ID: 957232110

View in Genome Browser
Species Human (GRCh38)
Location 3:77533444-77533466
Sequence GGCCAGGTTGCACTCTCCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 145}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957232108_957232110 -7 Left 957232108 3:77533428-77533450 CCAAAATCAAGATATTGGCCAGG 0: 2
1: 2
2: 29
3: 125
4: 662
Right 957232110 3:77533444-77533466 GGCCAGGTTGCACTCTCCTCCGG 0: 1
1: 0
2: 2
3: 15
4: 145
957232106_957232110 10 Left 957232106 3:77533411-77533433 CCTAAGGGTTTCACAGACCAAAA 0: 1
1: 0
2: 1
3: 19
4: 200
Right 957232110 3:77533444-77533466 GGCCAGGTTGCACTCTCCTCCGG 0: 1
1: 0
2: 2
3: 15
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957232110 Original CRISPR GGCCAGGTTGCACTCTCCTC CGG Intronic
901678605 1:10900731-10900753 GTCCAGCTTGCCCCCTCCTCTGG - Intergenic
902795573 1:18798809-18798831 TGGCATGTTCCACTCTCCTCTGG - Intergenic
905257536 1:36694555-36694577 GGCCAGGCTGCACTCTTCTCAGG - Intergenic
907417147 1:54322453-54322475 GGCCAGGAGGCAATCCCCTCCGG + Intronic
908729626 1:67212681-67212703 GGCATGGTGGCACTCTCCTGTGG - Intronic
911083533 1:93957045-93957067 AGCCAGGTGGGACTGTCCTCAGG + Intergenic
915262661 1:154689240-154689262 GGCCAGGCTGCATTCTTGTCTGG + Intergenic
918805147 1:189031158-189031180 AGTCAGGTTGCATTCTCATCTGG - Intergenic
920229986 1:204463849-204463871 GGCCACGTAGCACTTTCCCCAGG - Intronic
922096122 1:222444423-222444445 GGGGAGGCTGCACCCTCCTCTGG - Intergenic
922619409 1:226980875-226980897 GGCCAGGCTGCACCCGGCTCCGG + Intronic
923265380 1:232308660-232308682 GGCCAGGCTGTATTCTCATCTGG - Intergenic
1063131357 10:3180475-3180497 GGCCGGGTTGCATTCCCTTCCGG + Intergenic
1065408765 10:25398117-25398139 GGCTAGGCTGCATTCTCATCTGG - Intronic
1067407126 10:46033371-46033393 GGCCAGGCCTCATTCTCCTCTGG - Exonic
1067970148 10:50960479-50960501 GGCAAGGTAGGAGTCTCCTCTGG + Intergenic
1069519228 10:69105141-69105163 GGCAAGGTGGCTCTCTCCTGAGG - Intergenic
1069885900 10:71623430-71623452 GGCCAGGCTGCAGCCTCATCGGG + Intronic
1070493981 10:77004531-77004553 GGCCAGGAAGAGCTCTCCTCTGG + Intronic
1070587256 10:77775675-77775697 GGTCAGTTTCCCCTCTCCTCTGG + Intergenic
1070713508 10:78700731-78700753 AGCCAGGCTGCATTCTCCCCTGG - Intergenic
1073452289 10:103617126-103617148 GGCCACTTTGCACTCTGCCCAGG + Intronic
1074362504 10:112834534-112834556 GGGCAGGTGGCACTGTCCACTGG - Intergenic
1074882190 10:117667850-117667872 GGCCATGTGGCCCTCTCCACAGG - Intergenic
1087825892 11:102764382-102764404 GGCTAGGTTGCATTATCATCTGG + Intergenic
1087956150 11:104290056-104290078 AGCCAGGCTGCATTCTCATCTGG + Intergenic
1089307839 11:117537825-117537847 GGCCAGGAAGAACCCTCCTCTGG + Intronic
1089432273 11:118434987-118435009 GAGCAGGTTGCACTCAGCTCTGG - Exonic
1090845267 11:130524932-130524954 GGCCACGTAGGACTGTCCTCAGG - Intergenic
1091442479 12:522095-522117 GGCCAGGCTGCTCTCTTCTTTGG - Intronic
1091981577 12:4868437-4868459 GGCCATGATGCATTCTCCTGGGG + Intergenic
1092145071 12:6209174-6209196 GGCCAGGCTGGTCTCACCTCAGG + Intronic
