ID: 957228684

View in Genome Browser
Species Human (GRCh38)
Location 3:77482499-77482521
Sequence ATCTCTGGTAACACTCCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 140}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957228679_957228684 9 Left 957228679 3:77482467-77482489 CCTCTCCTTTCAATCATTCTGAG 0: 1
1: 0
2: 0
3: 24
4: 196
Right 957228684 3:77482499-77482521 ATCTCTGGTAACACTCCCTGTGG 0: 1
1: 0
2: 1
3: 8
4: 140
957228678_957228684 21 Left 957228678 3:77482455-77482477 CCAGAATGCAGGCCTCTCCTTTC 0: 1
1: 1
2: 1
3: 33
4: 242
Right 957228684 3:77482499-77482521 ATCTCTGGTAACACTCCCTGTGG 0: 1
1: 0
2: 1
3: 8
4: 140
957228680_957228684 4 Left 957228680 3:77482472-77482494 CCTTTCAATCATTCTGAGCACCA 0: 1
1: 0
2: 1
3: 16
4: 144
Right 957228684 3:77482499-77482521 ATCTCTGGTAACACTCCCTGTGG 0: 1
1: 0
2: 1
3: 8
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957228684 Original CRISPR ATCTCTGGTAACACTCCCTG TGG Intronic
901242039 1:7700802-7700824 ATCTCTGGTTGCTATCCCTGGGG - Intronic
904236249 1:29119232-29119254 ATCTCTGGCAACAGTTCTTGGGG + Exonic
904302725 1:29565676-29565698 ACCTCTGGTAACAGTCACTGTGG - Intergenic
910465192 1:87491567-87491589 ATCTCTTGGAACACTCTCTCTGG - Intergenic
913446823 1:118959079-118959101 TACTCTGGTAACATTCCTTGAGG + Intronic
913569364 1:120104821-120104843 AAGTCTGGTAACCCTCACTGAGG + Intergenic
914290173 1:146265809-146265831 AAGTCTGGTAACCCTCACTGAGG + Intergenic
914551216 1:148716592-148716614 AAGTCTGGTAACCCTCACTGAGG + Intergenic
918794313 1:188873319-188873341 TACTCTGGTCACACTGCCTGTGG + Intergenic
919813289 1:201422349-201422371 AGCCCTGGAAACACTCACTGGGG - Intronic
922503281 1:226111810-226111832 AGCTCTGCTCACACTCCCTTGGG - Intergenic
922828092 1:228535570-228535592 CTCTCTGGTTACAATGCCTGTGG + Intergenic
923287507 1:232510726-232510748 ATCTCGGGGAACAGACCCTGGGG + Intronic
1064361076 10:14665290-14665312 ATCTCTAGTAACACATACTGAGG + Intronic
1067704227 10:48595070-48595092 AGCTCTGGAGATACTCCCTGGGG + Intronic
1068158499 10:53233095-53233117 ATCTCTGGTTAAACTAACTGTGG - Intergenic
1069800150 10:71076984-71077006 CTCTCTCGTAGCACTTCCTGGGG - Intergenic
1069933535 10:71899861-71899883 AACTCTGGCAGAACTCCCTGTGG - Intergenic
1070050663 10:72886503-72886525 ATCACTGGCAACACTGCATGAGG + Exonic
1070542622 10:77427438-77427460 ATCTCAGCTAACACCCTCTGTGG - Intronic
1070917635 10:80165098-80165120 ATGTCTGGGTCCACTCCCTGGGG + Intronic
1073950135 10:108798014-108798036 ACCTCTGGTAACAATCCCAATGG - Intergenic
1074960554 10:118441501-118441523 TTATCTGGCAACACTCCTTGAGG - Intergenic
1081679846 11:44994514-44994536 ATCTGGGGTAAAGCTCCCTGGGG + Intergenic
1084053402 11:66616065-66616087 TTCTTTGGAAACATTCCCTGGGG - Intergenic
1085316548 11:75548573-75548595 ATCTCTGGTACCCATCCCTCAGG - Intergenic
1086348692 11:85923563-85923585 AGGAATGGTAACACTCCCTGGGG - Intergenic
