ID: 957261392

View in Genome Browser
Species Human (GRCh38)
Location 3:77906519-77906541
Sequence ATGGAGAAGGAGGCTGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957261386_957261392 26 Left 957261386 3:77906470-77906492 CCATACAATTACTTGAGCAAAGT No data
Right 957261392 3:77906519-77906541 ATGGAGAAGGAGGCTGAAGAAGG No data
957261385_957261392 27 Left 957261385 3:77906469-77906491 CCCATACAATTACTTGAGCAAAG No data
Right 957261392 3:77906519-77906541 ATGGAGAAGGAGGCTGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957261392 Original CRISPR ATGGAGAAGGAGGCTGAAGA AGG Intergenic
No off target data available for this crispr