ID: 957228272

View in Genome Browser
Species Human (GRCh38)
Location 3:77476803-77476825
Sequence CACACTGCCCAGATGTCACT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 194}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957228272 Original CRISPR CACACTGCCCAGATGTCACT CGG Intronic
900306216 1:2009895-2009917 CTCACTGCCCAGCTGGCAATGGG + Intergenic
902086862 1:13869370-13869392 CACACTGAGCAGATGGCCCTTGG - Intergenic
904219555 1:28954752-28954774 CACATTCCCTATATGTCACTGGG + Intronic
904926963 1:34057096-34057118 CTCTCTGCTCAGGTGTCACTGGG - Intronic
905206225 1:36344222-36344244 CCCAGGGCCCACATGTCACTGGG + Exonic
909988124 1:82187575-82187597 GACACTGAACAGATCTCACTAGG - Intergenic
914843158 1:151264925-151264947 CACATTCCCCAGCTGCCACTTGG - Intronic
915013810 1:152714519-152714541 CACAGTGCCCTGGTGTCTCTAGG - Intergenic
917800321 1:178563685-178563707 CACACACCGCAGATTTCACTGGG + Intergenic
919611630 1:199752140-199752162 CACATTGCTCACATGGCACTGGG + Intergenic
923215611 1:231845516-231845538 CACTGTCCCCAGAAGTCACTGGG - Intronic
923720869 1:236465480-236465502 CCCACTGCCCAGATTTCAGCAGG + Intronic
924442144 1:244095463-244095485 CACACTGTACTCATGTCACTTGG - Intergenic
924442152 1:244095508-244095530 CACACTGTACTCATGTCACTTGG - Intergenic
1064325071 10:14342317-14342339 AGCACTGCCCAGATGACACTTGG + Intronic
1066036220 10:31488802-31488824 CATAATGACCAGATGTCAATAGG - Intronic
1069443718 10:68453606-68453628 CACAATAGCTAGATGTCACTAGG - Intronic
1069690560 10:70348977-70348999 AACACAGCCAAGATGTGACTGGG + Intronic
1070674800 10:78405202-78405224 CACATTGCACAGATGAAACTCGG + Intergenic
1071998757 10:91173324-91173346 CACACTGCCTTAATCTCACTTGG - Intronic
1073077805 10:100835700-100835722 CTCTCTGCCCAGAGGTCTCTGGG + Intergenic
1074228734 10:111513033-111513055 GACACTGACCATATTTCACTTGG + Intergenic
1075341442 10:121649547-121649569 CACAGTGCACAGATGCCACCAGG - Intergenic
1075857083 10:125638672-125638694 CACCGTGCCCAGCTGTCACCTGG + Intronic
1076112577 10:127872331-127872353 CACACTTCCCAGTTGCCCCTGGG + Intergenic
1076324429 10:129609947-129609969 CAAACTGCACAGACGTCACTGGG - Intronic
1076634026 10:131871131-131871153 CACACTGCCCGCAAGTCACAGGG + Intergenic
1077228254 11:1447613-1447635 CACCCTGCCCAGCAGTCACACGG + Intronic
1077324721 11:1958778-1958800 CTCACTCCCCAGTCGTCACTGGG + Intronic
1077522831 11:3046409-3046431 CTCACAGCACAGGTGTCACTTGG + Intronic
1078307644 11:10206057-10206079 TTCACTGCCCTGATGTCACTGGG - Intronic
1079291126 11:19188596-19188618 CACACTTCCCTGATGTCATTTGG - Intronic
1084277515 11:68061792-68061814 CACACTGTCCTGATGCCACCAGG + Intronic
1085420027 11:76349132-76349154 CAGACAGCCCAGATGAGACTAGG + Intergenic
1086931132 11:92694522-92694544 CACAATGCCTACATGTAACTGGG - Intronic
1202807701 11_KI270721v1_random:13955-13977 CTCACTCCCCAGTCGTCACTGGG + Intergenic
1093137997 12:15474900-15474922 CGCACTGCCTAGATCGCACTTGG + Intronic
1094316967 12:29145765-29145787 CACGCTGCACAGATATTACTAGG - Intergenic
