-58243479 ATGATCATGCAGAGCTCCATGGG + Intergenic
1100185955 12:92140206-92140228 TTGAAGATGCAGTGTTCTTTTGG - Intronic
1101168569 12:102063970-102063992 CTGATCATGCAGAGCTTTATGGG + Intergenic
1106121888 13:26866730-26866752 ATCATGATGCAAAGTTCTATTGG - Intergenic
1108703513 13:52964221-52964243 GGGATCTTGAAGTGTTCTATTGG + Intergenic
1109012237 13:56966334-56966356 ATTATAATGCAGAGTTCCATTGG - Intergenic
1109289888 13:60461220-60461242 ATGTTCTTGCAGAGTTTTATAGG + Intronic
1110713893 13:78679935-78679957 TTGTTCATGCAGGGTTCTGTAGG + Intergenic
1112226103 13:97541944-97541966 ATGCTCAGGCAGTGTTTTGTTGG - Intergenic
1114192492 14:20450723-20450745 ATGATAATCAAGTGTTCTGTTGG + Intronic
1115415694 14:33130863-33130885 ATCATCATGCACACTTCTATAGG - Intronic
1115897902 14:38110646-38110668 ATGATGGTTCAGTGTTCTAATGG + Intergenic
1117693750 14:58337910-58337932 ATGATCAGGCAGACTTCTAAAGG - Intronic
1118467256 14:66042187-66042209 TGGATCATGCAGGGTTTTATAGG + Intergenic
1125103391 15:35942107-35942129 ATTATAATTCTGTGTTCTATGGG - Intergenic
1126844967 15:52751003-52751025 AGGATCACTCAGTGTTCTGTTGG - Intergenic
1132365791 15:101255542-101255564 ATAATGAAGCAGTGTTTTATTGG - Intergenic
1135395263 16:22126520-22126542 TTGATCAAGCAGTGTGTTATGGG - Intronic
1136926978 16:34383404-34383426 ATGTTCCTGCAGTGTACTTTGGG - Intergenic
1136977596 16:35028403-35028425 ATGTTCCTGCAGTGTACTTTGGG + Intergenic
1137920867 16:52486988-52487010 ATGATCTTGCTTTGTTCTAAGGG + Intronic
1141663678 16:85454771-85454793 ATCATCATGCAGCCTTCTATGGG + Intergenic
1146441957 17:32904969-32904991 ATGATCACTGAGTGTTCTAATGG + Intergenic
1146775259 17:35608784-35608806 ATTATCATGCATTTCTCTATAGG + Intronic
1150101594 17:62428848-62428870 TTGAGCCTGCAGTGTGCTATGGG - Intronic
1150737748 17:67754753-67754775 GAGATCATGCAGTGCTCTGTGGG - Intergenic
1154956518 18:21262771-21262793 ATGATAAAGCAGTTTTCTCTGGG + Intronic
1154960780 18:21306338-21306360 ATGATAATTAAGTGGTCTATGGG + Intronic
1155765646 18:29629033-29629055 ATGATCATTCAGCTTTTTATTGG - Intergenic
1159653284 18:71002805-71002827 ATCATCATACAAAGTTCTATTGG + Intergenic
1164789577 19:30964706-30964728 ATGATCAAGCAGGGTTCCTTGGG - Intergenic
1165886949 19:39085145-39085167 ATGATCAGGCAGTGCTCTGGGGG - Exonic
1166018476 19:40002585-40002607 ATCATCATGGAAAGTTCTATTGG - Intronic
1167353870 19:48991960-48991982 ATGACCATGCAGGCTTCTCTTGG - Intronic
1167579764 19:50334563-50334585 ATGATAATGCAGTTTTGTTTGGG - Intronic
931770455 2:65492670-65492692 ATGCTCCTGCAGTATTCTATAGG + Intergenic
932689789 2:73902444-73902466 GTGATGATGCCGTGTTCAATGGG - Exonic
935538150 2:104318416-104318438 TTGAACATGCAGTGGTTTATAGG + Intergenic
938282612 2:130075142-130075164 GTGATGATGCCGTGTTCCATGGG + Exonic
938333244 2:130463714-130463736 GTGATGATGCCGTGTTCCATGGG + Exonic
938356567 2:130656957-130656979 GTGATGATGCCGTGTTCCATGGG - Exonic
938433001 2:131263763-131263785 GTGATGATGCCGTGTTCCATGGG - Exonic
939772446 2:146338115-146338137 ATGATCATGCACTGAACTAGGGG + Intergenic
940477727 2:154187095-154187117 ATAACCATGAAGTTTTCTATAGG - Intronic
940686276 2:156855210-156855232 CAGAACATGCAGTGGTCTATTGG + Intergenic
941536685 2:166731157-166731179 ATGATAAGGCAGTATTTTATCGG - Intergenic
941727591 2:168880213-168880235 ATGAAAAAGCAGTTTTCTATTGG - Intronic
942556845 2:177180265-177180287 ATGATTATACATTGTTCTAAGGG + Intergenic
944155664 2:196604763-196604785 ATTATCACTCAGTGTCCTATGGG - Intergenic
944652084 2:201840826-201840848 ATGATTATGCAGTTTTCTCTAGG + Intronic
1169509302 20:6246130-6246152 ATCATGATGGAGAGTTCTATTGG - Intergenic
1182409030 22:30166318-30166340 ATTATCATGGAAAGTTCTATTGG - Intronic
1182726084 22:32446891-32446913 AAGATCATGCAGTGATTTGTGGG + Intronic
950770412 3:15306556-15306578 ATGATCATGTGTTGTTCTTTTGG - Intronic