1088511562 11:110580773-110580795 TTTTCTGATAAAACTCCCTGAGG + Exonic
1089164929 11:116468525-116468547 ATTTCTGCTAACTCGCCCTGCGG + Intergenic
1091602901 12:1928713-1928735 CTCTCTGGAAACAGTCCCGGAGG + Intergenic
1097915231 12:65014083-65014105 TTCTCTGCTAGAACTCCCTGGGG + Intergenic
1099829361 12:87820766-87820788 ATCTCTGGATACACTACTTGTGG - Intergenic
1100649628 12:96571033-96571055 ATATCTGGTAGACCTCCCTGAGG - Intronic
1103814136 12:123639337-123639359 ATCTCAGGTAAGACTGCTTGAGG + Exonic
1105429835 13:20326548-20326570 CTCTGTGGTAACAGCCCCTGTGG + Intergenic
1106002426 13:25736852-25736874 ATCGCTGGTTATATTCCCTGGGG - Intronic
1107042622 13:35965916-35965938 ATGTCTAGGAACTCTCCCTGTGG - Intronic
1107406349 13:40117708-40117730 ATCTCTGGTTAGAGTCACTGGGG - Intergenic
1110409169 13:75185069-75185091 ATCTCTGGTATCTCTCAGTGAGG - Intergenic
1114051142 14:18920562-18920584 ATCACTGGCTACACTGCCTGCGG + Intergenic
1114111420 14:19481363-19481385 ATCACTGGCTACACTGCCTGCGG - Intergenic
1119330403 14:73789279-73789301 CTCTCTGGGAACACTCACTGTGG + Intronic
1119402071 14:74369658-74369680 TTCTCTGGCAACCCTACCTGGGG + Intergenic
1120858015 14:89229742-89229764 CCCTCTGGTGACACTCGCTGAGG + Intronic
1121216568 14:92253077-92253099 ATTTCTGGTAACAATCTCAGAGG - Intergenic
1123101761 14:105807364-105807386 ATCTCTGATAACACTTGTTGGGG - Intergenic
1123716703 15:23039183-23039205 GTCCCGGGTAACACGCCCTGTGG + Intronic
1126201729 15:45994465-45994487 ACATCTGATAACACTGCCTGTGG + Intergenic
1129262915 15:74378910-74378932 ATCTCAGGAACCCCTCCCTGGGG + Intergenic
1131377058 15:91934205-91934227 CTCTCCTGTAACACTCACTGGGG - Intronic
1133398460 16:5466774-5466796 ATGGCAGGTCACACTCCCTGGGG - Intergenic
1134502253 16:14778426-14778448 GTATCTGGTAACACTCCTTAAGG - Intronic
1134578309 16:15350471-15350493 GTATCTGGTAACACTCCTTAAGG + Intergenic
1134724282 16:16407078-16407100 GTATCTGGTAACACTCCTTAAGG - Intergenic
1134943149 16:18304782-18304804 GTATCTGGTAACACTCCTTAAGG + Intergenic
1135883900 16:26286492-26286514 ATCTCTGGGAACACTGACAGTGG - Intergenic
1138538164 16:57670976-57670998 AGCTCTCCTAACACTTCCTGGGG + Intronic
1139415919 16:66810304-66810326 ATACCTGGGAACATTCCCTGTGG + Intronic
1146965212 17:37021926-37021948 AACTTTGTTAACATTCCCTGTGG - Intronic
1147422682 17:40330510-40330532 ACCTCAGGTAACCCTCACTGGGG + Intronic
1149339320 17:55669686-55669708 ATCGCTGGGTAGACTCCCTGGGG + Intergenic
1151551568 17:74825295-74825317 ATGACTGGTTACACTCCCAGTGG + Intronic
1152387310 17:79982547-79982569 ATCTCTTTAAACATTCCCTGAGG + Intronic
1152996115 18:407774-407796 ATCTCTGACATCACTCCCTGTGG - Intronic
1153939520 18:9966121-9966143 ATCTGTGGTTTCACTTCCTGTGG + Intergenic
1155059198 18:22213536-22213558 ATCTCTGTTAGAACTCCCTCAGG + Intergenic
1155462127 18:26094425-26094447 ATTTCTGTTCACAGTCCCTGTGG + Intergenic
1155874985 18:31075044-31075066 TTTTCTTGTAACATTCCCTGAGG - Intronic