1095982280 12:47980398-47980420 CACACAGCCCACATGCCACATGG + Intronic
1096464199 12:51839142-51839164 CACTGTGCCCAGACGTAACTTGG + Intergenic
1097788703 12:63790446-63790468 TACACTGCCCAGAGGTGACAGGG - Intronic
1101967536 12:109291657-109291679 CACACTGCTCAGTTGTCGCAGGG + Intronic
1102798292 12:115708713-115708735 CACTCTATCCAGATGTGACTTGG - Intergenic
1103196640 12:119049281-119049303 CACTTTGCCCAGATGTCTCCTGG - Intronic
1103738509 12:123076201-123076223 CACACCGCCCAGATGCCAGGAGG + Intronic
1104650397 12:130527146-130527168 AACACTGACCAGATGTAATTTGG + Intronic
1105366329 13:19768844-19768866 CACTGTGCCCAGTTGCCACTTGG - Intronic
1105895729 13:24716077-24716099 CACAGTGCCAGGAAGTCACTGGG - Intergenic
1106106068 13:26734513-26734535 ATCACAGCCCAGATGACACTCGG - Intergenic
1106865116 13:33955805-33955827 CACACCACCCAGATGTCTCAGGG + Intronic
1107319272 13:39168264-39168286 GACAATGCCCATATGTCAGTAGG - Intergenic
1107990463 13:45814627-45814649 CACACTGCTCAGATCTTTCTGGG + Intronic
1111465188 13:88598963-88598985 CACACTGTCCAGAGGTGCCTGGG - Intergenic
1113526387 13:110981141-110981163 CTCCCTGCCCAGCTGCCACTGGG + Intergenic
1113675827 13:112207260-112207282 CAGACTGGCCAGATTTAACTCGG + Intergenic
1120802045 14:88701170-88701192 GACAGTACCCAGATGTCCCTTGG - Intronic
1120996813 14:90423667-90423689 CGCACAGCCCAGCTGCCACTTGG - Intergenic
1121342534 14:93114332-93114354 CACACAGCCCAGATGGCAGAAGG + Intronic
1122190864 14:100042548-100042570 CACCCTGGCCAGAGGTCGCTGGG - Intronic
1123840157 15:24240054-24240076 CACACTTCCAAGATATCATTTGG - Intergenic
1123853099 15:24380571-24380593 CACACTTCCAAAATATCACTCGG - Intergenic
1124149161 15:27161382-27161404 CACACTGCCCCCATGGAACTTGG - Intronic
1127127444 15:55825711-55825733 CAAACTGCCCAGAAGTCTGTAGG + Intergenic
1127640071 15:60908055-60908077 CACACTGACCACATGTGTCTGGG + Intronic
1128135511 15:65260340-65260362 CACACTGCAGAGATGGAACTAGG + Intronic
1130147783 15:81287722-81287744 CACTCTGTCCAAGTGTCACTGGG - Intronic
1131465314 15:92650323-92650345 GACATTGCCCAGCTGTCAGTGGG - Intronic
1132935163 16:2476145-2476167 CACACTGCCTGGAAGTCACCTGG - Intronic
1134464904 16:14466911-14466933 GACCCTGCCCAGATGCCATTAGG - Intronic
1135500332 16:22990599-22990621 CACACGGTCCAGCTGTCACTGGG + Intergenic
1137548264 16:49418872-49418894 CACAGTGCCAAGATGGCATTTGG + Intergenic
1137961877 16:52889337-52889359 AAATCTGCCCAGATGACACTTGG + Intergenic
1139633571 16:68245052-68245074 CACGCTGCGCAGCTCTCACTTGG - Intergenic
1141140661 16:81494741-81494763 GACACTGCCCAGGTGCCCCTGGG + Intronic
1141862609 16:86728248-86728270 CACACTCCCCAAATGTCTCTTGG - Intergenic
1146079022 17:29760832-29760854 CAAACAGCTCAGCTGTCACTCGG + Intronic
1146280539 17:31541564-31541586 CTCACTGGCCACATGTCACCTGG + Intergenic
1146376756 17:32299720-32299742 CACTCTGCACTGGTGTCACTGGG - Intronic
1148223065 17:45878300-45878322 TACACAGCCTAGATGGCACTAGG + Intergenic
1148637083 17:49157031-49157053 CACACTTCCCAGATTCCTCTTGG - Intronic
