ID: 957226084

View in Genome Browser
Species Human (GRCh38)
Location 3:77448709-77448731
Sequence TGGCAGCTTCTCGGGGGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 130}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957226084 Original CRISPR TGGCAGCTTCTCGGGGGAAC TGG Intronic
905105244 1:35559909-35559931 TGCCACCTTCTCAGGGGAAATGG - Intronic
911288137 1:96023285-96023307 TAGCAGCTTCTGGGGGTGACAGG - Intergenic
913551806 1:119923788-119923810 TCGCAGCTTCTTGCGGGCACTGG - Exonic
913600094 1:120414637-120414659 AGGCCACTTCTCGGGGGAGCTGG + Intergenic
913685349 1:121226567-121226589 TGTCAGCTTCTCCGTGGAAGTGG + Intronic
914037195 1:144014171-144014193 TGTCAGCTTCTCCGTGGAAGTGG + Intergenic
914152260 1:145053761-145053783 TGTCAGCTTCTCCGTGGAAGTGG - Intronic
916511810 1:165478873-165478895 TGGCAGATTCTAGGGGGAGCAGG - Intergenic
920472667 1:206245125-206245147 TGTCAGCTTCTCTGTGGAAGTGG + Intronic
922480448 1:225936971-225936993 TAGCACCCTCTCAGGGGAACAGG + Exonic
1063104277 10:2979346-2979368 GGGCAGCTGCCCAGGGGAACAGG + Intergenic
1065119871 10:22517866-22517888 TGCCAGGTTCTGGGGGGAAGGGG + Intergenic
1065517005 10:26533971-26533993 TGTCAGGTTCTCGGGGGGGCGGG - Intronic
1066246310 10:33586408-33586430 TGTCAGCTTCTCAGAGGATCTGG - Intergenic
1067278422 10:44853833-44853855 TGCCAGCTCCTGGGGAGAACTGG - Intergenic
1069566214 10:69465061-69465083 TGCCAGCTTCTCAAGGGGACAGG - Intronic
1069590039 10:69635861-69635883 AGACAGCTGCTCGGGGGAACTGG - Intergenic
1069911799 10:71764618-71764640 TAGCAGCTTTTGGGGGGCACCGG + Intronic
1071141149 10:82510761-82510783 TGGCAGCTTCTGGTGGCAAATGG - Intronic
1071271946 10:84015937-84015959 GTGCAGCTTCTCTGGGGAAAAGG + Intergenic
1071544138 10:86515141-86515163 TCCCAGCTACTCGGGGGGACTGG + Intronic
1074122478 10:110503119-110503141 TGGCAGCTTCTGGGGAAAAGGGG + Intronic
1075448131 10:122528010-122528032 TGGCAACTTGCTGGGGGAACTGG - Intergenic
1083417324 11:62534162-62534184 TCCCAGCTTCTCTGGGAAACAGG - Intronic
1085048524 11:73367578-73367600 TGGCAGCTTCTCGGGGCCTGGGG - Exonic
1085219616 11:74862474-74862496 TGGCAGATGCTCGTGGGGACTGG - Intronic
1085306361 11:75488242-75488264 TGACAGGTTCTCTGGGGAGCAGG + Intronic
1089360456 11:117882714-117882736 TGTCAGCTTCTCGGTGCAACAGG - Intergenic
1089671912 11:120062558-120062580 GGGCAGCTTTTCTGGGGAAAGGG + Intergenic
1090660920 11:128880904-128880926 TGCCAGGTTCTCTGGGGAAAGGG + Intergenic
1091782975 12:3225472-3225494 TGACAGCTTCTGGGCAGAACAGG + Intronic
1091926404 12:4354424-4354446 TGGCTGCCTCTGGAGGGAACAGG - Exonic
