ID: 957222554

View in Genome Browser
Species Human (GRCh38)
Location 3:77402567-77402589
Sequence GCTCAACTATGTGCACTAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 16, 3: 84, 4: 254}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957222547_957222554 29 Left 957222547 3:77402515-77402537 CCTGAAACCGGTGATCAGAAACT 0: 1
1: 0
2: 19
3: 180
4: 352
Right 957222554 3:77402567-77402589 GCTCAACTATGTGCACTAAAAGG 0: 1
1: 0
2: 16
3: 84
4: 254
957222548_957222554 22 Left 957222548 3:77402522-77402544 CCGGTGATCAGAAACTTCTGAAT 0: 1
1: 0
2: 1
3: 22
4: 193
Right 957222554 3:77402567-77402589 GCTCAACTATGTGCACTAAAAGG 0: 1
1: 0
2: 16
3: 84
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957222554 Original CRISPR GCTCAACTATGTGCACTAAA AGG Intronic
901729251 1:11266978-11267000 GCTCAAGCATGGGCACTAAGAGG - Intergenic
903309644 1:22444538-22444560 GTTCAAGCATGTGCACTAAGAGG + Intergenic
905610312 1:39344767-39344789 GCTCAAGCATGCGCACTAAGAGG - Intronic
905690911 1:39941999-39942021 GGTCAAGCATGTGCACTAAGAGG - Intergenic
907053200 1:51343701-51343723 GCTCAACAATGTGTGCTGAAAGG + Intronic
908583001 1:65537344-65537366 GCTCTACTACCTACACTAAAGGG + Intronic
908769385 1:67582599-67582621 GCTCCACTATGTGCACACAACGG + Intergenic
908771283 1:67599196-67599218 GCACAGCTATCTGCACTAACAGG - Intergenic
909099823 1:71336594-71336616 GCTCAAGCATGTGCATTAAGAGG - Intergenic
910191788 1:84602753-84602775 GCTCTACTATGTACACCAAGGGG - Intergenic
910365444 1:86460254-86460276 GCTCAAGCATGTGCACTAAGAGG - Intergenic
911644551 1:100324317-100324339 AGTCAACTATGTTCACTAAATGG - Intergenic
911854429 1:102858983-102859005 GCTCAAGCATGTGCACTAAGAGG + Intergenic
912940146 1:114037547-114037569 GCTCAAGCATGTGCACTAAGAGG - Intergenic
913367024 1:118049990-118050012 GCTCAAATATGTGCATTAAGAGG + Intronic
915909556 1:159905171-159905193 GCCCAACTAGGTGGACTTAAGGG + Intergenic
916816862 1:168362613-168362635 GCTCAAGCATGTGCATTAAGAGG + Intergenic
917103137 1:171465738-171465760 GCTCAAGCATGTTCACTAAGAGG - Intergenic
917314527 1:173710655-173710677 GCTCCAGCATGTGCATTAAAGGG - Intergenic
917567280 1:176225821-176225843 GCTCATGCATGTGCACTAAAAGG + Intergenic
918324501 1:183396447-183396469 GCTCAAGCATGTGCACTAAGAGG + Intronic
919298473 1:195732415-195732437 GATCAAGCATGTGCACTAACAGG + Intergenic
919675878 1:200382549-200382571 TTTCAATTATGTGTACTAAATGG + Intergenic
920798107 1:209160188-209160210 GCTCAAGCATGTGCACTAAGAGG - Intergenic
921294933 1:213692723-213692745 GCTCAAGCATGTGCATTAAGAGG - Intergenic
921522007 1:216167415-216167437 GCTCAAGCATGCGCACTAAGAGG + Intronic
921649097 1:217655736-217655758 GGTCAACTATTCTCACTAAATGG + Intronic
922333758 1:224601399-224601421 GCTCAAGCATGTGCACTAAGCGG - Intronic
922334660 1:224608914-224608936 GCTCAAACATGTGCACTAAGAGG - Intronic
922875348 1:228936056-228936078 GCTCAAGCATGCGCACTAAGAGG + Intergenic
924144300 1:241058160-241058182 GCTCAAACATGTGCATTAAGAGG + Intronic
924511688 1:244733107-244733129 GCTCAAGTATGTGCACTAAGAGG + Intergenic
1062775355 10:140760-140782 GCTTAAGTATGTGCACGTAAGGG - Intronic
1062986755 10:1776324-1776346 ACTCAAGCATGTGCACTAAGAGG + Intergenic
1065506462 10:26434720-26434742 GCTCAAGCATGTGCACTAAGAGG + Intergenic