1155938545 18:31779663-31779685 CTCTCTGGTAAGACTCCCAAAGG + Intergenic
1156072407 18:33228780-33228802 CTGCCTGGAAACACTCCCTGTGG - Intronic
1160062880 18:75548730-75548752 CACTCTGGGCACACTCCCTGTGG + Intergenic
1167826905 19:51981632-51981654 ATCTTTGGTTACTCTCTCTGTGG - Intronic
925013639 2:504844-504866 ATCCCTGGTGACAATCCCAGAGG - Intergenic
927095976 2:19747885-19747907 CTCTCTGGTATCACCCCCAGGGG + Intergenic
927884338 2:26709448-26709470 CTCTCTGGAAACACTCCCCCTGG - Intronic
928604660 2:32934548-32934570 ATCCTTGGGAACAATCCCTGTGG - Intergenic
932404531 2:71504497-71504519 CTGTCTCTTAACACTCCCTGTGG + Intronic
935200958 2:100856170-100856192 ATTACAGGTAACTCTCCCTGTGG + Intronic
939816788 2:146906358-146906380 AGCTCTGGTCTCACTCCATGAGG + Intergenic
942824713 2:180161529-180161551 ATGTCAGTTAAGACTCCCTGAGG + Intergenic
943576941 2:189641061-189641083 ATCTCTAGTAACTATCACTGGGG - Intergenic
944278742 2:197870580-197870602 AAATATGGTAACACTCTCTGAGG - Intronic
945497565 2:210527569-210527591 ATATCAGGAAACACTTCCTGAGG - Intronic
1169571660 20:6913054-6913076 ATGCCTGGTACCACTGCCTGAGG - Intergenic
1170774065 20:19359822-19359844 CTCAGTGGTAACACTCCCTATGG - Intronic
1173329723 20:42064922-42064944 ATCTCTTGGGACACTCACTGTGG + Intergenic
1174796260 20:53525077-53525099 ACCCCTGGAAACACTCCCTCCGG + Intergenic
1178347874 21:31847490-31847512 ATATTTGCTATCACTCCCTGTGG - Intergenic
1179066001 21:38025377-38025399 ATCTCTGGCATCACTCTCTGTGG + Intronic
1180469617 22:15642937-15642959 ATCACTGGCTACACTGCCTGCGG + Intergenic
1181767304 22:25101131-25101153 ATCTTTGGCCACACTGCCTGGGG - Intronic
1182310257 22:29399699-29399721 TCCTGTGATAACACTCCCTGTGG + Intronic
1182690975 22:32162326-32162348 TCCTGTGATAACACTCCCTGTGG - Intergenic
950148728 3:10669676-10669698 GTCTCTGGGCACAGTCCCTGAGG - Intronic
950585069 3:13886565-13886587 TTCTCTGGTCACACTACCTGAGG - Intergenic
950985230 3:17356772-17356794 AGCTATGGAAACACACCCTGGGG + Intronic
954838042 3:53487908-53487930 TTATCTGGTAACCCTACCTGGGG + Intergenic
956593625 3:70943282-70943304 ATCTTTGGAAACTATCCCTGGGG + Intergenic
957228684 3:77482499-77482521 ATCTCTGGTAACACTCCCTGTGG + Intronic
961989763 3:131175999-131176021 AGCTTTGTTAACACTCCTTGTGG - Intronic
966411043 3:179646114-179646136 ATATATGGTAAGACTCACTGTGG - Intergenic
966884789 3:184371128-184371150 ATCAGTGGTTACACGCCCTGTGG - Intronic
970360717 4:15306170-15306192 ATCTCTGGGAGGACTCACTGAGG - Intergenic
971431751 4:26575451-26575473 ATCTCTGGGAAAACTTCCTCTGG - Intergenic
971452300 4:26811504-26811526 ATTTCTGGTAACACTATCTCTGG - Intergenic
972774376 4:42227827-42227849 ATCTCTGAAAGCACTCCCTCGGG - Intergenic
976907366 4:90256365-90256387 ATCTATGGTAAAATTCTCTGGGG + Intronic
980905075 4:138940329-138940351 ATATCAGGTAACTCTCCCTAAGG + Intergenic
981138608 4:141240580-141240602 ATCTCTGGTCACATGTCCTGGGG + Intergenic
