ID: 957223343

View in Genome Browser
Species Human (GRCh38)
Location 3:77412455-77412477
Sequence CAGTAGATCTTGAGGACAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 167}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957223343 Original CRISPR CAGTAGATCTTGAGGACAGA GGG (reversed) Intronic
902744000 1:18460973-18460995 CAGTAGATGAAGAAGACAGAAGG - Intergenic
903638475 1:24838183-24838205 GTTTAGATCTTGGGGACAGAGGG - Intronic
907009544 1:50950770-50950792 TAGTAGATCTTCAGGAAGGAAGG - Intronic
909995175 1:82270172-82270194 TAGAAGATATTGAGCACAGAAGG - Intergenic
910928864 1:92422763-92422785 CAGCAGATCACGAGGTCAGATGG + Intergenic
912179229 1:107197635-107197657 CAGTGGAGCCTGAAGACAGAGGG - Intronic
919729680 1:200905201-200905223 CAGTAGATTTCTAGGACATACGG - Intronic
919970274 1:202572212-202572234 CAGTAGAGCTTGGGGCCAGTTGG + Intronic
920819712 1:209369025-209369047 GAGTAGTTCTAGAGTACAGATGG - Intergenic
1064001501 10:11667302-11667324 GAGTAGCTCTCTAGGACAGATGG - Intergenic
1066408706 10:35144785-35144807 CAGTATACTTTAAGGACAGAGGG - Intronic
1067266310 10:44748398-44748420 CAGTAGATAGAGAGGAGAGATGG - Intergenic
1068246484 10:54377796-54377818 CAGTCTTTCTTGAGTACAGAGGG - Intronic
1070817938 10:79336877-79336899 CAGGAGTTCTTGAGCACAGGTGG - Intergenic
1070983648 10:80669761-80669783 CATCAGGCCTTGAGGACAGAGGG + Intergenic
1073677103 10:105660824-105660846 CAGTAGTTCTTGAGCTTAGAGGG + Intergenic
1073942979 10:108719226-108719248 CCCTGGATCATGAGGACAGAGGG - Intergenic
1076828997 10:132985014-132985036 CAGCAGATCCTGAGAACTGACGG + Intergenic
1078022497 11:7667474-7667496 CAGTACATCTTAAGGAAAAAAGG + Intronic
1079265861 11:18932190-18932212 CAATGGATCTGGAGGACTGAGGG + Intergenic
1084088775 11:66866744-66866766 CAGCAGATCTCTAGGTCAGAGGG + Intronic
1085327439 11:75617857-75617879 CAGTTGAGATTGAGGAGAGAAGG + Intronic
1086094167 11:83033976-83033998 GACTTGCTCTTGAGGACAGATGG - Intronic
1086356790 11:86009367-86009389 CAGCAGATCTGGAGTACAGAAGG + Intronic
1088549854 11:111001666-111001688 CAGTAGAGCTGGAGAAGAGAAGG + Intergenic
1089536530 11:119163698-119163720 CAGAAGTTCTTGAGGACTGGGGG + Intergenic
1097232165 12:57519641-57519663 CAGTAGAGCCTCAGGTCAGAAGG + Intronic
1099816605 12:87656821-87656843 CGGTACAAATTGAGGACAGAAGG + Intergenic
1100660064 12:96687066-96687088 CTGTTGGTCTTGAAGACAGAAGG - Intronic
1103015065 12:117487837-117487859 CAGAAGCTCTTGAGGTCATACGG - Intronic
1104038246 12:125113393-125113415 TACAAGATCCTGAGGACAGACGG - Intronic
1110136265 13:72071048-72071070 CAGAAGAGCTGGAGGATAGAAGG - Intergenic
1114029298 14:18561922-18561944 TGGTAGATCTTGAGCACTGAAGG + Intergenic
1115352801 14:32413650-32413672 CATAATGTCTTGAGGACAGAAGG + Intronic
1115503459 14:34070420-34070442 CAGCAGATCTTGGAGACTGAAGG + Intronic
1116718702 14:48463921-48463943 GAGTAGATTTTAAGGTCAGAGGG - Intergenic
1118964440 14:70567058-70567080 CCCTAGGTCATGAGGACAGAGGG - Intergenic
1119872418 14:78028935-78028957 AAGTATAGCTGGAGGACAGAAGG + Intergenic
1120270378 14:82306366-82306388 CAGATGATCCTGAGGAAAGATGG - Intergenic
1120330740 14:83090322-83090344 CAGCAGGTCTAAAGGACAGAGGG + Intergenic