1065534901 10:26707255-26707277 GCTCAACCATGCACACTAAGAGG - Intronic
1065940407 10:30559253-30559275 GCTCAAGCATGAGCACTAACAGG + Intergenic
1066173206 10:32874485-32874507 GCTAAGCTATGTGCACACAAAGG - Intronic
1066289362 10:33999702-33999724 GCTCAAGCATGCGCACTAAGAGG - Intergenic
1067803368 10:49375922-49375944 GCTCAGCTCTGTGCACTCCAGGG + Intronic
1067893898 10:50159511-50159533 GCTCAAGCATGTGCATTAAGAGG + Intergenic
1068438401 10:57019765-57019787 GCTCACCTATGCACACTAAGAGG + Intergenic
1068497047 10:57795999-57796021 GCTAAAACATGTGCACTAAGAGG + Intergenic
1068518866 10:58057302-58057324 GCTCATGTATGTGCACTAAGAGG - Intergenic
1068807190 10:61210674-61210696 TCTAAACTATTTGCACTTAATGG - Intergenic
1070089355 10:73269563-73269585 CCTCACCTCTGTGCCCTAAAAGG + Intronic
1071155015 10:82678075-82678097 GCTCAAGCATGAGCACTAAGAGG - Intronic
1071409400 10:85374000-85374022 GCTCAAGCATGTGCCCTAAGAGG + Intergenic
1071828977 10:89353260-89353282 GCTCAAGCATGTGCACTAAGAGG + Intronic
1072589064 10:96810629-96810651 GCACACATATGTTCACTAAAAGG + Intergenic
1072739206 10:97899727-97899749 GCCCAACTATTTATACTAAAAGG - Intronic
1073849562 10:107599062-107599084 GCTCAAGCATGTGCATTAAGAGG + Intergenic
1074696725 10:116056530-116056552 GCTCATTTATGAGCAGTAAAAGG - Intergenic
1075240211 10:120771589-120771611 GCTCAAGCATGTACACTAAGAGG + Intergenic
1075491576 10:122875817-122875839 GTTCAAGCATGTGCACTAAGAGG + Intronic
1078819357 11:14862067-14862089 GCTCAAGCATGTGCACTAAGAGG - Intronic
1079405944 11:20145845-20145867 GCTCAAGCATGTGCATTAAGAGG - Intergenic
1080794013 11:35546743-35546765 GCCCAACTATGAGCACTGATTGG - Intergenic
1081253918 11:40869538-40869560 GCTCAAGCACGTTCACTAAAAGG + Intronic
1085831505 11:79906077-79906099 ACTCAAGTGTGTGCACTAAAAGG + Intergenic
1085963936 11:81498085-81498107 GCTCAAGTATGTGCATTAAAAGG + Intergenic
1086390162 11:86355617-86355639 GCTCAAGTATGTGCACTGAGAGG + Intergenic
1086737066 11:90320058-90320080 GCTCAAGCATGTGCACTGAGAGG + Intergenic
1086974383 11:93115581-93115603 GCTCAAGCATGCGCACTAAGAGG - Intergenic
1089108393 11:116034725-116034747 GCTCAACTATTTCCACTTCAGGG - Intergenic
1089558595 11:119331115-119331137 GTTCAACTATGTGCCATACAGGG + Intergenic
1090190550 11:124763560-124763582 GCAAAACTATGTGCAGTAAATGG - Intergenic
1091196483 11:133735576-133735598 GCTCAAATATGTCCACCAAAAGG - Intergenic
1095289951 12:40466863-40466885 GGTGAACTATGTGTAATAAATGG - Intronic
1095334662 12:41010791-41010813 CCTCCAATATGTGCATTAAATGG + Intronic
1096145441 12:49275728-49275750 CCTCAACTATGTGCTCTGGATGG + Intergenic
1097493725 12:60301490-60301512 GCTCAAGCATGTGCATTAAGAGG + Intergenic
1098300924 12:69053523-69053545 GCTCAACTATATGCAGCACATGG + Intergenic
1098476939 12:70915994-70916016 GCAAAAATATGTGCCCTAAATGG + Intronic
1099437474 12:82660969-82660991 GCTCAAGCATGTGCAGTAAGAGG - Intergenic
1100027395 12:90147175-90147197 GCTCAAGCAGGTGCACTAAGAGG + Intergenic
1100758364 12:97777281-97777303 GCTCAAGCATGTACACTAAGAGG + Intergenic
1101516838 12:105444135-105444157 GCTCAAGCATGCGCACTAAGAGG + Intergenic
1107236705 13:38179064-38179086 GCTCAAGCATGTGCCCTAACAGG - Intergenic
1107763514 13:43708125-43708147 GCTCAAGCATGAGCACTAAAAGG + Intronic