981175269 4:141675604-141675626 ATCACTAGTGACACTTCCTGTGG - Intronic
990480148 5:56202488-56202510 ATCTCAGGAAATACACCCTGAGG - Intronic
992299713 5:75365840-75365862 ACCTCTGCTGACAATCCCTGTGG - Intergenic
992494968 5:77282924-77282946 ACCTCGGGGAGCACTCCCTGGGG + Intronic
992787379 5:80183155-80183177 ATCTCTGGTTTCTCTGCCTGGGG - Intronic
999447802 5:151654665-151654687 CTCTCAGGTAACATCCCCTGTGG + Intergenic
1000401630 5:160834730-160834752 ATTTTTGGTTACACTCCTTGTGG + Intronic
1001110848 5:168895001-168895023 AGCTCTGGAAACCCTCCCAGAGG + Intronic
1002272868 5:178084150-178084172 GTCTCCGGTTACACTCCCTCGGG + Intergenic
1004218510 6:13724481-13724503 GTCACTGGCAACATTCCCTGTGG + Intergenic
1008046455 6:46856165-46856187 ATCTCTAGTCCCACTCCCAGAGG + Intronic
1009746096 6:67818087-67818109 ATCTCTGGTATCTTTCTCTGTGG - Intergenic
1011370433 6:86631639-86631661 ATCTCTATTAACACTCCCTAAGG + Intergenic
1012192628 6:96299477-96299499 ATCGCTGGTAACACCACCTTAGG - Intergenic
1012718178 6:102702838-102702860 ATCTCATGTACCAATCCCTGAGG - Intergenic
1017499284 6:155008637-155008659 TTCTCTGGGCACACTGCCTGCGG - Intronic
1018568738 6:165184885-165184907 ATCTGTGCAAACACTCCCAGGGG - Intergenic
1019924469 7:4182984-4183006 ATCACTGGTCAGTCTCCCTGAGG + Intronic
1024435047 7:49342261-49342283 AACTCTGGGCACACTACCTGTGG + Intergenic
1025846931 7:65207956-65207978 ATCCCTGTTAACTCTCACTGAGG + Intergenic
1025897178 7:65713847-65713869 ATCCCTGTTAACTCTCACTGAGG + Intergenic
1026283029 7:68938554-68938576 ATCCCTGGAACCACTCCCAGTGG + Intergenic
1027470513 7:78567821-78567843 CTCTATGGTAAAACTCCCTATGG + Intronic
1029504809 7:100956670-100956692 ATGTCTGCTACCACTCCCAGTGG + Exonic
1029901859 7:104049448-104049470 ATCTCTGACAAAACTCCCTGTGG - Intergenic
1034907688 7:154965141-154965163 ATCTTGGGTCACACCCCCTGGGG + Intronic
1037217627 8:16476969-16476991 ATCTCTGGTAACAGACCTTAAGG - Intronic
1039359039 8:36855328-36855350 ATATTTGATAACACTCCCTGGGG + Intronic
1040448536 8:47521204-47521226 ATCTCTGGTAAAACTGAATGAGG - Intronic
1044500565 8:92950289-92950311 ATATCTGATAAAAATCCCTGGGG - Intronic
1048226505 8:132592323-132592345 AGCTCAGATAACACTCCCTCGGG - Intronic
1053650949 9:40169375-40169397 ATCTCTAGTCCCACTCCCAGAGG - Intergenic
1053901337 9:42798728-42798750 ATCTCTAGTCCCACTCCCAGAGG - Intergenic
1054533631 9:66206828-66206850 ATCTCTAGTCCCACTCCCAGAGG + Intergenic
1056461329 9:86812339-86812361 CTCTCTGGAAACACTCCCTGTGG - Intergenic
1056831449 9:89920376-89920398 TTCTCAGACAACACTCCCTGGGG - Intergenic
1188306021 X:28560605-28560627 ATCATTGGGAACACTCCATGAGG + Intergenic
1188842373 X:35032031-35032053 ATGTCTGGTAGCGGTCCCTGGGG + Intergenic
1189308195 X:40003096-40003118 ATTTCTGGTGACATTCTCTGGGG - Intergenic
1189870756 X:45380862-45380884 CTCTCTTGTAATACTCCCTTTGG - Intergenic
1195487543 X:105426354-105426376 ATCTCATGTATCACACCCTGAGG - Intronic