ID: 957254016

View in Genome Browser
Species Human (GRCh38)
Location 3:77813423-77813445
Sequence ACTACTCTGCAGGAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957254007_957254016 12 Left 957254007 3:77813388-77813410 CCCTTCTCATTATTCTACCGTCC No data
Right 957254016 3:77813423-77813445 ACTACTCTGCAGGAGGAGGAAGG No data
957254009_957254016 -5 Left 957254009 3:77813405-77813427 CCGTCCACTCCCTGACTCACTAC No data
Right 957254016 3:77813423-77813445 ACTACTCTGCAGGAGGAGGAAGG No data
957254010_957254016 -9 Left 957254010 3:77813409-77813431 CCACTCCCTGACTCACTACTCTG No data
Right 957254016 3:77813423-77813445 ACTACTCTGCAGGAGGAGGAAGG No data
957254008_957254016 11 Left 957254008 3:77813389-77813411 CCTTCTCATTATTCTACCGTCCA No data
Right 957254016 3:77813423-77813445 ACTACTCTGCAGGAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957254016 Original CRISPR ACTACTCTGCAGGAGGAGGA AGG Intergenic
No off target data available for this crispr