1092957295 12:13562528-13562550 TGGCATCATCTCATGGGAACAGG + Exonic
1098535744 12:71591953-71591975 TGGAAGCTTCTAGGGGCAGCAGG + Intergenic
1113670986 13:112175942-112175964 CGGCAGCACCTCGGGGGGACAGG + Intergenic
1113671042 13:112176123-112176145 TGGCAGCACCTCGGGGGGACAGG + Intergenic
1113671132 13:112176430-112176452 CGGCAGCACCTCGGGGGGACAGG + Intergenic
1113831342 13:113297684-113297706 TGGCAGGTGCTTGGGGGACCAGG + Intronic
1118349800 14:64965613-64965635 TGGCAGTTTCACAGGGAAACTGG + Intronic
1118687508 14:68305818-68305840 TGGCAAGTTCTCAGTGGAACAGG - Intronic
1118752307 14:68816281-68816303 TGGTAGCTTCCCGGGGGTGCTGG - Intergenic
1121316506 14:92964180-92964202 TTGCAGTTTCTCTGGGGCACTGG + Intronic
1122012195 14:98759441-98759463 TGGCAGCTTCCCAGGTGAATAGG + Intergenic
1122295430 14:100703163-100703185 AGGCAGCTGCTGGGGGCAACAGG - Intergenic
1124695878 15:31863694-31863716 TGGCAGCCCCTCTGGAGAACAGG - Intronic
1131352155 15:91710976-91710998 TGACTGCTTCTCTGGGTAACTGG - Intergenic
1132839816 16:1973580-1973602 TGACAGCTGCTCGTGGGACCCGG + Intronic
1137446811 16:48536948-48536970 TGGCATCCTCTCGCAGGAACAGG + Intergenic
1137556432 16:49473245-49473267 TTGCAGCTTCTCATGGGAAGAGG - Intergenic
1138324463 16:56152459-56152481 TGGCATCTTCTGGGTGTAACTGG - Intergenic
1139287106 16:65825574-65825596 TTGCAGCTTCTCCGGGATACGGG - Intergenic
1142059078 16:88018200-88018222 TGGCCGCTTCTCGGGGGTGGTGG + Intronic
1143396792 17:6605700-6605722 TGGCTGCCTCTCGGGGGAAAGGG + Intronic
1143682365 17:8486947-8486969 GAGCAACTTCTCAGGGGAACTGG - Intronic
1143881948 17:10036543-10036565 TGGCAGCCTCTCCGGGAAATGGG + Intronic
1149681155 17:58508244-58508266 CAGCAGCTTCTGGGGGTAACTGG + Exonic
1150641162 17:66950693-66950715 TGGCAGCCTCTCAGGGAAAAGGG + Intergenic
1151489215 17:74422512-74422534 TGGCTGCTTCTTGGAGAAACAGG - Intergenic
1152691538 17:81720334-81720356 TGGCAGCTCCTCAGGGGAACAGG + Exonic
1153536706 18:6109701-6109723 TGGCATCTTCTGGGGTGCACGGG - Intronic
1153564284 18:6404222-6404244 CAACAGCTTTTCGGGGGAACAGG - Intronic
1155229330 18:23757515-23757537 TGGCAACTGCTGGGGGGAGCTGG - Intronic
1161733552 19:5977291-5977313 TGGTGCCTTCTCGGGGGATCTGG + Intronic
1163512048 19:17741303-17741325 TGGGAGCTTCTTGGGGGCCCTGG - Intergenic
1163546243 19:17942922-17942944 CGGCAGCTTCTCTGGGGGCCAGG - Intronic
1164578288 19:29418824-29418846 GTGCAGCTTCTCCTGGGAACAGG - Intergenic
925710966 2:6739829-6739851 TGACAGCTGCTGGGAGGAACAGG + Intergenic
933773310 2:85757153-85757175 TGGCAGCCTTTCTGGGGAAGGGG - Intronic