951985221 3:28612342-28612364 ATGCTCATGCTCTGTTCTATTGG - Intergenic
952669466 3:35948633-35948655 AAGAACATGCAGTGTTGAATAGG + Intergenic
957221575 3:77389454-77389476 ATGATCATGCAGTGTTCTATTGG + Intronic
957513953 3:81226767-81226789 TTGAACATACAGTGATCTATGGG + Intergenic
957670644 3:83297032-83297054 ATGGTTAGGCAGTATTCTATTGG - Intergenic
963909007 3:150799248-150799270 GTGATCTTTCAGTGTTTTATGGG + Intergenic
964864715 3:161244154-161244176 ATGATCTTGCCGTGTTGTTTGGG + Intronic
965116177 3:164491935-164491957 ATGATCATGGAAAGTTCTGTTGG + Intergenic
965920243 3:173904893-173904915 ATGATATTGCAGTGTTCCAAGGG + Intronic
965964402 3:174469171-174469193 ATGATCAAGCAGTATTATAAAGG - Intronic
968064481 3:195751062-195751084 ATGACCATCCAGTGTTGGATGGG + Exonic
970711021 4:18862482-18862504 GTGATCATTCAGAGTTCTTTTGG - Intergenic
972094054 4:35326149-35326171 ATGATCATGTAGTCTTCCACAGG - Intergenic
973084702 4:46043303-46043325 AGTATCATGGAGAGTTCTATGGG + Intronic
974100714 4:57412859-57412881 CTGGGCATGCCGTGTTCTATAGG - Intergenic
975275061 4:72487583-72487605 ATGAGCATGCAGTCTTATATCGG + Intronic
977065646 4:92311104-92311126 CTAATTTTGCAGTGTTCTATAGG - Intronic
979300559 4:119081660-119081682 ATGATCATTCACTTTTATATTGG - Intergenic
979555846 4:122046580-122046602 CTGATCATACAGTCTACTATAGG + Intergenic
984076204 4:175183630-175183652 ATGAGCAAGCAGTGGACTATAGG - Intergenic
985673291 5:1217476-1217498 TTCATTATGCAGTGTTCTTTTGG + Intronic
987590267 5:19916208-19916230 CAGATCTTGCAGTGCTCTATGGG - Intronic
995532524 5:113105879-113105901 TTGATCATGCAGAGTTTTACAGG - Intronic
999116848 5:149171889-149171911 AAACTCATGGAGTGTTCTATTGG - Intronic
1003463979 6:6359766-6359788 TTGATAATGCTGTGTTCTAAGGG + Intergenic
1012110905 6:95232230-95232252 ATCATCATGCAGTCATCTAGGGG + Intergenic
1012712059 6:102619185-102619207 ATTATCAGGCAGTGTCATATTGG + Intergenic
1012967977 6:105696000-105696022 CTGATCTTGCAGTGCTTTATAGG + Intergenic
1014174407 6:118315758-118315780 AGGATCCTGCAGTATTCTCTGGG - Exonic
1028564805 7:92218098-92218120 ATGATCATCCACTGTACTCTAGG - Intronic
1030511695 7:110490901-110490923 ATAATCAATCAGTGTTTTATTGG + Intergenic
1031373567 7:120997102-120997124 ATGATCATGAAGATTTCTAGAGG - Intronic
1032030742 7:128481707-128481729 TTGAGCCTGCAGTGTGCTATGGG - Intronic
1038093966 8:24286759-24286781 ATTGTCATGCTGTGTTCTCTGGG - Intergenic
1042025832 8:64422810-64422832 TTGATGATGCACTGTTCTACAGG - Intergenic
1044289227 8:90448106-90448128 TTGATCATGCAGAGCTCTTTAGG - Intergenic
1044751324 8:95418883-95418905 ATGATCAGGCAGCATTATATGGG + Intergenic
1044780499 8:95738933-95738955 CTGATCATGCAATGATCTAGGGG + Intergenic
1044808286 8:96031163-96031185 AAGATCATGTAGGGTTTTATGGG - Intergenic
1048298168 8:133230869-133230891 ATGATAATGCCATATTCTATAGG - Intergenic
1049207760 8:141371358-141371380 ATGATGAGGCAGTGTTCTGTGGG - Intergenic
1056021678 9:82444394-82444416 ATGCTCTTGCAGTTTTCTCTGGG + Intergenic
1056542750 9:87587849-87587871 AAGCTCATACATTGTTCTATTGG - Intronic
1059542291 9:115142967-115142989 ATGACCATGTACTCTTCTATTGG + Intronic
1059842746 9:118236293-118236315 ATGATCATGGACTATTATATTGG - Intergenic
1185471735 X:387709-387731 ATGATAATGCAGTGTTTTTATGG - Intergenic
1190242449 X:48668045-48668067 ATGGTCATGCAGTGTGCCCTGGG - Intergenic
1191961549 X:66708198-66708220 ATGAGCATTTAGTGTTATATTGG - Intergenic
1194412304 X:93572126-93572148 ATGATCACTGAGTGCTCTATTGG + Intergenic
1195162486 X:102184234-102184256 TTGATCATGCACTGTCCTTTGGG + Intergenic
1195166576 X:102226156-102226178 TTGATCATGCATTGTCCTTTGGG + Intronic
1195192284 X:102460932-102460954 TTGATCATGCATTGTCCTTTGGG - Intronic
1197408089 X:126079665-126079687 ATAATCATGCTGTGGTGTATGGG + Intergenic
1199260704 X:145770914-145770936 ATTATCATTCTATGTTCTATGGG - Intergenic