1109821975 13:67668783-67668805 GATGAACTATGTGCTATAAATGG + Intergenic
1109866711 13:68273477-68273499 ACTCAAGCATGAGCACTAAAAGG - Intergenic
1109952175 13:69512874-69512896 GCTCACACATGTGCACTAAGAGG - Intergenic
1111122232 13:83868066-83868088 GCTCAAGCATGTACACTAAGAGG + Intergenic
1114878229 14:26750497-26750519 GCTCAAGCATGTGCACCAAGAGG + Intergenic
1115147143 14:30238994-30239016 GCTCAAGCATGTCCACTAAGAGG + Intergenic
1115336818 14:32250432-32250454 GCTCAAGCATTTGCACTAAGAGG - Intergenic
1116064902 14:39970395-39970417 GCTCAAACATGTGCACTAAATGG + Intergenic
1116173272 14:41430232-41430254 GCTCACACATGTGCACTAAGAGG + Intergenic
1116464151 14:45212638-45212660 GCTCAAGCATGTGCATTAAGAGG + Intronic
1116708534 14:48335179-48335201 GCTCAAGCATGCACACTAAAAGG + Intergenic
1117099762 14:52334267-52334289 GCTTAAGCATGTGCACTAAGAGG - Intergenic
1117528089 14:56631746-56631768 GCTCAAGCATGTGCACTAAGAGG - Intronic
1118560629 14:67077529-67077551 GCTCAAATATATTCTCTAAAGGG - Intronic
1119692549 14:76687825-76687847 GCTCAAGCATGTGCACTAAGAGG + Intergenic
1120902917 14:89591289-89591311 GCTAAACTTCGTGCACTGAATGG + Intronic
1121044241 14:90776349-90776371 GCTCAAGCATGCGCACTAAGGGG + Intronic
1121261875 14:92572365-92572387 GCTCAAGCATGAGCACTAAGAGG - Intronic
1121721561 14:96112469-96112491 GCTCAAGCATGCGCACTAAGAGG - Intergenic
1121815079 14:96923051-96923073 GCTCAAGCATGTGCACTAACAGG + Intronic
1123126229 14:105948046-105948068 GCTCAAGCATATGCACTAAGAGG - Intergenic
1123406738 15:20024100-20024122 GCTCAAGCATATGCACTAAGAGG - Intergenic
1123516067 15:21030748-21030770 GCTCAAGCATATGCACTAAGAGG - Intergenic
1123825133 15:24073609-24073631 ACTCAACCATGTGCATTAAGAGG - Intergenic
1125041097 15:35188240-35188262 GCTCACCTATGCACACTAAGAGG + Intergenic
1126312443 15:47333412-47333434 ACACAGCTATGTTCACTAAAGGG - Intronic
1128596649 15:68957829-68957851 GCTCAAGTATGTGCACTAAGAGG + Intronic
1128822330 15:70670166-70670188 GCTCAAGCATGCGCACTAAGAGG + Intronic
1128849884 15:70943698-70943720 GCTCAAGCATGTGCATTAAGAGG - Intronic
1129055830 15:72819594-72819616 GTTCAAGCATGTGCACTAAGAGG + Intergenic
1129068900 15:72934835-72934857 GCTCCACTGTGTGCACTATTAGG - Intergenic
1130660211 15:85825512-85825534 GCTCAAGTATGTACACTAAGGGG - Intergenic
1136651109 16:31672122-31672144 GCTAAGCTATGTGTACTCAAAGG - Intergenic
1137512707 16:49115366-49115388 GCTGACCTATGTGAACTACATGG - Intergenic
1138711016 16:58970399-58970421 GTTCAAGCATGTGCACTAAGAGG - Intergenic
1141251553 16:82363561-82363583 GCTCAAGCATGAGCACTAAGAGG - Intergenic
1145877748 17:28332361-28332383 GCTGAACTATGTGCTCTTCAGGG - Exonic
1146823376 17:36002299-36002321 GCTCAAGTATGTGCACTAAGAGG - Intergenic
1149258072 17:54849600-54849622 GCTCAAGCATGTGCATTAAGAGG + Intergenic
1149290797 17:55215831-55215853 GTTCAAGCATGTGCACTAAGAGG + Intergenic
1149304233 17:55333031-55333053 GCTCAAGCATGTGCGCTAAGAGG - Intergenic
1150907027 17:69348726-69348748 GCTCAAGCATGTGCACTAAGAGG + Intergenic
1151051158 17:70979769-70979791 GCTCAAGCATGTGCACTAAGAGG - Intergenic
1151864233 17:76789480-76789502 GTTCAAACATGTGCACTAAGAGG - Intergenic
1153101540 18:1476068-1476090 GCTCAAGCATGCGCACTAAGAGG - Intergenic
1153175503 18:2367735-2367757 GCTCCAGCATGTGTACTAAAAGG + Intergenic