1093731239 12:22568069-22568091 GGGCAGGTTGCTCTCCCCTGAGG + Intergenic
1093731247 12:22568114-22568136 GGGCAGGTTGCTCTCCCCTGAGG + Intergenic
1096071923 12:48780237-48780259 GCCCAGCTTGGAGTCTCCTCCGG - Intronic
1097632394 12:62080008-62080030 AGCCAGGCTGCATTCTCATCCGG + Intronic
1097739348 12:63220975-63220997 GGCCAGGATCCACTCTTCACAGG + Intergenic
1097982291 12:65746745-65746767 GTCCCAGTTGCAGTCTCCTCAGG - Intergenic
1103280139 12:119751017-119751039 GGTCAGGGTGCCCTCTCCTGTGG - Intronic
1103370161 12:120413467-120413489 GGCCAGGCTGGTCTCACCTCAGG - Intergenic
1107260700 13:38487375-38487397 GGCCAGGCTGCATCCTCATCTGG + Intergenic
1109218266 13:59614930-59614952 ACCCAGGTAGCACTCTACTCAGG + Intergenic
1109757556 13:66780531-66780553 GGCCAGCTTGCTCTTTCCTTGGG + Intronic
1110184238 13:72654801-72654823 GGACAGGTTGCAGTCTCATGGGG - Intergenic
1112267919 13:97942348-97942370 TGGCAGGTTGTACTTTCCTCAGG - Intergenic
1112610700 13:100952175-100952197 GTCCAGGTTGCTCCCACCTCAGG - Intergenic
1112879129 13:104084621-104084643 GGCCAGAGTGTACACTCCTCGGG - Intergenic
1116034875 14:39615622-39615644 GGCCAGGCAGCACCCACCTCAGG - Intergenic
1118763712 14:68896110-68896132 GGCCAGGCTGCAGACTCCACCGG + Intronic
1121015476 14:90546352-90546374 GCCCGGCTTGCTCTCTCCTCCGG + Intronic
1121180108 14:91922548-91922570 GGCCAGGTGGCACTGGCCTGTGG - Intronic
1123998304 15:25733991-25734013 GGCCTGGCTGCACTCCCCCCGGG - Intronic
1124009957 15:25830270-25830292 GGCCAGGCTCCACTCTCCTAAGG + Intronic
1124594899 15:31084045-31084067 GGCCAGGGTTCCCTTTCCTCCGG + Intronic
1124661703 15:31555114-31555136 GGCCTGATTCCACTCTCCTGGGG - Intronic
1126401262 15:48273169-48273191 GGCCAGGCTGCATTCCCTTCCGG + Intronic
1127739195 15:61882595-61882617 GGCCAGGTTGTACTGGCTTCAGG - Exonic
1130243235 15:82218068-82218090 GGCCAGGGTGCATTCTCATCTGG - Intronic
1130457217 15:84123222-84123244 GGCCAGGGTGCATTCTCATCTGG + Intergenic
1132372676 15:101309216-101309238 GGCCAGGCTGGGCTCTCCTCTGG + Intronic
1135277569 16:21126842-21126864 ATCCAGGTTGCACACTCCTTAGG + Intronic
1144678240 17:17175461-17175483 GGCCATGCTGCACTCCCCTGGGG - Intronic
1147635382 17:41960763-41960785 GGCCTGGATGCACTCTCTTGTGG - Intronic
1148211786 17:45813166-45813188 GGCCAGTTGGCACTGTCCACTGG - Intronic
1148807322 17:50270543-50270565 GCACAGGTGGCACTCACCTCGGG - Intergenic
1149756014 17:59186532-59186554 GGGCAGGTGGCACACACCTCTGG - Intronic
1150108692 17:62479362-62479384 GCCCAGGTCGCAGGCTCCTCAGG - Intronic
1150600425 17:66646219-66646241 GGCCTGGTTACTCCCTCCTCGGG + Intronic
1150959370 17:69897161-69897183 GGCCAGGCTGCATTTTCATCTGG + Intergenic
1151477457 17:74352210-74352232 GGCCAGGTTGTAGTCTGCTGGGG - Exonic
1152684933 17:81689269-81689291 GGCCCGGCTGCACTCTCCTCTGG - Intronic
1153881024 18:9421941-9421963 GGGCAGGTTGCCTTCTGCTCAGG - Intergenic
1155799387 18:30081789-30081811 GGCCAGGTGGGCCTATCCTCAGG + Intergenic
1160063285 18:75551228-75551250 AGCCAGGCTGCATTCTCCTCTGG + Intergenic
1161208802 19:3055967-3055989 GGCCAGACTGCACATTCCTCGGG + Intronic
1163552716 19:17974408-17974430 GGCCAGGGAGCCCTCACCTCCGG - Intronic