1151868788 17:76822545-76822567 AGCACTGCCCAGCTGTCACTTGG + Intergenic
1152377615 17:79926852-79926874 CCCACTGCCCAGACGTCCCCTGG + Intergenic
1152602516 17:81271699-81271721 CTCTCTGCCCAGGTGTCAATGGG + Intronic
1152666827 17:81575387-81575409 CACAGCGCCCAGCTGACACTTGG + Intronic
1154300033 18:13184690-13184712 CACACTGCCAAGATGACAGATGG + Intergenic
1156487841 18:37477872-37477894 CACACTGCCCCAATGTGGCTTGG - Intronic
1158665613 18:59430023-59430045 CACAGTGCCCAGATTGCAATAGG + Intergenic
1160122333 18:76142033-76142055 CACACTGAGCAGATGTCGCTGGG - Intergenic
1160436956 18:78859108-78859130 GACACTTCCCAGATGTGCCTTGG - Intergenic
1161630980 19:5355286-5355308 CAGAGTTCCCAGATGACACTGGG + Intergenic
1166476964 19:43135036-43135058 CACACTGACAAGGTGACACTGGG + Intronic
1167492678 19:49801419-49801441 CACGCTGCACAGATGGAACTTGG - Exonic
925366261 2:3314087-3314109 CACGCTGGCCATATGTCATTGGG + Intronic
926855257 2:17249535-17249557 CACACTGCCTTGAAATCACTTGG - Intergenic
929761951 2:44814373-44814395 CACCCTGGCCAGATGACAGTGGG - Intergenic
930402713 2:50910898-50910920 AACTCTGCACAGATCTCACTGGG + Intronic
930927835 2:56841620-56841642 CACTCTGCCATGATTTCACTAGG - Intergenic
935215877 2:100975021-100975043 CAGACTGCCCTGATTCCACTTGG - Intronic
936259823 2:110949158-110949180 CACCCTACCCACAAGTCACTTGG - Intronic
937222893 2:120352318-120352340 CCCACTGCGCAGGTGTAACTGGG + Intergenic
942901910 2:181129966-181129988 CACCCTGCCCAGATCCCACTAGG - Intergenic
942931404 2:181498229-181498251 CACTTTGCTCAAATGTCACTTGG - Intronic
943329169 2:186538358-186538380 CACACTGCCTAGATTACTCTAGG + Intergenic
946118854 2:217491025-217491047 CTCACTGCCCAGTTGTCCCAGGG + Intronic
946879162 2:224160220-224160242 CAAACTGCCCATATTTCTCTAGG - Intergenic
947254051 2:228142231-228142253 CACTCTGCCCAGCAGTCCCTGGG - Intronic
948256882 2:236574859-236574881 CTCACAGCCCAGATGGTACTGGG - Intronic
948389406 2:237601270-237601292 CACCCTGCACAGAGGTCACCAGG + Intronic
949050164 2:241893495-241893517 CACACTGCCCAGAGGCCAGACGG - Intergenic
949062186 2:241967622-241967644 CACACTGGCCACAGGTCGCTGGG + Intergenic
1169190377 20:3655164-3655186 CACACTGCCCTCCTGTGACTGGG - Intergenic
1170187194 20:13603959-13603981 CACAGTGATCAGATGTCACTTGG - Intronic
1170860199 20:20095653-20095675 CGCTCTGCCCATCTGTCACTAGG - Intronic
1172895391 20:38296333-38296355 GACACTGCCCTGATATCCCTGGG + Intronic
1173626914 20:44479869-44479891 AACACTGCCCTGAGGTTACTCGG + Intronic
1176198120 20:63847342-63847364 CACACTCCTCAGCTGTCCCTAGG - Intergenic
1178024596 21:28451919-28451941 GACATTGCCCAGATGTCCATGGG + Intergenic
1178480481 21:32975809-32975831 CACACTGCACAGACCTTACTGGG - Intergenic
1180920335 22:19518394-19518416 CAAACTGCCCATATCTCACAGGG - Intronic
1183936394 22:41264833-41264855 CTCTGTGCCCAGATCTCACTAGG - Exonic
1184875758 22:47274433-47274455 GACACTGCCCAGCTGTGACCAGG - Intergenic
950291222 3:11785918-11785940 ACCACTGCCCAGATGCCACTTGG - Intergenic
952945332 3:38475084-38475106 CACCCTGCCCAGAGGCCACAGGG - Intronic