1153746054 18:8180740-8180762 GCTCAAGCATGTGCACTAAGAGG - Intronic
1154040722 18:10853033-10853055 GCTCAAGCATGTGCAGTAAGAGG + Intronic
1154044720 18:10894141-10894163 GCTCAAGCATGTGCATTAAGAGG + Intronic
1154112920 18:11585784-11585806 GCTCAAGCATGCGCACTAAGAGG + Intergenic
1154276031 18:12961245-12961267 GCTCAAGCATGTGCACTAAGAGG - Intronic
1154917227 18:20747034-20747056 GCTCAACTCTGTGACTTAAAAGG - Intergenic
1154924976 18:20918766-20918788 GCTCAACTCTGTGACTTAAAAGG - Intergenic
1155749108 18:29398198-29398220 GCTCACATATGTGCACTAAAAGG + Intergenic
1156679984 18:39576594-39576616 GCTCAAGCATGTGCATTAAGAGG + Intergenic
1157083635 18:44554770-44554792 GATCAACTATGTGCATTCAGGGG - Intergenic
1157499001 18:48177101-48177123 TCTCAGCTCTGTGCCCTAAAGGG - Intronic
1159670739 18:71217745-71217767 GCTCCAGCATGTGCACTAAGAGG - Intergenic
1159864841 18:73691640-73691662 GCTTAAGCATGTGCACTAAGAGG + Intergenic
1159892777 18:73968311-73968333 GCTCAAACATGTGCACTAAGGGG - Intergenic
1162005211 19:7773954-7773976 GCTCAAGCATGTGCACCAAGAGG - Intergenic
1164863940 19:31588240-31588262 GCTCAAGCATGAGCACTAAGAGG - Intergenic
1165692462 19:37874235-37874257 GCTCAAGCATGTGCACTAAGAGG - Intergenic
1166418464 19:42613785-42613807 GCTCAAGCATGTGCATTAAGAGG + Intronic
1167302003 19:48683372-48683394 GCACAAGCATGTGCACTAAGAGG + Intergenic
925751571 2:7094473-7094495 GCTCAAGCATGTGCATTAAGAGG + Intergenic
926439671 2:12874805-12874827 GCTCAAGCATGCGCACTAAGAGG - Intergenic
926637301 2:15195756-15195778 GCTCAAGCATGTACACTAAGAGG + Intronic
926651619 2:15352762-15352784 GCTCAAGCATGTTCACTAAGAGG - Intronic
926686427 2:15701910-15701932 GCTGAAGCATGTGCACTAAGAGG - Intronic
928327269 2:30329366-30329388 ACTTCACTATGAGCACTAAAAGG - Intergenic
933064854 2:77780326-77780348 GCTCAAGCATGTGCATTAAGAGG - Intergenic
936710333 2:115123544-115123566 GCTCAAATATGTGCACCAAGAGG - Intronic
936746466 2:115582352-115582374 GCTCAAGCATGTGCAGTAACAGG - Intronic
936837748 2:116728168-116728190 GCTCAAGCATGTACACTAAGAGG + Intergenic
937556868 2:123168698-123168720 GCTCAAGCATATGCACTAAGAGG - Intergenic
937721263 2:125099710-125099732 GCTCACATTTGTGCACTAAGAGG + Intergenic
938117459 2:128611742-128611764 GCTCAGGTTTGTGCTCTAAAAGG - Intergenic
939131213 2:138237685-138237707 GCTCAACTATGCACACTAAGAGG + Intergenic
939195067 2:138961537-138961559 GCTCAAGCATGTGCACTAAGAGG - Intergenic
939755612 2:146105525-146105547 GCTCAAGTATGTGCACTAAGAGG - Intergenic
939867647 2:147491787-147491809 GCAACACTATGTGCACTATATGG + Intergenic
940569276 2:155409695-155409717 GGTCTGCTATGTGCACTAATGGG + Intergenic
943345410 2:186732851-186732873 GCCCAAGCATGTGCACTAAAAGG - Intronic
945342557 2:208674338-208674360 GCTCAAGCATGTGCATTAAGAGG - Intronic
945392005 2:209275914-209275936 GCTCAAGCATGTGCACTAAGAGG + Intergenic
945543956 2:211125474-211125496 GTTCACCTAGGTGTACTAAAAGG - Intergenic
945838234 2:214857701-214857723 GCTCAAGCATGTGCACCAAGAGG + Intergenic
946722806 2:222628698-222628720 GCTACACTATGTGCATTACATGG - Intronic
946952104 2:224887345-224887367 CCTCAAAAATGTGCACCAAAGGG + Intronic
947001996 2:225467242-225467264 GCTCACACATGTGCACTAAGAGG - Intronic
