ID: 957245795

View in Genome Browser
Species Human (GRCh38)
Location 3:77714212-77714234
Sequence GCCTTTTATGTCATCTACGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957245794_957245795 3 Left 957245794 3:77714186-77714208 CCAAGATATGATTTACTTTAGTA No data
Right 957245795 3:77714212-77714234 GCCTTTTATGTCATCTACGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957245795 Original CRISPR GCCTTTTATGTCATCTACGT TGG Intergenic
No off target data available for this crispr