1120739922 14:88096788-88096810 TAGTAGAACTTCAGGCCAGATGG - Intergenic
1121362235 14:93272144-93272166 GAGTAGATTTTTAGTACAGATGG - Intronic
1121439621 14:93940470-93940492 CACGAGATCCTGAGGACAAAAGG + Intronic
1122720520 14:103719496-103719518 CAGTTGATCATGAGGAGAAATGG + Intronic
1127205689 15:56715772-56715794 CAGAAGATCTACATGACAGAAGG + Intronic
1128460026 15:67859930-67859952 CAGAAGGGCTTGAGCACAGAGGG + Intergenic
1131167689 15:90154351-90154373 CAGTGTAGCTTGAGGGCAGATGG - Intergenic
1131374093 15:91909401-91909423 CAGTAGATATTTAGGCCATATGG - Intronic
1132025525 15:98401605-98401627 CAGTTGATCTTAAGAACAGGAGG + Intergenic
1132782702 16:1636850-1636872 CAGTGGCTCTTGAGGAAAGAGGG + Intronic
1134780715 16:16892728-16892750 CAGAACATGTTAAGGACAGAAGG - Intergenic
1138165779 16:54800479-54800501 AGTTAGATGTTGAGGACAGAGGG + Intergenic
1143621273 17:8081377-8081399 CAGTAGAGCAAGAGGAAAGAGGG - Exonic
1144470756 17:15538976-15538998 CAATAAATTTTGAGTACAGAGGG + Intronic
1147687451 17:42295178-42295200 CAGTAGATCCTAGGGACATAGGG - Intronic
1154495918 18:14960941-14960963 CAGCAGATCTTGCCAACAGAAGG - Intergenic
1158736772 18:60091311-60091333 CTCTAGATCTTGAGCCCAGAGGG - Intergenic
1159550574 18:69891846-69891868 CATTAGTTCTTGAGCAAAGATGG - Intronic
1162849719 19:13421584-13421606 GATTAGATCATGAAGACAGAGGG + Intronic
1163033442 19:14558866-14558888 CAGGGGATCCTGAGCACAGACGG - Intronic
1166197011 19:41213644-41213666 CAGGAGATCCTGGGAACAGAAGG - Intergenic
1166368585 19:42289593-42289615 CAGGAAATCTGGAGGACAGGGGG + Intronic
926732901 2:16050616-16050638 CAGCAGATCTTCAGGGCAGGGGG - Intergenic
927619189 2:24634556-24634578 AAGTAGATAATGAAGACAGAAGG + Intronic
928804805 2:35138110-35138132 CAGCAGATCTTAATGACAAAAGG - Intergenic
929928910 2:46237094-46237116 CATGAAATCATGAGGACAGAGGG - Intergenic
931034744 2:58227433-58227455 CAGTAGATGTGGGAGACAGAAGG + Intronic
931523812 2:63129940-63129962 CTGTACATGTTTAGGACAGATGG + Intronic
931861993 2:66364915-66364937 CTGGAGCTCTTGAGGACAGCTGG - Intergenic
935663045 2:105486369-105486391 CAGTTGATTTTGAGAAGAGAAGG + Intergenic
936170291 2:110165301-110165323 CAGAAAATCTTGAGCATAGATGG + Intronic
938068666 2:128295123-128295145 CAGTAGCCCTTCAGGACAGAGGG - Intronic
939093804 2:137809401-137809423 CAGTTGCTTTTGAGGACTGATGG + Intergenic
939635592 2:144578657-144578679 CAGTAGGTCATGAATACAGATGG + Intergenic
939987729 2:148848168-148848190 CAGAAACTCTGGAGGACAGAAGG - Intergenic
940771587 2:157844698-157844720 CAGCAGCTCTTGAGGTCAAAAGG - Intronic
942312943 2:174672199-174672221 TAATAGATGGTGAGGACAGATGG + Intronic
943444492 2:187967303-187967325 CAGTAGATGGTGAGGTGAGAGGG - Intergenic
943778311 2:191792638-191792660 AAGTACATCTTCAGGAAAGAGGG - Intergenic
945437144 2:209832134-209832156 CAGTAGACTTTGAGGACTCAGGG + Intronic
946035366 2:216737951-216737973 TAGTACATCTTGAGAACAGAAGG - Intergenic
946053295 2:216881273-216881295 CAGGACACCTGGAGGACAGAGGG + Intergenic
946174702 2:217915429-217915451 CAGTGCTTCTTGAAGACAGACGG - Intronic
947946638 2:234109344-234109366 CGGGAGATTTTGAGGGCAGAGGG + Intergenic
948207493 2:236169932-236169954 CAGCAGACCTGGAGGAAAGAGGG + Intergenic
1170513622 20:17105213-17105235 CAGCAGATCTTCAGGAGACAGGG - Intergenic
