ID: 957243050

View in Genome Browser
Species Human (GRCh38)
Location 3:77683861-77683883
Sequence TGCCCAAGTTGCATATTTCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957243050_957243054 28 Left 957243050 3:77683861-77683883 CCTCGAAATATGCAACTTGGGCA No data
Right 957243054 3:77683912-77683934 AACGATCAACAGATGGAGGAAGG No data
957243050_957243051 0 Left 957243050 3:77683861-77683883 CCTCGAAATATGCAACTTGGGCA No data
Right 957243051 3:77683884-77683906 TAAAGATTATTTTGAGTCAAAGG No data
957243050_957243055 29 Left 957243050 3:77683861-77683883 CCTCGAAATATGCAACTTGGGCA No data
Right 957243055 3:77683913-77683935 ACGATCAACAGATGGAGGAAGGG No data
957243050_957243052 21 Left 957243050 3:77683861-77683883 CCTCGAAATATGCAACTTGGGCA No data
Right 957243052 3:77683905-77683927 GGCAATCAACGATCAACAGATGG No data
957243050_957243053 24 Left 957243050 3:77683861-77683883 CCTCGAAATATGCAACTTGGGCA No data
Right 957243053 3:77683908-77683930 AATCAACGATCAACAGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957243050 Original CRISPR TGCCCAAGTTGCATATTTCG AGG (reversed) Intergenic
No off target data available for this crispr