ID: 957243054

View in Genome Browser
Species Human (GRCh38)
Location 3:77683912-77683934
Sequence AACGATCAACAGATGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957243050_957243054 28 Left 957243050 3:77683861-77683883 CCTCGAAATATGCAACTTGGGCA No data
Right 957243054 3:77683912-77683934 AACGATCAACAGATGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957243054 Original CRISPR AACGATCAACAGATGGAGGA AGG Intergenic
No off target data available for this crispr