947219800 2:227781342-227781364 GCTCAAGCATGCGCACTAAGAGG + Intergenic
947401263 2:229733614-229733636 GCTCAAGTATGTTCACTAAGAGG - Intergenic
948230671 2:236346856-236346878 GTTCAACCATGTGCATTAAGAGG + Intronic
1172185937 20:33031140-33031162 GCTCAACTCTGAGCCCTGAAAGG - Intergenic
1172797811 20:37554787-37554809 GCTCAAGCATACGCACTAAAAGG + Intergenic
1175587015 20:60149134-60149156 GCCCAAGTATGTGCACTAAATGG + Intergenic
1175673476 20:60926874-60926896 CCACAACTATGTTCTCTAAAGGG - Intergenic
1176291287 21:5046272-5046294 GCTCAAGCATGTGTATTAAAAGG - Intergenic
1177609160 21:23423384-23423406 GCTCAAGCATGCGCACTAAGGGG + Intergenic
1177966071 21:27727313-27727335 GCTCAAATATGCACACTAAGAGG - Intergenic
1178837505 21:36111283-36111305 GCTCAATCATGTGCATTAAGAGG + Intergenic
1179010001 21:37549179-37549201 GCTCAGGCATGTGCACTAAGAGG - Intergenic
1179235074 21:39538645-39538667 GCTCAAGCATGCGCACTAGAAGG - Intergenic
1179775432 21:43658973-43658995 GCTCAACGAGGTGTGCTAAATGG + Intronic
1179865968 21:44217369-44217391 GCTCAAGCATGTGTATTAAAAGG + Intergenic
1182739868 22:32559918-32559940 GCTCAAGCCTGTGCACTAAGAGG + Intronic
949591963 3:5504058-5504080 GCTCAAGCATGTGCACTAAGAGG + Intergenic
950628115 3:14263362-14263384 GCTCAAGCATGTGCATTAAGAGG - Intergenic
950869543 3:16216828-16216850 GCTCAAGCATGTGCACTAAGAGG - Intronic
951756989 3:26101852-26101874 GCTCAAGCATGTGCACTAACGGG - Intergenic
953194497 3:40719840-40719862 GCTCAAGCATGCGCACTAAGAGG + Intergenic
953259239 3:41321686-41321708 GCTCAAGCATGTGCACTAAGAGG + Intronic
953590278 3:44245291-44245313 CCCCAACAATCTGCACTAAAAGG - Intronic
953745707 3:45572418-45572440 GCTCAAGCATGTGCACTAATAGG + Intronic
954098520 3:48351110-48351132 GCTGAACTATGTGCAATAAATGG - Intergenic
954326201 3:49865565-49865587 GCTCAACTGTGTCCACTCAATGG + Intronic
955293345 3:57713101-57713123 CCTCAAGCATGTGCACTAAGAGG - Intergenic
955608422 3:60731658-60731680 GATCAAGTATGTGCACTAAGAGG - Intronic
955825287 3:62939694-62939716 GCCCAAGCATGTGCACTAAGAGG + Intergenic
956552468 3:70477037-70477059 GCTCAAGCATGTGCACTAGGAGG + Intergenic
957222554 3:77402567-77402589 GCTCAACTATGTGCACTAAAAGG + Intronic
957289336 3:78258188-78258210 GCTCAACTATTCCAACTAAAAGG - Intergenic
957315413 3:78570035-78570057 GCTCAAGCATGCGCACTAAGAGG - Intergenic
957605017 3:82387294-82387316 AATGAGCTATGTGCACTAAATGG - Intergenic
957610848 3:82463335-82463357 GCTCAAGCATGTGCATTAAGTGG - Intergenic
957755477 3:84479663-84479685 GCCCAACTATGCTCTCTAAAAGG + Intergenic
958929861 3:100197493-100197515 GCTCAAGCATGGGCACTAAGAGG - Intergenic
959401267 3:105904892-105904914 GCTCAAGCATGTGCACTAAGAGG + Intergenic
959585621 3:108022549-108022571 GCTCAAGCATGTGCACTAAGAGG - Intergenic
959878244 3:111412358-111412380 GCTAAGCTATGTGGACTCAAAGG + Intronic
960481557 3:118197586-118197608 GCTCAAGCATGTGCACTAAGAGG + Intergenic
961394048 3:126573782-126573804 GTTCAAGCATGTGCACTAAGAGG - Intronic
961411998 3:126729357-126729379 GTTCAACAATGTGCACTCCAAGG + Intronic
961480955 3:127180421-127180443 GCTCAAGCATGTGCACTAAGAGG + Intergenic
962209310 3:133463641-133463663 GCTCAAGCATGCACACTAAAAGG - Intronic
962388734 3:134954146-134954168 GCTGAACTCTGTGCCCTGAAAGG + Intronic