1163621386 19:18362813-18362835 GGCCAGGTTGCACTCCAAACTGG + Intronic
1164443014 19:28293560-28293582 GGCCAGCATGGTCTCTCCTCTGG - Intergenic
1165775146 19:38399932-38399954 GGCCAGGTTAGACCCTCCTCAGG + Intergenic
1167104808 19:47423920-47423942 GCCCAGGTTGCCCTCTCTCCTGG - Intergenic
1167246620 19:48376876-48376898 GGCCAGGAAGCACTTTCTTCAGG + Intergenic
1167717466 19:51153108-51153130 GGCCTGGCTGCCCACTCCTCAGG + Exonic
1168047940 19:53807478-53807500 GACCAGCCTGCACTCACCTCAGG + Exonic
925911337 2:8575387-8575409 GTCCAGGTTCCAGTCTCCTATGG + Intergenic
927185987 2:20482906-20482928 GGCCAGGTTACACTGTTCCCAGG - Intergenic
928425922 2:31177687-31177709 GGGCAGGGTGCACACTCATCAGG - Intronic
929349729 2:40935550-40935572 AGCCAGGCTGCATTCTCATCTGG - Intergenic
932342469 2:70974985-70975007 GGCCAGGTTCCAATGTCCCCTGG + Intronic
933136069 2:78737274-78737296 GGCCAGGCTGCATTCTCATCTGG - Intergenic
934164744 2:89283737-89283759 GGCCAGGCAGCACTGTCCTGTGG + Intergenic
934202530 2:89898787-89898809 GGCCAGGCAGCACTGTCCTGTGG - Intergenic
936924715 2:117724635-117724657 GGCCATTTTGCCCTCACCTCAGG - Intergenic
937092542 2:119216053-119216075 AGCCAGGCTGCACTCTCCCTTGG - Intergenic
937423997 2:121782215-121782237 GGCCACAGTGCACGCTCCTCAGG - Intergenic
1170120843 20:12910122-12910144 GGCCAGGCTGCATTCTTTTCTGG + Intergenic
1170311515 20:14997407-14997429 AGCCAGGTAGTACTCTCCACAGG + Intronic
1170368177 20:15619623-15619645 GGCCATGTTGTAGTCTCCTGAGG + Intronic
1170625973 20:18030478-18030500 GGCCTGGCTGGCCTCTCCTCGGG - Intronic
1174544380 20:51314378-51314400 GGCCGGGCTGCACTCACATCTGG + Intergenic
1176087705 20:63305600-63305622 GGCCGGGTCCCACCCTCCTCTGG + Intronic
1177519930 21:22207876-22207898 AGCCAGATTGCATTCTCATCTGG + Intergenic
1179191111 21:39122121-39122143 TGCCAGGTTGGCCTGTCCTCAGG - Intergenic
1179250816 21:39669878-39669900 GGTCAGGTGGCACACTCCTTGGG - Exonic
1181632213 22:24157185-24157207 GGCCAGGTTGAACACCCCTAGGG - Intronic
1184318937 22:43724047-43724069 GGCCAGGCTGCACTTCCTTCAGG + Intronic
950257463 3:11517589-11517611 GGCCAGGCAGTACCCTCCTCTGG - Intronic
954698108 3:52438104-52438126 GGCCAGGCAGCACTCTGCACAGG + Exonic
955810028 3:62778128-62778150 GGAGAGGTTGAACTTTCCTCAGG + Intronic
957232110 3:77533444-77533466 GGCCAGGTTGCACTCTCCTCCGG + Intronic
960078132 3:113512069-113512091 GGCCAGTATGCATTCTCATCTGG - Intronic
962948710 3:140198438-140198460 GGCTGGGCTGCACTCTCCTCTGG + Intronic
967182242 3:186916203-186916225 GGCCAGGTAGCTCTTCCCTCTGG + Intergenic
969940313 4:10725257-10725279 TGCCAGGGTCCCCTCTCCTCTGG + Intergenic
971072326 4:23109024-23109046 GACCTGGCTGCATTCTCCTCTGG + Intergenic
971470338 4:27018223-27018245 GGCCAGGCTGCATTCTCATCTGG + Intronic
975721557 4:77253427-77253449 GGCCAGGGTACACCCTCATCAGG + Intronic
978713825 4:111817602-111817624 GACCAGGCTGCATTCTCCTTTGG - Intergenic
983568734 4:169181792-169181814 GGCCAGTATCCACTCTTCTCTGG - Intronic
983622683 4:169776528-169776550 GGCCAGGTGGTACTCACCTGTGG + Intergenic
983819474 4:172175019-172175041 TGCCAGTTTGCACTCTCTTAGGG - Intronic