934133382 2:88970898-88970920 TGAAATCTTCTCAGGGGAACAGG - Intergenic
934136150 2:88998078-88998100 TGAAATCTTCTCAGGGGAACAGG - Intergenic
940184379 2:150967199-150967221 TGGCAGCTTCACTGGGAAAGGGG - Intergenic
941638408 2:167960984-167961006 TGTCAGCTTCCCTTGGGAACTGG - Intronic
946826848 2:223687995-223688017 TGGCAGCGGCTCGGGGGCAGAGG + Intergenic
948150321 2:235739672-235739694 TGGCAGGAGCTCGCGGGAACGGG + Intronic
1169451832 20:5718599-5718621 TCGCAGCTTCTCTGGGGAGAGGG - Intergenic
1173934119 20:46846264-46846286 TGGCAGCCACTTGGGGGAAGAGG + Intergenic
1178812354 21:35895741-35895763 TGGCACCTTCACAGGGGACCTGG + Intronic
1180986254 22:19905533-19905555 GGGCAGCCTCTGAGGGGAACAGG + Intronic
1182175624 22:28284253-28284275 TGGGAGCTTCTGGTGGGAAAGGG - Intronic
1183431534 22:37768860-37768882 TGACAGCTTCTCTGGGCTACAGG - Intronic
1185139942 22:49094418-49094440 TGGCAGCTGCTCTGGGTAAATGG + Intergenic
952698752 3:36302966-36302988 TGGCAGCTGCTATGGGGCACAGG + Intergenic
954661679 3:52229977-52229999 GGGCAGCATCTCGGGGCACCCGG + Exonic
956595013 3:70957967-70957989 GGGCAGCTGCTCGGGGAAGCCGG + Intronic
957226084 3:77448709-77448731 TGGCAGCTTCTCGGGGGAACTGG + Intronic
962100013 3:132332254-132332276 TGACACCTTCTGGGGGAAACAGG - Exonic
964304194 3:155324023-155324045 TGGGATCTTCTTGGGGGAAAGGG - Intergenic
965162732 3:165155484-165155506 TGGCAGCTTCTCTGAGAAAATGG - Intergenic
967382747 3:188878290-188878312 TGGCAGCTGCTAGGGAGATCAGG + Exonic
969604672 4:8196539-8196561 TGGCAGCTTCCCTGTGGAATGGG - Intronic
969840743 4:9879968-9879990 AGGCAGCTTCTGTGAGGAACAGG - Intronic
969891091 4:10260720-10260742 AGGCAGCTTCTCTGGGCAGCAGG + Intergenic
974404816 4:61452255-61452277 TTGCAGCCTCCTGGGGGAACAGG + Intronic
980863713 4:138529642-138529664 TGGCAGCCTCCCTGGGGTACTGG - Intergenic
982091537 4:151883980-151884002 TGGGAGCTTCGAGAGGGAACCGG - Intergenic
982515918 4:156348800-156348822 TGGCTGTTTCTTGGGGGCACTGG + Intergenic
985251995 4:188033661-188033683 TTACAGCTTCTCAGGGGAAATGG - Intergenic
985937891 5:3110642-3110664 TGCCAGCTTCTTGTAGGAACAGG - Intergenic
988721017 5:33879217-33879239 TGTCAGAATCTCGGGGGAATGGG - Intronic
991465381 5:66906951-66906973 TGGTAGCTTCTGGGAGGAGCTGG + Intronic
994066089 5:95544303-95544325 TGGCAGCTACTGGGGAAAACTGG - Intronic
994131696 5:96236353-96236375 TGGCAGATTCACGGGGGACCAGG - Intergenic
994858628 5:105159038-105159060 TGGCTGATTCTCAGAGGAACAGG + Intergenic
999157964 5:149472042-149472064 TAGCACCTTCTCGGGGGTGCCGG + Intergenic