963023643 3:140897500-140897522 GCTCAAGCACGTGCACTAAGAGG - Intergenic
965737043 3:171831745-171831767 ACTCAACTATATGCACTTTAAGG - Intergenic
965867678 3:173225356-173225378 GCTCAAGCATGTTCACTAAGAGG - Intergenic
965945427 3:174234517-174234539 GCTCAAGCATGTGCATTAAGAGG - Intronic
966536228 3:181037357-181037379 GGTCTACTATGTGCACTTATAGG - Intergenic
967120827 3:186381340-186381362 GCTCAAGCATGTACACTAAGAGG + Intergenic
967452695 3:189644729-189644751 GCTAAGCTATGTGGACTCAAAGG - Intronic
967461933 3:189757938-189757960 GCTCAAGCATGTGTACTAAGGGG + Intronic
967961503 3:194928898-194928920 GCTCAAGCATGCGCACTAAGAGG + Intergenic
967994177 3:195154304-195154326 GCTCAAGCATGTGCACTAGGAGG + Intronic
969947455 4:10799105-10799127 GCTCATGCATGTGCACTAAGAGG - Intergenic
971955781 4:33416562-33416584 GCTCACATATGTGCCCTAAGAGG + Intergenic
974039185 4:56843334-56843356 GCTCAAGCGTGTGCACTAAGAGG + Intergenic
974166973 4:58215864-58215886 GCTCAAGCATGTGCACTAAGAGG - Intergenic
974170806 4:58264793-58264815 GCTCAAGTATGTGCACTAAGAGG + Intergenic
974746849 4:66088425-66088447 GCATAACTAGGTGCACTACATGG + Intergenic
974882317 4:67774848-67774870 GCTCAAGCATGAGCACTAAGAGG + Intergenic
977582971 4:98745171-98745193 ACTCAAGCATGTGCCCTAAAAGG - Intergenic
977622494 4:99153354-99153376 GCTAAACTATGAGGACTCAAAGG - Intronic
977867722 4:102049811-102049833 GCGCAAGCATGTGCACTAAGAGG + Intronic
979038711 4:115759302-115759324 GCTCAAGCATGTGCACTAAGAGG + Intergenic
979065251 4:116123263-116123285 GCTCAAGCATGTGCACTAAGAGG - Intergenic
979695006 4:123603147-123603169 GCTCAAGCATATGCACTAAGAGG + Intergenic
980116642 4:128685838-128685860 GCTCACCTATGTACACTAAGAGG - Intergenic
980259689 4:130432596-130432618 GATCAAGCATGTGCACTAAGAGG + Intergenic
980571622 4:134627364-134627386 GCTCAAGCATGTGCATTAAGAGG - Intergenic
980798364 4:137714709-137714731 GCTCACACATGTGCACTAAGAGG + Intergenic
981450043 4:144886216-144886238 GCTCAAGCATGTGAACTAAGAGG + Intergenic
981928747 4:150167806-150167828 GCTCAAGCATGTGCACTAAGAGG + Intronic
982103797 4:151993997-151994019 TCTCAAGCATGTGCACTAAGAGG - Intergenic
983847856 4:172541842-172541864 GCTCAAGCATGTGCACTAAAAGG - Intronic
983904961 4:173172403-173172425 GCTCCAGCATGTGCACTAATAGG - Intronic
984351458 4:178600179-178600201 TCTCAAGTATGTGCATTAAGAGG - Intergenic
984436519 4:179717311-179717333 GCTCAGATATGCACACTAAAAGG + Intergenic
986538033 5:8813146-8813168 GCTCAAGCATGTGCACTAAGAGG + Intergenic
987681798 5:21145463-21145485 GCTCAAGCATGTGCATTAAGAGG + Intergenic
987838976 5:23198297-23198319 GCTCAAACATGAGCACTAAGAGG - Intergenic
988650217 5:33140789-33140811 GCTCAACCATGCTCACTAAAAGG - Intergenic
988737674 5:34039033-34039055 GCTCAAGCATGTGCATTAAGAGG + Intronic
988882159 5:35515525-35515547 GCTCAAACATGTGCATTAAGAGG + Intergenic
990213171 5:53502454-53502476 GCTCAAGCATGTGCATTCAAAGG - Intergenic
990594154 5:57296257-57296279 GCTCAAGCATGTGCACTAAGAGG + Intergenic
991145515 5:63298169-63298191 ACTAAAGTATGTGCACTGAAAGG - Intergenic
991482147 5:67092116-67092138 GCTCAGCAATGTGCACCAAATGG - Intronic
993318946 5:86447956-86447978 GTTCAACAATGAACACTAAATGG + Intergenic
994196533 5:96928900-96928922 GCTCAAGCATGTGCACTAAGAGG + Intronic
