ID: 957245217

View in Genome Browser
Species Human (GRCh38)
Location 3:77707861-77707883
Sequence AGCATTCAGGAGGATCTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957245217_957245222 13 Left 957245217 3:77707861-77707883 CCCTGTAGATCCTCCTGAATGCT No data
Right 957245222 3:77707897-77707919 TAGAACAAAGCTTTGAGGAGTGG No data
957245217_957245221 8 Left 957245217 3:77707861-77707883 CCCTGTAGATCCTCCTGAATGCT No data
Right 957245221 3:77707892-77707914 TCTTTTAGAACAAAGCTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957245217 Original CRISPR AGCATTCAGGAGGATCTACA GGG (reversed) Intergenic
No off target data available for this crispr