ID: 957257344

View in Genome Browser
Species Human (GRCh38)
Location 3:77855539-77855561
Sequence GTTGACTAACAATCAATGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957257343_957257344 -8 Left 957257343 3:77855524-77855546 CCTGAGAAGTTGCTGGTTGACTA No data
Right 957257344 3:77855539-77855561 GTTGACTAACAATCAATGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957257344 Original CRISPR GTTGACTAACAATCAATGAC TGG Intergenic
No off target data available for this crispr