994281395 5:97907782-97907804 GCTTAAGCATGTGCACTAAGAGG + Intergenic
995331006 5:110945927-110945949 CCTCAAGAATGAGCACTAAAAGG + Intergenic
995556034 5:113329804-113329826 GCTGATCTATATACACTAAAGGG - Intronic
995918175 5:117276491-117276513 GCTCAGGCATGTGCACTAAGAGG + Intergenic
996280930 5:121728322-121728344 GCTCAAGCATGTGCACTATGAGG + Intergenic
997065727 5:130556451-130556473 GCTCAAGCATGTGCACTAAGAGG + Intergenic
999376896 5:151093059-151093081 GCACAGCTGTGTGCACAAAAGGG + Intronic
1000089624 5:157919037-157919059 GCTCAAATATGTGCACTAAGAGG - Intergenic
1000286226 5:159828279-159828301 GTTCTCCAATGTGCACTAAAGGG - Intergenic
1003204297 6:3993013-3993035 GCTCAAGCATGTGCACTCAAAGG - Intergenic
1003783913 6:9461511-9461533 GCTCAAGCATGTTCACTAAGAGG - Intergenic
1004271070 6:14195970-14195992 GCTCAAGCATGTGCATTAAGAGG + Intergenic
1005158270 6:22833509-22833531 GCTCAAGCATGTGCACTAAGAGG + Intergenic
1005621389 6:27623794-27623816 GGTCAAGCATGTGCACTAAGAGG - Intergenic
1007411968 6:41669515-41669537 ACTTAAATATGTGCAATAAATGG + Intergenic
1008290537 6:49710209-49710231 GCTCAATTATGTGCAAAAAAGGG + Intronic
1008748699 6:54706253-54706275 ACTCAACTATGTTGACTTAAAGG + Intergenic
1009746275 6:67820780-67820802 GCTCAAACATGTGAACTAAGAGG - Intergenic
1011478729 6:87773282-87773304 GCTCAAGCATGCGCACTAAGGGG + Intergenic
1011594969 6:89007547-89007569 GCTCAAGCATGCGCACTAAAAGG + Intergenic
1014555123 6:122836498-122836520 GCTCACACATGTGCACTAAGAGG + Intergenic
1014768433 6:125434104-125434126 GCTCAGGCATGTGCACTAAGGGG - Intergenic
1016193999 6:141309296-141309318 ACTCAAGCATGTGCACTAAGAGG - Intergenic
1016235405 6:141857786-141857808 GCTCAAGCATGTGCATTAAAAGG - Intergenic
1017422776 6:154290152-154290174 GCCCAAGTATGTGTACTAAAGGG + Intronic
1017426926 6:154331658-154331680 GCTCAAGCATGTGCACTAAGAGG + Intronic
1018171109 6:161143711-161143733 GCTAAACTAGGTCCACTCAAAGG + Intronic
1018664823 6:166125965-166125987 GCTCAAGCATGTGCACTAAGAGG - Intergenic
1021598170 7:22339031-22339053 GCTCAAGCATGCGCACTAAGAGG + Intronic
1023190018 7:37570364-37570386 GCTCAAGCATGCGCACTAAGAGG - Intergenic
1024016803 7:45324734-45324756 GCTCATGCATGTGCACTAAGAGG + Intergenic
1024193986 7:47040856-47040878 GCTCAAGCATGTGCATTAAGAGG + Intergenic
1026156047 7:67826732-67826754 GCTCAAGCATGTGCACTCAGAGG + Intergenic
1026463627 7:70635393-70635415 GCTAACCTATCTCCACTAAAAGG - Intronic
1026626847 7:72001331-72001353 GCTCGTGTATGTGCACTAAGTGG + Intronic
1026741100 7:72979110-72979132 GCTCAAGCATGTGCACTAAGAGG + Intergenic
1026800929 7:73399424-73399446 GCTCAAGCATGTGCACTAAGAGG + Intergenic
1027102634 7:75385968-75385990 GCTCAAGCATGTGCACTAAGAGG - Intergenic
1027617547 7:80442534-80442556 GTTCAACTGTGTGGGCTAAATGG + Intronic
1028870295 7:95764222-95764244 GCTAAACTATGGGTACTCAAAGG + Intergenic
1029499260 7:100917819-100917841 GCTCAAGCATGTGCACTAAGAGG + Intergenic
1030414842 7:109230073-109230095 GCTCAAGCATGTGCACTAAGAGG - Intergenic
1030515509 7:110533435-110533457 GCTCAAGCATGTGCATTAAGAGG + Intergenic
1033095285 7:138425190-138425212 GCTCAAGCATGAGCACTAAGAGG - Intergenic
1033223474 7:139543747-139543769 GCTCAACTCTGCGCACTGCAGGG + Intronic
1034685578 7:152967976-152967998 GCTCAAGCATATGCATTAAAAGG + Intergenic
