ID: 957259689

View in Genome Browser
Species Human (GRCh38)
Location 3:77884926-77884948
Sequence TTGAATAATCATGAGATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957259683_957259689 19 Left 957259683 3:77884884-77884906 CCTCCAGCAAAAGTCTCTCTGAG No data
Right 957259689 3:77884926-77884948 TTGAATAATCATGAGATGGAAGG No data
957259685_957259689 16 Left 957259685 3:77884887-77884909 CCAGCAAAAGTCTCTCTGAGGAA No data
Right 957259689 3:77884926-77884948 TTGAATAATCATGAGATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957259689 Original CRISPR TTGAATAATCATGAGATGGA AGG Intergenic
No off target data available for this crispr