ID: 957259685

View in Genome Browser
Species Human (GRCh38)
Location 3:77884887-77884909
Sequence TTCCTCAGAGAGACTTTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957259685_957259688 12 Left 957259685 3:77884887-77884909 CCAGCAAAAGTCTCTCTGAGGAA No data
Right 957259688 3:77884922-77884944 AGAGTTGAATAATCATGAGATGG No data
957259685_957259693 27 Left 957259685 3:77884887-77884909 CCAGCAAAAGTCTCTCTGAGGAA No data
Right 957259693 3:77884937-77884959 TGAGATGGAAGGTGGGAACAGGG No data
957259685_957259692 26 Left 957259685 3:77884887-77884909 CCAGCAAAAGTCTCTCTGAGGAA No data
Right 957259692 3:77884936-77884958 ATGAGATGGAAGGTGGGAACAGG No data
957259685_957259689 16 Left 957259685 3:77884887-77884909 CCAGCAAAAGTCTCTCTGAGGAA No data
Right 957259689 3:77884926-77884948 TTGAATAATCATGAGATGGAAGG No data
957259685_957259690 19 Left 957259685 3:77884887-77884909 CCAGCAAAAGTCTCTCTGAGGAA No data
Right 957259690 3:77884929-77884951 AATAATCATGAGATGGAAGGTGG No data
957259685_957259691 20 Left 957259685 3:77884887-77884909 CCAGCAAAAGTCTCTCTGAGGAA No data
Right 957259691 3:77884930-77884952 ATAATCATGAGATGGAAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957259685 Original CRISPR TTCCTCAGAGAGACTTTTGC TGG (reversed) Intergenic
No off target data available for this crispr