1034731343 7:153390027-153390049 GCTCAAGCATGTGCACTAAGAGG + Intergenic
1035157765 7:156928264-156928286 GCTCAAGTATGTGCACTAAGAGG + Intergenic
1035687417 8:1535760-1535782 GCTCAACAATGTGTCCTAAGTGG - Intronic
1037135382 8:15453946-15453968 GCTCAAGCATGTACACTAAGAGG + Intronic
1037225477 8:16584456-16584478 GCTCAATTAAGTGCAATACAGGG - Intergenic
1038869845 8:31481965-31481987 GCTCAAGCATGAGCACTAAGAGG - Intergenic
1038874643 8:31534799-31534821 GCTCAAGCATGTACACTAAAAGG - Intergenic
1039096952 8:33896668-33896690 GCTCACACATGTGCATTAAAAGG + Intergenic
1039729149 8:40255816-40255838 GCTCAAGGATGTGCGCTAAGAGG - Intergenic
1039879649 8:41616766-41616788 GCTCTACTCTGTGGACTAAATGG - Intronic
1040482468 8:47838819-47838841 TCTCAACTATGTGTGTTAAATGG + Intronic
1041810499 8:61903140-61903162 GCTCAAGCATGTGCACTAAGAGG - Intergenic
1042397347 8:68307633-68307655 GCTCAAGCATGCGCACTAAGAGG - Intronic
1043885111 8:85590008-85590030 GCTCAAGTATGTGCATTAAAAGG + Intergenic
1044139910 8:88637537-88637559 GCTCAAGCATCTGCACTAAGAGG + Intergenic
1046463564 8:114572527-114572549 GCTCAAGCATGCGCACTAACAGG + Intergenic
1047901352 8:129425563-129425585 GCTAAACTATGAGGACTCAAAGG - Intergenic
1048473957 8:134726504-134726526 GCTCAAGCATGTGCACTAAGAGG - Intergenic
1049933126 9:475149-475171 GCTCAAGCATGTGCACTAAGAGG + Intronic
1050135105 9:2454517-2454539 GCTAAACTATGAGGACTCAAAGG - Intergenic
1051179067 9:14391534-14391556 GCTCAAGCATGTGCACTAAGAGG + Intronic
1051598830 9:18851850-18851872 GCTCAACCATGTACACTAAGAGG - Intronic
1051788217 9:20770205-20770227 GTTCAACACTGTGCTCTAAAAGG - Exonic
1051889990 9:21931548-21931570 GCTCAAACATGGGCACTAAGAGG + Intronic
1053451207 9:38195654-38195676 GCTCAAGCATGTGAACTAAGAGG + Intergenic
1055464128 9:76547017-76547039 GCTCAAACATGAGCACTAAGCGG - Intergenic
1055998803 9:82192630-82192652 GCTCAAACATGCGCACTAAGAGG - Intergenic
1057333110 9:94134530-94134552 GCTCAAGCATGTGCACTAAGAGG + Intergenic
1059901393 9:118930349-118930371 GCTCAAGCATGTGCATTAAGAGG + Intergenic
1060874913 9:127075940-127075962 GCTCTACAATTTGCATTAAAAGG - Intronic
1185676749 X:1855628-1855650 GCAGAACTATGAGCAATAAATGG - Intergenic
1186035785 X:5421979-5422001 GCTCAAGCATGTGCACTAAAAGG - Intergenic
1186538505 X:10374463-10374485 GTTCAATAATGTGGACTAAATGG + Intergenic
1188898655 X:35700558-35700580 GCTCCAGCATGTGCACTAAGAGG - Intergenic
1188905770 X:35789429-35789451 GCTTAAGCATGTGCACTAAGAGG - Intergenic
1189753469 X:44247080-44247102 GCCCAACTGTGTCCACTGAAGGG + Intronic
1189986062 X:46554291-46554313 GCTCAAGTATGTGCACTAAGAGG - Intergenic
1190075200 X:47312025-47312047 GCTCAATCATGCGCACTAAGAGG - Intergenic
1191739736 X:64423982-64424004 GCTCAAGCATGTGCACTAAGAGG + Intergenic
1191884602 X:65875501-65875523 GCTCAAGCATGTGCATTAAGAGG - Intergenic
1193732415 X:85116910-85116932 GCTCAAGCATGTGCACTAAGAGG + Intergenic
1193786349 X:85763974-85763996 GCTTAACTCTATGGACTAAAAGG - Intergenic
1195325809 X:103757494-103757516 GTTCAAGCATGTGCACTAAGAGG - Intergenic
1198393620 X:136201495-136201517 GCTCAAGCATGTGCACTAAGAGG - Intronic
1198823490 X:140674185-140674207 GCTCAAGCATGTGCACTAAGAGG + Intergenic
1200492938 Y:3850711-3850733 GCTTAAGCATGTGCACTAAGAGG - Intergenic