955552093 3:60096075-60096097 CACCCTGCCCAGGCCTCACTCGG + Intronic
957228272 3:77476803-77476825 CACACTGCCCAGATGTCACTCGG + Intronic
957664157 3:83202230-83202252 CAAACTGCCCAGTTGAGACTAGG - Intergenic
963919480 3:150892119-150892141 CACCTTGCCCAGAAGTCACTGGG + Intronic
977159924 4:93621187-93621209 CTCACTTCCCAGATAACACTAGG - Intronic
978289106 4:107116555-107116577 CACAATTCCCACATGTCACGGGG + Intronic
981139845 4:141255071-141255093 CACACTTCCCAGTTGCCCCTTGG + Intergenic
981487378 4:145301542-145301564 CACACTGCCCAGAAGCTGCTGGG - Intergenic
985426131 4:189832414-189832436 CACACTGCACAGCTGACATTGGG + Intergenic
987458846 5:18181846-18181868 CACACAGCCCAGAGATCACTTGG + Intergenic
987709800 5:21492483-21492505 CTGACTGCACAGAAGTCACTGGG + Intergenic
988749813 5:34181680-34181702 CTGACTGCACAGAAGTCACTGGG - Intergenic
990825727 5:59895195-59895217 CACACAGTCTAGATGCCACTGGG + Intronic
991738072 5:69644884-69644906 CTGACTGCACAGAAGTCACTGGG - Intergenic
991760122 5:69911540-69911562 CTGACTGCACAGAAGTCACTGGG + Intergenic
991787210 5:70206560-70206582 CTGACTGCACAGAAGTCACTGGG - Intergenic
991789648 5:70224610-70224632 CTGACTGCACAGAAGTCACTGGG - Intergenic
991817532 5:70521012-70521034 CTGACTGCACAGAAGTCACTGGG - Intergenic
991839353 5:70786591-70786613 CTGACTGCACAGAAGTCACTGGG + Intergenic
991879656 5:71206950-71206972 CTGACTGCACAGAAGTCACTGGG - Intergenic
991882096 5:71224979-71225001 CTGACTGCACAGAAGTCACTGGG - Intergenic
994421920 5:99533802-99533824 CTGACTGCACAGAAGTCACTGGG + Intergenic
994460922 5:100066779-100066801 CTGACTGCACAGAAGTCACTGGG - Intergenic
994485070 5:100380207-100380229 CTGACTGCACAGAAGTCACTGGG - Intergenic
997328760 5:133043998-133044020 AACACTGCACAGATTTCTCTGGG - Intergenic
997617708 5:135263193-135263215 CACCCTGCCCACGTGTCACGAGG - Intronic
1000630691 5:163587276-163587298 CTCTCTGCCCAGGTGTCTCTGGG + Intergenic
1001663653 5:173414875-173414897 CACACAGCCCTGATGTTCCTTGG - Intergenic
1002074503 5:176700072-176700094 CACTCTGCCCAGAGGTGACGAGG - Intergenic
1002276792 5:178109145-178109167 CACACTGCTCAGATGCCAAGGGG - Intergenic
1002724101 5:181283152-181283174 CACAGTGCCCAGGGCTCACTGGG - Intergenic
1003131975 6:3402475-3402497 CACACTACCCAGAGTGCACTAGG + Intronic
1003131991 6:3402563-3402585 CACACTACCCAGAGTGCACTAGG + Intronic
1003884014 6:10504627-10504649 TAAACTGCCCAGAAGTCTCTGGG + Intronic
1005547879 6:26888023-26888045 CTGACTGCACAGAAGTCACTGGG - Intergenic
1007547817 6:42707821-42707843 CACACTGCCCAGAGACCACATGG + Intronic
1008593592 6:53018433-53018455 CCCACCGCCCAGACGTCAATGGG + Exonic
1009018640 6:57929104-57929126 CTGACTGCACAGAAGTCACTGGG - Intergenic
1011128487 6:84031699-84031721 CACAATGCCCTGAAGACACTTGG + Intergenic
1011627622 6:89296406-89296428 CTGGATGCCCAGATGTCACTTGG - Intronic
1013136974 6:107291722-107291744 CACCGTGCCCAGCTGGCACTTGG - Intronic
1014118554 6:117695433-117695455 CTCTCTGCTCAGATGTTACTGGG + Intronic