1172839038 20:37891007-37891029 CAGTAGATCATGAATACAGGGGG + Intergenic
1173069328 20:39746624-39746646 CAGTAAATCTAGAGATCAGAAGG + Intergenic
1173300154 20:41795126-41795148 CAGTAGACCTTGAGTAAAGCAGG - Intergenic
1175444512 20:59010752-59010774 CAGTGGTGCTTGAGGGCAGAGGG + Intergenic
1177057059 21:16319232-16319254 CAGTAGACACTGAGGCCAGAGGG + Intergenic
1177759218 21:25383853-25383875 CTTGAGACCTTGAGGACAGAAGG + Intergenic
1177772139 21:25529008-25529030 GAGCAGATTTTGAGGACAGAAGG + Intergenic
1180453413 22:15488985-15489007 TGGTAGATCTTGAGCACTGAAGG + Intergenic
1181638886 22:24186722-24186744 CAGTGGCTTTTGAGGACTGAGGG - Intronic
1185122519 22:48980897-48980919 CAGCAGATCTGGAGGAAATATGG - Intergenic
949825292 3:8158486-8158508 CAGTAGCTCTTGAATACAAAGGG + Intergenic
951401030 3:22231641-22231663 CAGTAGGTATGGAAGACAGAAGG - Intronic
952701804 3:36336384-36336406 CAGTATTTCTTCAGGTCAGAAGG - Intergenic
952989644 3:38820700-38820722 CAGTAGATCATTGGGAAAGAAGG - Intergenic
953912786 3:46901306-46901328 CATTAGCTGTTGAGGACACAGGG - Intronic
957223343 3:77412455-77412477 CAGTAGATCTTGAGGACAGAGGG - Intronic
961141631 3:124561313-124561335 CAGGAAATCTGCAGGACAGAAGG - Intronic
962036898 3:131661665-131661687 CAGCAGCTCTTGAGTCCAGAAGG + Intronic
962943456 3:140146498-140146520 GAGTAGGCTTTGAGGACAGAAGG - Intronic
963754125 3:149215662-149215684 CAGCACAGCTTGAGGACAAAGGG + Intronic
965122668 3:164582776-164582798 CAGGATTTCTTGAGGCCAGAAGG + Intergenic
967138661 3:186533982-186534004 AAGTAGTTCTTCAGGACTGAGGG + Intergenic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
967397518 3:189024177-189024199 CAGTAGAACATGGGGAGAGATGG + Intronic
967948586 3:194823303-194823325 CAGTTGATTTTGATGAGAGAAGG + Intergenic
968689939 4:1985162-1985184 CAGCCCATCTTGAGCACAGAAGG + Intronic
969914077 4:10472812-10472834 GAGTAGATCTAGAGTACATATGG - Intergenic
974894592 4:67924027-67924049 AAGAAAATCTGGAGGACAGATGG + Intronic
975191782 4:71472269-71472291 CAGTAGACCGTGATGACATAGGG + Intronic
975351255 4:73349899-73349921 GAGTGGATGTTGAGGGCAGAGGG + Intergenic
975542265 4:75526174-75526196 CAGCAGCTATTGTGGACAGATGG - Intronic
975874014 4:78814173-78814195 GAGTAATTCTTGAGGACAGAGGG - Intronic
978769272 4:112437010-112437032 CAGTGAATCCTAAGGACAGAAGG + Intronic
980139985 4:128903495-128903517 CAGTAAATCTTGAGCAAATAAGG - Intronic
980163968 4:129201612-129201634 CAATAGATTTTGAAGACAGTTGG + Intergenic
986358296 5:6950240-6950262 CCGTACATCTTGAGGAAAGAAGG + Intergenic
988280536 5:29140493-29140515 CAGAATATCTTGAGAACAGCAGG + Intergenic
990997403 5:61746171-61746193 CAGCACATCTTGGGCACAGAGGG + Intronic
991010759 5:61880797-61880819 CAAAAGATCTTGAGGGCAAAGGG + Intergenic
991162034 5:63514593-63514615 CAGGAGATGGGGAGGACAGAGGG - Intergenic
991284694 5:64959482-64959504 CAGTAGCTCCTCAGGAGAGATGG + Intronic
993131095 5:83899270-83899292 CAGTAGAGCTTGATTACAAAGGG + Intergenic
993809984 5:92464159-92464181 CAGGAGATCTAGAGGAAAGGAGG + Intergenic
996201244 5:120677170-120677192 CAGTAGATCATTAGGATAGGTGG + Intronic
999178681 5:149652905-149652927 AAGTAGGTCTTGTGGAAAGAGGG - Intergenic
1000448815 5:161358817-161358839 AAGTAGTTGTTAAGGACAGAGGG + Intronic