987566194 5:19589800-19589822 TGCCATGTTTCACTCACCTCAGG + Intronic
987603848 5:20107640-20107662 GGCAAGGTTGCTTTCTCCTGAGG + Intronic
990039396 5:51361363-51361385 GGCCAGGCTGCCCTGACCTCAGG - Intergenic
990435739 5:55789771-55789793 GGACAGGTTGCACACTCATGAGG + Intronic
991475192 5:67011250-67011272 GGCCAGGCTTCAGTCTCCTGTGG - Intronic
997508255 5:134435311-134435333 GGCCAGGTGGGGCTCGCCTCAGG - Intergenic
997671615 5:135679361-135679383 GGCCAGGTGGATCTGTCCTCAGG + Intergenic
999223581 5:150001157-150001179 GCGCAGCTTGCACGCTCCTCCGG + Exonic
999548837 5:152661533-152661555 GGCCAGGATGCTCTGTCCACAGG - Intergenic
1001887724 5:175310615-175310637 GGCCAGGCTGCATTCTTCTCTGG - Intergenic
1001887999 5:175313192-175313214 GGCCAGGCTGCATTCTTCTCTGG + Intergenic
1001963788 5:175896106-175896128 GACCAGGCTGCAAACTCCTCTGG + Intergenic
1003221333 6:4163562-4163584 GCCCAGGCTGGACTCTTCTCGGG + Intergenic
1006541678 6:34745047-34745069 GGGCAGGTTGCACTCGGGTCTGG + Intergenic
1007783372 6:44266588-44266610 TGCTGGGTTGCACTCTGCTCAGG + Intergenic
1009879732 6:69551457-69551479 GGCAAGGGTGCACTCCCCTGTGG + Intergenic
1012012523 6:93807207-93807229 TGCCAGGCTGCACCCTCATCTGG + Intergenic
1012765135 6:103357830-103357852 GGCCAGGTGGATCTGTCCTCAGG - Intergenic
1013647821 6:112162920-112162942 GGCCATGTTGATCTCTGCTCTGG - Intronic
1019774653 7:2905494-2905516 GGCCAGGTTGCACCCTCACGGGG - Intergenic
1022404064 7:30070255-30070277 TGCCAGGTGGAACTCTCCTTTGG + Intronic
1024897285 7:54274899-54274921 GGCCAGGTGGCACTATTCTTTGG + Intergenic
1028492168 7:91424565-91424587 CTCCAGGTGGCACCCTCCTCTGG - Intergenic
1032037711 7:128531872-128531894 GCCCAGGTCGCAGGCTCCTCAGG - Intergenic
1032727082 7:134600241-134600263 GGCCAGGCTGGGCTCTTCTCTGG + Intergenic
1033013134 7:137643758-137643780 TGCCATATTGCACTCTCTTCTGG - Intronic
1034686949 7:152980585-152980607 GGCTGGGATACACTCTCCTCAGG - Intergenic
1035812771 8:2506303-2506325 GACCTGGTTGCATTCTCCTCAGG - Intergenic
1035814751 8:2527342-2527364 GGGCAGGCTGCACACACCTCTGG - Intergenic
1037317989 8:17617016-17617038 GCCCAGGCTGCTCTCTCCTGGGG - Intronic
1037467129 8:19171930-19171952 GGCCAGGTTCCATTCTCCCAAGG + Intergenic
1037983296 8:23270606-23270628 GGCCAGGTGGCACACGCCTGTGG + Intronic
1038225565 8:25654127-25654149 GGCCAGGTGGCTCTATCCTCAGG + Intergenic
1038997864 8:32945631-32945653 GTCCAGGTGGGACTGTCCTCAGG + Intergenic
1048276591 8:133070757-133070779 GGCCTGTGTGCATTCTCCTCTGG - Intronic
1048281107 8:133106230-133106252 GGCCACACTGCCCTCTCCTCAGG - Intronic
1049849736 8:144824454-144824476 GGCCAGGCTGGTCTCACCTCAGG + Intergenic
1061556731 9:131374894-131374916 GACCAGCTTGCACCCTCCCCAGG + Intergenic
1062249496 9:135587202-135587224 GGCCTGGCTTCACTCTCCTTTGG - Intergenic
1189019398 X:37318862-37318884 GGCCAGCTTGGACACTTCTCTGG + Intergenic
1192103853 X:68294170-68294192 GGCCAGGTTACTCTTTTCTCAGG - Intronic
1193509432 X:82382107-82382129 GGCCAGGTTGGCCTGTCCTCAGG + Intergenic
1199725699 X:150578359-150578381 GGCCAGGCTGCATTCTCATCTGG - Intronic