ID: 957249493

View in Genome Browser
Species Human (GRCh38)
Location 3:77755379-77755401
Sequence TCTTCCACAGGTTAGACAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957249493_957249495 30 Left 957249493 3:77755379-77755401 CCTTTTGTCTAACCTGTGGAAGA No data
Right 957249495 3:77755432-77755454 ACCAAGAAATCTTTTTCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957249493 Original CRISPR TCTTCCACAGGTTAGACAAA AGG (reversed) Intergenic
No off target data available for this crispr