1021507758 7:21404119-21404141 CACACTTCCCAGAGATCAGTGGG + Intergenic
1023842969 7:44107126-44107148 GCCCCTGCCCAGATGTCCCTGGG + Intronic
1024022999 7:45387929-45387951 GCCCCTGCCCAGATGACACTGGG + Intergenic
1024088851 7:45919607-45919629 CACGTTGGACAGATGTCACTGGG - Intronic
1025731773 7:64114220-64114242 CTGACTGCACAGACGTCACTGGG + Intronic
1025928101 7:65975043-65975065 CTGACTGCACAGACGTCACTGGG - Exonic
1026132776 7:67634194-67634216 CCCACCCCCCAGATGACACTGGG + Intergenic
1028024692 7:85822022-85822044 CAGCCTCCCCAGCTGTCACTGGG - Intergenic
1029096576 7:98089720-98089742 CACACTGCCCAAATGACAGGGGG - Intergenic
1029448775 7:100629142-100629164 CAGACTGGCCAGTGGTCACTTGG - Intronic
1029655242 7:101919768-101919790 GGCCCTTCCCAGATGTCACTGGG + Intronic
1030059718 7:105612942-105612964 CACACTGCCCTGATGGGTCTAGG + Intronic
1030291588 7:107878310-107878332 CTCTTTGCCCAGATGTCTCTAGG + Intergenic
1033042317 7:137929486-137929508 GACACTGCCCAAATGTCTGTAGG + Intronic
1034421920 7:150995133-150995155 CAGCCTTCCCAGATGTCACCCGG - Intronic
1035635019 8:1138064-1138086 CACACTGCCCCGCTGACACCGGG + Intergenic
1040837672 8:51749401-51749423 CACACTGCACAGGTGTGAATGGG - Intronic
1041028088 8:53707381-53707403 CACCCTGCCCAGAGGTGACCGGG - Intergenic
1041402126 8:57457125-57457147 CCCTCAGCCCAGATATCACTGGG + Intergenic
1043165211 8:76894767-76894789 CACACTTCCAAGAGGGCACTTGG + Intergenic
1043226313 8:77735566-77735588 CTTACTGCCCACTTGTCACTGGG + Intergenic
1043869301 8:85413600-85413622 CACACTGCCCAGAATTCAAAAGG + Intronic
1044515527 8:93134168-93134190 CACTCTGACCAAATGTAACTGGG + Exonic
1045784498 8:105904433-105904455 TACACTTCCCAGAATTCACTCGG - Intergenic
1048132185 8:131710213-131710235 CACCCTGCCCACTTGTCACCTGG + Intergenic
1048599889 8:135908660-135908682 CACACTGCTCAGCTCTCAATCGG + Intergenic
1057767795 9:97938326-97938348 CACACTGCACAGGTGTGAGTAGG + Exonic
1060257691 9:122047096-122047118 CAGGCTCCCCAGATGTGACTAGG - Intronic
1060664289 9:125423709-125423731 CACACGGCCATGAAGTCACTGGG + Intergenic
1060860888 9:126954026-126954048 CACACTGCCCACACTTTACTTGG + Intronic
1061066719 9:128282887-128282909 CACCATGCCCATCTGTCACTGGG - Intronic
1062235838 9:135507153-135507175 CCTCCTGCCCAGATGTCACCAGG + Intergenic
1062287109 9:135778185-135778207 CACACAGCCAAGATGACCCTGGG - Intronic
1186187026 X:7030635-7030657 CACACTGACAAGGTGACACTGGG + Intergenic
1187217071 X:17287517-17287539 CACACTGCCAACAGGTCCCTTGG + Intergenic
1188612745 X:32119579-32119601 CACAATGCCCATATATAACTAGG + Intronic
1193967538 X:88006870-88006892 CTCACTGCCCAGAGCTAACTTGG - Intergenic
1201784927 Y:17764953-17764975 GACACTCCTCAGATTTCACTAGG + Intergenic
1201816625 Y:18141034-18141056 GACACTCCTCAGATTTCACTAGG - Intergenic
1201853383 Y:18514199-18514221 CACACTCCTCAGATTTCAATGGG - Intergenic
1201879938 Y:18806185-18806207 CACACTCCTCAGATTTCAATGGG + Intronic
1202327874 Y:23710971-23710993 CACACTCCTCAGATTTCATTGGG + Intergenic
1202542896 Y:25959081-25959103 CACACTCCTCAGATTTCATTGGG - Intergenic