1001246376 5:170108256-170108278 GGGCCGCTTCTCTGGGGAGCTGG - Exonic
1003503079 6:6718302-6718324 AGCCAGCTTCTCATGGGAACTGG + Intergenic
1006082530 6:31575654-31575676 TGGCAGCTTGTCAGGGGATGTGG - Exonic
1006377405 6:33679198-33679220 TGTCAGCTCCTGGGGGGCACGGG + Intronic
1014535624 6:122610352-122610374 TGGCAGCTACTCGGGGGCGGAGG - Intronic
1014650730 6:124033724-124033746 TGGCAGGTTGTCAGGGAAACAGG + Intronic
1017959317 6:159208127-159208149 AGGCAGCTTCTTTGGGGGACTGG - Intronic
1019406683 7:887691-887713 TCGCAGCTTCTCGGGTGCAGTGG - Intronic
1020018423 7:4845936-4845958 TCACAGCTTCCCGGGGTAACTGG - Intronic
1021248623 7:18295824-18295846 GGGCAGCATCTAGGGGGAAGAGG + Intronic
1021819250 7:24480026-24480048 GGGCAGCTTCCCGGGAGCACTGG - Intergenic
1023271257 7:38465336-38465358 TGTCAGCTTCTAGGGTGAAAAGG + Intronic
1032148530 7:129406556-129406578 TGGCAGCATCTCTGAGGATCTGG - Intronic
1032242915 7:130179336-130179358 TGGCTGCTTCTCTGGGGAAGGGG - Intronic
1043889663 8:85642460-85642482 TGGCAGCGACCCGGGGGAATGGG + Intergenic
1044840083 8:96329788-96329810 TGTCAGCTTCTAGGGGGAAGAGG - Intronic
1045339071 8:101235369-101235391 TGGCAGCTTCTCGGGGCTTCAGG + Intergenic
1055831176 9:80380529-80380551 TGGCTGCTTCTCAGGACAACTGG + Intergenic
1056598273 9:88025589-88025611 TGGCAGCTTGGGGAGGGAACTGG + Intergenic
1057258494 9:93569589-93569611 TGGAAGCTTCCCTGGGGTACAGG - Intergenic
1057294968 9:93829582-93829604 TGGCATCTTCTCGAGGCACCAGG - Intergenic
1059653337 9:116335019-116335041 TGGCAGCTGCTCAGGGTGACGGG - Exonic
1059843695 9:118247103-118247125 TGTAATCTTCTCTGGGGAACTGG - Intergenic
1061762435 9:132859848-132859870 GGGCAGCGTTTCAGGGGAACGGG + Intronic
1061923798 9:133796348-133796370 TGGCAGCTTCCAGGGGGTATAGG - Intronic
1203761310 EBV:13869-13891 TGGGGGCTTCTGGGGGGACCGGG - Intergenic
1203762239 EBV:16941-16963 TGGGGGCTTCTGGGGGGACCGGG - Intergenic
1203763168 EBV:20013-20035 TGGGGGCTTCTGGGGGGACCGGG - Intergenic
1203764097 EBV:23085-23107 TGGGGGCTTCTGGGGGGACCGGG - Intergenic
1203765026 EBV:26157-26179 TGGGGGCTTCTGGGGGGACCGGG - Intergenic
1203765955 EBV:29229-29251 TGGGGGCTTCTGGGGGGACCGGG - Intergenic
1203766884 EBV:32301-32323 TGGGGGCTTCTGGGGGGACCGGG - Intergenic
1189141676 X:38613631-38613653 TGGGAGCTTCTTGGGGAAAGAGG + Intronic
1190385208 X:49878349-49878371 TGGCAGCATCCCGGGGGAGGGGG - Intergenic
1199986302 X:152954276-152954298 TAGCAGCTTCTCCTGAGAACCGG - Intronic
1199988540 X:152970110-152970132 TAGCAGCTTCTCCTGAGAACCGG + Intronic
1200911920 Y:8538581-8538603 CAGCAGCTTCTCTGGGGACCAGG - Intergenic