1000533535 5:162453231-162453253 CTGGAGATCTGGAGGGCAGAGGG - Intergenic
1004028567 6:11843377-11843399 GTGAAGATCTTGGGGACAGATGG - Intergenic
1004406538 6:15338476-15338498 CTGTAGACATTGAGGACAGATGG + Intronic
1004866516 6:19858224-19858246 CAGGAGATCCTGAAGACTGAAGG - Intergenic
1008089914 6:47283568-47283590 TAGTTGTTTTTGAGGACAGATGG - Intronic
1008354336 6:50533594-50533616 CTTTAGATCTTGAGGATATAAGG + Intergenic
1009483766 6:64194096-64194118 CGGCAGATCATGAGGTCAGAAGG - Intronic
1009860103 6:69317704-69317726 CAGAAGATTCTGAGGAAAGAAGG - Intronic
1014183905 6:118413545-118413567 TAGTATAGCTTGAGGTCAGATGG - Intergenic
1015006487 6:128287796-128287818 CAGAAGAAATTGATGACAGACGG - Intronic
1016504047 6:144757459-144757481 GAGTAGCTATTGAGTACAGATGG - Intronic
1016932551 6:149425279-149425301 CAGCAGAGATTGAGTACAGAAGG + Intergenic
1021992953 7:26154227-26154249 CAGTATATCCTGAACACAGAAGG - Intronic
1022528213 7:31051960-31051982 CAGGAAATCTTGAGGACCTAGGG + Intergenic
1024681351 7:51692985-51693007 CAGTAAATATTGTGGATAGATGG - Intergenic
1026529263 7:71183293-71183315 GTGTAGCTCTTGAAGACAGAAGG + Intronic
1031726143 7:125241903-125241925 CAGTAGATCTTGTGAGCAAAAGG - Intergenic
1034450504 7:151134769-151134791 CAGTTGATCTGGATGTCAGATGG + Intronic
1035477521 7:159153691-159153713 CTGTAGCTCTGGAGAACAGAAGG + Intergenic
1035735867 8:1887314-1887336 CAGGAGACCTTGAGGACACATGG + Intronic
1035982472 8:4388530-4388552 CAGTGGATTTTGGGGACTGAGGG + Intronic
1036018995 8:4820935-4820957 AAGTAAAGCTTGAGGAAAGATGG - Intronic
1036917045 8:12814243-12814265 CAGCAGAACTTGAGGGCTGAAGG - Intergenic
1038052932 8:23830394-23830416 CAATAGATTTTGGGGACTGAGGG - Intergenic
1038496335 8:28006051-28006073 CAGTAGAAGTTCAGCACAGAGGG + Intergenic
1039513513 8:38111155-38111177 CAGTGGATCATGAGGTCAGTTGG - Intronic
1041108248 8:54461711-54461733 CAGTAGATAAAGTGGACAGAAGG + Intergenic
1042741150 8:72048346-72048368 CTGTAGAACTTGAGGGTAGAGGG + Intronic
1047472448 8:125190391-125190413 CAGTAGAACCAGAAGACAGACGG + Intronic
1047507476 8:125491314-125491336 CAGAAGATGCTGAGGACAGTTGG - Intergenic
1049802442 8:144524291-144524313 CAGCAGATCGTGAGGAAAAAGGG + Exonic
1053016530 9:34665365-34665387 CAGTAGATCCTGCAGAGAGAGGG + Exonic
1053429971 9:38035619-38035641 GGGTAGGTCTTGGGGACAGAAGG + Intronic
1055423764 9:76171594-76171616 CAGAACTTCTTGAGGGCAGAGGG - Intronic
1055431186 9:76245932-76245954 CAGGAAATTATGAGGACAGAGGG + Intronic
1056438267 9:86594718-86594740 CAGGAGAACTTAAGGAAAGATGG - Intergenic
1062282797 9:135759485-135759507 CGGCAGAGCTTGGGGACAGATGG + Intronic
1062630118 9:137459578-137459600 CAGCAGATCGTGAGGGCCGAGGG - Intergenic
1185711851 X:2310480-2310502 CAGTAGGTCTTAGGGGCAGATGG - Intronic
1188240766 X:27786630-27786652 CAGTAGAGCAGGAGGAAAGAAGG - Intergenic
1189091051 X:38083266-38083288 AAGTAGATCTTAAGAACAGGTGG - Intronic
1193423302 X:81310290-81310312 CAGTGGATTTTGAGGACTCAGGG - Intergenic
1194821605 X:98514202-98514224 CAGCAGAGCCTGGGGACAGATGG - Intergenic
1199601565 X:149544264-149544286 CAGGAGATCTGGAGCTCAGAAGG + Intronic
1199648812 X:149935220-149935242 CAGGAGATCTGGAGCTCAGAAGG - Intronic